ID: 1102232902

View in Genome Browser
Species Human (GRCh38)
Location 12:111275827-111275849
Sequence GGTTCAAAGGGGAGAGCTGG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 312
Summary {0: 1, 1: 0, 2: 3, 3: 24, 4: 284}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1102232902_1102232910 -4 Left 1102232902 12:111275827-111275849 CCACCAGCTCTCCCCTTTGAACC 0: 1
1: 0
2: 3
3: 24
4: 284
Right 1102232910 12:111275846-111275868 AACCTCAGGAGAGGCGGCCCAGG 0: 1
1: 0
2: 7
3: 16
4: 173
1102232902_1102232919 22 Left 1102232902 12:111275827-111275849 CCACCAGCTCTCCCCTTTGAACC 0: 1
1: 0
2: 3
3: 24
4: 284
Right 1102232919 12:111275872-111275894 AAGGTCTTGGGCAGGCCACAGGG 0: 1
1: 0
2: 3
3: 17
4: 202
1102232902_1102232917 14 Left 1102232902 12:111275827-111275849 CCACCAGCTCTCCCCTTTGAACC 0: 1
1: 0
2: 3
3: 24
4: 284
Right 1102232917 12:111275864-111275886 CCAGGCTCAAGGTCTTGGGCAGG 0: 1
1: 0
2: 1
3: 21
4: 237
1102232902_1102232912 3 Left 1102232902 12:111275827-111275849 CCACCAGCTCTCCCCTTTGAACC 0: 1
1: 0
2: 3
3: 24
4: 284
Right 1102232912 12:111275853-111275875 GGAGAGGCGGCCCAGGCTCAAGG 0: 1
1: 0
2: 0
3: 50
4: 376
1102232902_1102232909 -10 Left 1102232902 12:111275827-111275849 CCACCAGCTCTCCCCTTTGAACC 0: 1
1: 0
2: 3
3: 24
4: 284
Right 1102232909 12:111275840-111275862 CCTTTGAACCTCAGGAGAGGCGG 0: 1
1: 0
2: 2
3: 19
4: 257
1102232902_1102232913 9 Left 1102232902 12:111275827-111275849 CCACCAGCTCTCCCCTTTGAACC 0: 1
1: 0
2: 3
3: 24
4: 284
Right 1102232913 12:111275859-111275881 GCGGCCCAGGCTCAAGGTCTTGG 0: 1
1: 0
2: 1
3: 17
4: 167
1102232902_1102232914 10 Left 1102232902 12:111275827-111275849 CCACCAGCTCTCCCCTTTGAACC 0: 1
1: 0
2: 3
3: 24
4: 284
Right 1102232914 12:111275860-111275882 CGGCCCAGGCTCAAGGTCTTGGG 0: 1
1: 0
2: 0
3: 13
4: 118
1102232902_1102232918 21 Left 1102232902 12:111275827-111275849 CCACCAGCTCTCCCCTTTGAACC 0: 1
1: 0
2: 3
3: 24
4: 284
Right 1102232918 12:111275871-111275893 CAAGGTCTTGGGCAGGCCACAGG 0: 1
1: 0
2: 0
3: 18
4: 222

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1102232902 Original CRISPR GGTTCAAAGGGGAGAGCTGG TGG (reversed) Intronic
901225535 1:7610995-7611017 GTTGCAAAGGGCAGAGCTAGGGG - Intronic
905132163 1:35769537-35769559 GCGCCAAAGGGGAGGGCTGGCGG + Intronic
906379079 1:45320252-45320274 GGTTCTAAGAGGCGAGCTCGTGG - Intergenic
906518300 1:46452490-46452512 GGTCCAGAGGGAAGAGCTGTTGG + Intergenic
907867178 1:58409755-58409777 GTTTTAAAGGGCAGAGATGGAGG + Intronic
911759504 1:101599705-101599727 GGTTCTAAGAGGTGGGCTGGTGG + Intergenic
911812541 1:102301559-102301581 GATACAAAGGGGAGAACTTGTGG - Intergenic
912814974 1:112821717-112821739 GGTTCTAAGGGGTGGGCTAGTGG + Intergenic
913475116 1:119229694-119229716 GGATAAAAGGGGAGAGAAGGAGG - Intergenic
913551647 1:119922601-119922623 GGTGTAAAGGGGAAAGGTGGCGG - Intronic
914460994 1:147885038-147885060 GGTTCAAAGCTGAGAGCTGGTGG - Intergenic
915113175 1:153577758-153577780 GGTTGGAAGGGCGGAGCTGGTGG - Intergenic
916608095 1:166363004-166363026 CTTTCAAAGGACAGAGCTGGGGG + Intergenic
917930812 1:179821399-179821421 GGCTCAAGAGGAAGAGCTGGGGG - Intergenic
918062365 1:181073039-181073061 GGGGACAAGGGGAGAGCTGGGGG - Intergenic
918356137 1:183707807-183707829 GGTTGAGAGGGGAGAGGTAGGGG + Intronic
919183207 1:194112015-194112037 GGTTCAAAGGAGCAAGCGGGCGG - Intergenic
919318963 1:196009621-196009643 GGTTAGAAGGGGAGAGGAGGTGG + Intergenic
921949545 1:220915239-220915261 TGTTCTAAGGGGACAGCTGAAGG - Intergenic
922573862 1:226649199-226649221 GGTGCAGAGGAGAGAGCTGTGGG - Intronic
922978184 1:229802469-229802491 GGGTCAAATGGGAAAACTGGAGG + Intergenic
923075496 1:230605431-230605453 GGTTCAAAGAGGCGGGCTAGTGG - Intergenic
923261844 1:232275210-232275232 GTGTCAAAGGGGGGACCTGGTGG + Intergenic
923546684 1:234928579-234928601 GTTTGGAGGGGGAGAGCTGGGGG - Intergenic
1062931060 10:1352989-1353011 GGTTCTAAGAGGAGGGCTGGTGG - Intronic
1063446355 10:6120384-6120406 GGTGCAAAGGGGACAGCCAGGGG - Intergenic
1066255944 10:33679031-33679053 GTGTCAAGGGAGAGAGCTGGTGG - Intergenic
1067373571 10:45706977-45706999 GGCTGAAAGGAGAGAACTGGGGG + Intergenic
1067380118 10:45765242-45765264 GGCTGAAAGGAGAGAACTGGGGG - Intronic
1067881393 10:50048748-50048770 GGCTCAAAGGAGAGAACTGGGGG + Intergenic
1067887817 10:50105897-50105919 GGCTGAAAGGAGAGAACTGGGGG - Intronic
1068636349 10:59352288-59352310 TCTTCAAAGCGGAGAGCGGGAGG - Exonic
1069952559 10:72029621-72029643 GGTTCAAAGGGCATGGCTGGGGG - Intergenic
1070224435 10:74486086-74486108 GTGTCAAAGGAGAGACCTGGTGG + Intronic
1070250092 10:74766004-74766026 GGGTGAGAGGGGAGAGCAGGAGG + Intergenic
1070778217 10:79122586-79122608 GGTTGGAAGGGAGGAGCTGGGGG - Intronic
1070807681 10:79279950-79279972 CGTGCAAAGGGGAGAGGGGGAGG + Intronic
1071154124 10:82669970-82669992 GCTCCAAAGGGGAGTGGTGGAGG - Intronic
1071546924 10:86536354-86536376 AGTGCAAAGGGGAGTCCTGGGGG - Intergenic
1072787477 10:98294045-98294067 AGTTCAAAGGGAAGGGCTTGGGG + Intergenic
1073177422 10:101565054-101565076 GGTTGAGCGGGGAGGGCTGGGGG - Intergenic
1073325719 10:102643310-102643332 TTTTCCAAGGGGAGGGCTGGCGG - Intergenic
1073443171 10:103564771-103564793 GGTCCAGAGGGGACAGCTGGAGG - Intronic
1073709215 10:106019291-106019313 GGTTCTAAGAGGCGGGCTGGTGG + Intergenic
1074154574 10:110786994-110787016 GGCTCAATGGGCAGCGCTGGAGG - Intronic
1074741078 10:116484860-116484882 GGTTCTAAGAGGCGAGCTAGTGG - Intergenic
1074800567 10:116996938-116996960 GTTTCAAAGGGGAGAACTGAAGG + Intronic
1077588474 11:3472949-3472971 GGTTCTAAGAGGCGGGCTGGTGG + Intergenic
1077612465 11:3651982-3652004 GGTTCTAAGAGGCGGGCTGGTGG - Intronic
1077627982 11:3790358-3790380 GCTTCATAGGGCAGAGCTGGTGG - Intronic
1077671869 11:4165210-4165232 GGTTCAAAAAGGAGGGCTAGAGG + Intergenic
1077678803 11:4220936-4220958 GGTTCTAAGAGGCGGGCTGGTGG + Intergenic
1077883658 11:6370052-6370074 GGTTCTAAGAGGCGGGCTGGTGG - Intergenic
1078549071 11:12268147-12268169 GGTTCAGGAGGGAGACCTGGAGG + Intergenic
1080169450 11:29281772-29281794 GGTTGTGAGGGGAGGGCTGGGGG + Intergenic
1082064925 11:47892299-47892321 CGTGCAAAGGGGAGAGGGGGAGG - Intergenic
1082942842 11:58726406-58726428 GGTTCAAGGGGGACAGGGGGAGG + Intronic
1083176882 11:60955900-60955922 GTTTTAAAAGGTAGAGCTGGGGG - Intergenic
1083851908 11:65372955-65372977 GGATCACAGAGGAAAGCTGGGGG + Intergenic
1084021262 11:66419777-66419799 GGTGGAAAGTGGAGAGCTGAAGG + Intergenic
1084714130 11:70862993-70863015 GGCTAAAAGGTGTGAGCTGGTGG + Intronic
1084864029 11:72041262-72041284 GCTGCAAAGGGGAAGGCTGGAGG + Intronic
1085175322 11:74481662-74481684 GGTTTACAGGGGAGAGGGGGAGG + Intergenic
1086005288 11:82029265-82029287 GGTTCTAAGAGGTGGGCTGGTGG - Intergenic
1087210595 11:95443022-95443044 GGTTCACAGGGAAGATGTGGCGG + Intergenic
1087850939 11:103028589-103028611 GGCTCAAAGGGGAAAGCCAGAGG - Intergenic
1088060032 11:105636568-105636590 GGGAAAAAGGGGAGAGGTGGTGG - Intronic
1089576389 11:119447412-119447434 GGGTCAGAGGGTGGAGCTGGGGG + Intergenic
1090274421 11:125409580-125409602 GATACAAAGGTGAGAGCTGGAGG + Intronic
1091347729 11:134866543-134866565 GGATCACAGGGGGCAGCTGGAGG - Intergenic
1092281172 12:7098779-7098801 GGTTGTCAGGGGAGAGTTGGAGG + Intronic
1092414737 12:8281714-8281736 GGTTCTAAGAGGAGGGCTAGTGG + Intergenic
1093855397 12:24095689-24095711 GTGTCAAAGGGGAGACCAGGTGG + Intergenic
1093871979 12:24303810-24303832 GGATCAAAGGGGAGAGAGAGGGG + Intergenic
1093951352 12:25167187-25167209 GGTTCTAAGAGGTGGGCTGGTGG - Intronic
1094359526 12:29615288-29615310 GGTTCTTACAGGAGAGCTGGAGG - Intronic
1095829650 12:46570316-46570338 TGTTGAAAGGAGAGTGCTGGAGG - Intergenic
1096112934 12:49039952-49039974 GGTCCACAGGGGAGAGCTATGGG - Exonic
1096413594 12:51394045-51394067 GGGTCAAAGGGCAGAGGTGGAGG - Intronic
1096490280 12:52009269-52009291 GGTCCAAAGGGGTGAGGTGCTGG + Intronic
1102232902 12:111275827-111275849 GGTTCAAAGGGGAGAGCTGGTGG - Intronic
1104409523 12:128546685-128546707 TGTTCAAAGAGGAGGGCGGGTGG + Intronic
1104781282 12:131422108-131422130 GGCTCAGAGGGGACAGGTGGAGG - Intergenic
1106799366 13:33241550-33241572 CGTGCAAAGGGGAGAGGGGGAGG - Intronic
1106958027 13:34964740-34964762 GCTACAAAGGGAAGAGCAGGGGG + Intronic
1107617869 13:42190414-42190436 GGTTCACAGGGGTGAACTGTCGG - Exonic
1108474353 13:50798945-50798967 GGGTGAAAGAGGAGAGTTGGAGG - Intronic
1110234379 13:73201174-73201196 AGTTCAAAGAGGGAAGCTGGAGG - Intergenic
1111846966 13:93522829-93522851 GGTTGAAAGAGAAGTGCTGGTGG + Intronic
1112046146 13:95600321-95600343 AGGTAAAAGTGGAGAGCTGGTGG - Intronic
1113841202 13:113362837-113362859 GGGTCAAAGGGGAGTCCTGGGGG - Intronic
1114194930 14:20469090-20469112 GGTTGCAAGGAGAGGGCTGGGGG + Intronic
1117756988 14:58985255-58985277 GGTTCAAAAAGCAGAGCTGATGG - Intergenic
1117911783 14:60643714-60643736 GGGTAAAAGGGGCGAGCAGGAGG - Exonic
1118678183 14:68211333-68211355 GTTTCAATGGGGAAAGCGGGTGG - Intronic
1118753477 14:68822576-68822598 GGTTCACAGGGGAGCGTTGTGGG - Intergenic
1121703955 14:95977211-95977233 GGTTCTAAGAGGCGGGCTGGTGG - Intergenic
1121760364 14:96439803-96439825 GGTTCAAGAGGAACAGCTGGAGG + Intronic
1121835928 14:97092322-97092344 GCTTCCATGGGCAGAGCTGGTGG + Intergenic
1122041265 14:98989244-98989266 GGTTCTAAGAGGAGGGCTAGTGG - Intergenic
1123922243 15:25078537-25078559 ATTTCAATGGGGAGAGCTGCAGG - Intergenic
1125956221 15:43792745-43792767 GGTCCCAAGGGGCCAGCTGGAGG - Intronic
1126427322 15:48542673-48542695 GGTTCCATGGGGAAAACTGGGGG - Intronic
1127801383 15:62480116-62480138 GAGTAAAAGGGGAGAGCAGGTGG + Intronic
1128089026 15:64906415-64906437 GGTTGCAGGTGGAGAGCTGGAGG + Intronic
1128345139 15:66848675-66848697 GGTTTACAGGAGAGGGCTGGAGG + Intergenic
1129322176 15:74781598-74781620 TGATCAAAGTGGAGAGGTGGTGG - Intergenic
1129743335 15:78000897-78000919 GGCTCTAGGGGGAGAGGTGGTGG - Intronic
1129760224 15:78124946-78124968 GCTGAAAAGGGGAGAGCTGGTGG + Intronic
1130649107 15:85751988-85752010 GGTCCAAAGGAGAGGGCTGCTGG + Intergenic
1131312766 15:91305890-91305912 GGTCAGAAGGGGACAGCTGGTGG + Intergenic
1131685020 15:94758728-94758750 GGTTCTAAGAGGTGGGCTGGTGG - Intergenic
1132203273 15:99969606-99969628 GTGTCAAAGGGGAGGGCTGCTGG + Intergenic
1133035715 16:3033002-3033024 GGGTCAAAGGTGGAAGCTGGGGG + Intronic
1133593328 16:7267008-7267030 GGTTCAAAAGGGTGAGCCAGCGG + Intronic
1133651664 16:7818744-7818766 GGTTCTAAGAGGCGGGCTGGTGG - Intergenic
1135535623 16:23292098-23292120 GGTGCCAAGGGCAGAGCAGGGGG - Intronic
1135537087 16:23302620-23302642 GGGGCGGAGGGGAGAGCTGGAGG + Intronic
1138054140 16:53814708-53814730 AGTTGGAAGTGGAGAGCTGGAGG - Intronic
1139887737 16:70222956-70222978 GGTGAAAAAGGGAGAGATGGAGG - Intergenic
1142635810 17:1256892-1256914 GCTTCAAGGGTGAGAGTTGGAGG + Intergenic
1143157560 17:4848015-4848037 GTTTAAAAGAGGAGAGATGGGGG + Intronic
1143871773 17:9961862-9961884 GTCTCAAAGTGGAGAGATGGCGG - Intronic
1146652162 17:34613619-34613641 GGTTCAAAGGAAAGAGATAGGGG - Intronic
1146660154 17:34660159-34660181 GGTTCCAAGGACAGAGCTGAGGG + Intergenic
1147557885 17:41491079-41491101 GGATCACTGGGCAGAGCTGGAGG + Intronic
1147678270 17:42222315-42222337 GGGTCAAAAGGGGGCGCTGGTGG + Intronic
1148770505 17:50063455-50063477 GGTTCAGAGGGGAGAACTTAGGG - Intronic
1148821636 17:50363457-50363479 GGTTCAGAGGGCAGATTTGGGGG + Intergenic
1149862963 17:60134374-60134396 GTGTCAAAGGAGAGACCTGGTGG - Intergenic
1150969919 17:70016064-70016086 GGTCTAAAGGGGAGAGGTTGTGG + Intergenic
1151681028 17:75622883-75622905 GGTTCAAGGGAGAAGGCTGGAGG + Intergenic
1151862438 17:76774718-76774740 AGGTCAAAGGGGATAGCTTGTGG + Intronic
1153769039 18:8400781-8400803 GGCACAAGGGGGAGAGCTGTAGG - Intronic
1155419631 18:25641158-25641180 GATTCGAAGGGGAGATCTGGGGG - Intergenic
1158682585 18:59581990-59582012 AGATTAAAGGGGAGAACTGGAGG + Intronic
1161663233 19:5560013-5560035 GGCACCAAGGGGAGAGGTGGAGG + Intergenic
1161943217 19:7418778-7418800 GATTCAAGGGGGAGAGAGGGAGG + Intronic
1163369535 19:16894191-16894213 GGTGCAGGGGGGACAGCTGGAGG - Intronic
1163816289 19:19466492-19466514 TGTTCATAAGGGACAGCTGGTGG + Intronic
1163938377 19:20471163-20471185 CATTCAAAAGGGAGAACTGGAGG + Intergenic
1166126672 19:40718883-40718905 GGGTCACAGGGGAGACCAGGTGG - Intronic
1166367809 19:42286119-42286141 GGGGCAAAGGAGAGAGCTGCTGG + Intronic
1167271409 19:48508604-48508626 GGTTCAGAGGGGAGAGGAGCAGG + Intronic
925242817 2:2347575-2347597 GGTTCAGGGGAGAGAGCTGAGGG - Intergenic
926008171 2:9388850-9388872 GGTGCAGAGGGGAGACCTGAAGG - Intronic
926343100 2:11921032-11921054 AGTACAAAGGGCAGAGCTGGAGG - Intergenic
926519067 2:13886725-13886747 TGTTCTAAGGGGAAAGCTGTTGG - Intergenic
928168900 2:28990796-28990818 GGCTCATGGGTGAGAGCTGGAGG + Intronic
928358342 2:30641273-30641295 GTTTCAAAGTGGAGAGCCTGTGG - Exonic
928827873 2:35441969-35441991 GGTTGAAAGGAGAGAGGTTGAGG + Intergenic
928937191 2:36691329-36691351 GGTTGAAAGGGGAGAGATGGTGG + Intergenic
930868771 2:56149053-56149075 TGTTCACAGCAGAGAGCTGGAGG - Intergenic
930958673 2:57232939-57232961 GGTTCCAAGAGGCGGGCTGGTGG - Intergenic
932006005 2:67927570-67927592 GGGTCACAGGGCAGAGTTGGTGG + Intergenic
932445827 2:71780633-71780655 TGTCCAGAGGGGAGAGCTGAAGG + Intergenic
932706071 2:74026092-74026114 GGGGCAAAGGGGAGAGCAGAAGG - Intronic
933506846 2:83187482-83187504 GTTTCAAAGGGCAAAACTGGGGG - Intergenic
933782938 2:85814326-85814348 GGTACAGCCGGGAGAGCTGGTGG + Intergenic
936086579 2:109473623-109473645 GGTTCAAGGGGGAGGGATGAGGG + Intronic
937253329 2:120538017-120538039 GTATCCGAGGGGAGAGCTGGAGG - Intergenic
937902909 2:127036183-127036205 GATACATAGGTGAGAGCTGGTGG + Intergenic
938966251 2:136391301-136391323 GGTTCTAAGGAGAAAGCTGTTGG - Intergenic
939579895 2:143936041-143936063 GGTTTAAAGGTGTGAGCGGGTGG - Intergenic
940352407 2:152704390-152704412 GGTCCAAAGAGGAGAACTGAGGG + Intronic
941262739 2:163317928-163317950 GGGACAGAGGGAAGAGCTGGAGG - Intergenic
941451227 2:165663092-165663114 GATACAAAGGGCAGGGCTGGAGG - Intronic
942590601 2:177542332-177542354 GGTTCAAAAGGGAGTGCTTCAGG - Exonic
946229492 2:218282674-218282696 GGCTCAAAGTGGAGAGCCGGGGG + Intronic
947903940 2:233745919-233745941 GATTCAGAAGGGACAGCTGGGGG + Intronic
947905343 2:233757274-233757296 GATTCAGAAGGGACAGCTGGGGG + Intronic
948424961 2:237881457-237881479 GGACCAAAGGTGAGAGCAGGAGG + Intronic
948726475 2:239937071-239937093 GGAGCAGAGGGGAGGGCTGGGGG + Intronic
948739196 2:240031707-240031729 GGTTTGCTGGGGAGAGCTGGCGG + Intergenic
1168739569 20:176284-176306 GGTTCTAAGAGGTGGGCTGGTGG - Intergenic
1171290124 20:23978451-23978473 AGCACAAAGGGGAGAGATGGAGG + Intergenic
1174611400 20:51801354-51801376 GTGTGAAAGGGGAGAGGTGGGGG - Intronic
1176299937 21:5094816-5094838 GATTCGGAGGGGAGAGCTGGGGG - Intergenic
1177295277 21:19165603-19165625 GGGGCAAAGGGGACAGATGGAGG + Intergenic
1178375956 21:32067669-32067691 GGATCAGGGAGGAGAGCTGGGGG + Intergenic
1179557251 21:42187651-42187673 GGTGTAGAGGTGAGAGCTGGGGG + Intergenic
1179857085 21:44167095-44167117 GATTCGGAGGGGAGAGCTGGGGG + Intergenic
1180557007 22:16586202-16586224 GGTTCCAAGGAGTGAGATGGGGG - Intergenic
1181401872 22:22654444-22654466 AGCACAAAGGGGAGAGATGGAGG - Intergenic
1182043516 22:27257005-27257027 GGTTCAAAGGGGGAGGCTGGGGG - Intergenic
1182998870 22:34838364-34838386 GGTTCTAAGAGGTGGGCTGGTGG - Intergenic
1183268279 22:36844415-36844437 AGAACAAAGGGGAGAGGTGGTGG - Intergenic
1184206034 22:43003906-43003928 GGCACAAAAGGGAGAGCTGCTGG - Intronic
1184692524 22:46123734-46123756 GGTCCAGCTGGGAGAGCTGGTGG - Intergenic
949827710 3:8181057-8181079 GGTTCTAAGGGGCGGGCTAGTGG - Intergenic
950926762 3:16748363-16748385 GGTTCTAAGGGGCGGGCTAGTGG - Intergenic
952211727 3:31234817-31234839 GCATCAAAGGGGAGAACTAGAGG + Intergenic
953093842 3:39755599-39755621 GGATCAAGGGAGAGACCTGGTGG - Intergenic
953114950 3:39983581-39983603 GGATCCCAGGGGAGGGCTGGGGG + Intronic
953834091 3:46328222-46328244 GGTTCTAAGAGGAGGGCTAGTGG + Intergenic
955406104 3:58626841-58626863 AGTTCCAGGGGGAGGGCTGGTGG + Intronic
960583267 3:119298209-119298231 GGTTCCCAGGGGAGAGCTGGGGG - Intronic
961037027 3:123649421-123649443 GGGACAGAGGGGAGACCTGGTGG - Intronic
961372300 3:126439031-126439053 GCTGCAGAGGGGTGAGCTGGAGG - Intronic
961921139 3:130427870-130427892 GGTTCAAAGGGAGGAGATAGTGG + Intronic
963925266 3:150944467-150944489 TTTTCAGAGGGGAGAGATGGGGG + Intronic
964843169 3:161016491-161016513 GGTTGAAGGAGGAGAGATGGAGG + Intronic
966535337 3:181027103-181027125 GTGTCAAGGGAGAGAGCTGGTGG + Intergenic
966851628 3:184168423-184168445 GGCTTAAAGGGAAGAACTGGAGG + Intronic
968545598 4:1196107-1196129 GGTTCACAGGGGAGAGGCAGAGG - Intronic
968624163 4:1619022-1619044 CGTCCACAGGTGAGAGCTGGGGG + Intronic
968878849 4:3288387-3288409 GGCCCAGAGGGGAGTGCTGGTGG - Intergenic
968993648 4:3931419-3931441 GGTTCTAAGAGGAGGGCTAGTGG - Intergenic
969384925 4:6837900-6837922 CGTGCAAAGGGGAGAGGGGGAGG + Intronic
969989782 4:11250243-11250265 GTTCCAAAGGGTAGAACTGGTGG - Intergenic
970697823 4:18698190-18698212 GGTTCAAAGAGGGGACCAGGTGG + Intergenic
971267205 4:25106215-25106237 GAATCTAAGAGGAGAGCTGGAGG - Intergenic
972359793 4:38316288-38316310 GGTCCCAAGGAGAGGGCTGGGGG - Intergenic
973875939 4:55218583-55218605 GGGTCAAAAGGAAGAGGTGGAGG - Intergenic
973896372 4:55417654-55417676 GGTTCAGAGGGGAGGTTTGGGGG + Intronic
977577247 4:98688452-98688474 AGTTCAAAGTGGTGAGGTGGTGG - Intergenic
977770229 4:100849351-100849373 GATTCAAAGGCAAGAGCTGCTGG - Intronic
978235483 4:106452858-106452880 CGTTCAAAGTGCAGAGGTGGTGG + Intergenic
979941602 4:126770593-126770615 CGTGCAAAGGGGAGAGGGGGAGG - Intergenic
980076955 4:128303857-128303879 GGATGATGGGGGAGAGCTGGTGG + Intergenic
980782180 4:137505208-137505230 GTTTCAAAGGAGAGACCAGGTGG - Intergenic
982281004 4:153683992-153684014 GGGTCGAAGAAGAGAGCTGGGGG - Intergenic
985382096 4:189405331-189405353 GGTTTGAAGGAGAGACCTGGTGG + Intergenic
985489844 5:172647-172669 GGGTCAAACGGGAGGGTTGGGGG + Intronic
985573893 5:664908-664930 GTTTGAGAGGGGAGTGCTGGGGG + Exonic
985648045 5:1094343-1094365 GGTTTAGAGGTGACAGCTGGTGG - Intronic
986389144 5:7267632-7267654 GGTTCTAAGAGGCGAGCTAGTGG - Intergenic
989398692 5:40985854-40985876 GTTTGAAAGGGGTGGGCTGGAGG + Intergenic
995124896 5:108570141-108570163 GGTTCTAAGAGGTGGGCTGGTGG + Intergenic
997512378 5:134462447-134462469 GGTTGTAAAGGGAGTGCTGGAGG - Intergenic
997615978 5:135246445-135246467 GGTGCAAAGGGGAGGGTAGGTGG + Intronic
999177714 5:149643051-149643073 GGTGAAATGGGGAGGGCTGGAGG - Intergenic
999479609 5:151935407-151935429 GGCCCAAAGCAGAGAGCTGGGGG - Intergenic
1000163672 5:158626373-158626395 GGTTAAGAGGAGAGGGCTGGCGG + Intergenic
1001480633 5:172086820-172086842 GGTCAAAAGGGGAGACCTCGAGG - Intronic
1001646852 5:173288538-173288560 GGTGCAAAGGCGGGAGGTGGGGG + Intergenic
1001761214 5:174209945-174209967 GGTGAAGAGGGGTGAGCTGGGGG + Intronic
1001761221 5:174209966-174209988 GGTGAAGAGGGGTGAGCTGGGGG + Intronic
1002618022 5:180467521-180467543 GGGTCAAATTAGAGAGCTGGTGG + Intergenic
1005927043 6:30452811-30452833 GGTCCACAGGGGAGGGCTGGGGG + Intergenic
1008378252 6:50815446-50815468 GGTGCAAAGGTGAGGGCTAGTGG + Intergenic
1008849941 6:56012485-56012507 GGTTCTAAGAGGCGGGCTGGTGG + Intergenic
1009682709 6:66919604-66919626 GGGTCAAGGGAGAGATCTGGTGG - Intergenic
1010332367 6:74638627-74638649 GTTTCAAAGGGCAGAGATGCAGG - Intergenic
1011254738 6:85408675-85408697 GGTTTTAAGGGGAGAGATGCAGG + Intergenic
1011558988 6:88596355-88596377 GATTCTTAGGGGTGAGCTGGGGG - Intergenic
1012653350 6:101784619-101784641 GTTTCAAGGGAGAGACCTGGTGG + Intronic
1013823063 6:114178768-114178790 TTTTCAAAGGGGAGAGATGAGGG + Intronic
1014396339 6:120929218-120929240 GGTTCAAAGAGGCGGGCTAGTGG - Intergenic
1014862536 6:126487135-126487157 AGTTCAAAGGTGAGGGGTGGGGG + Intergenic
1017249061 6:152260471-152260493 GTTTCCCAGGGCAGAGCTGGTGG + Intronic
1017270185 6:152495078-152495100 GGTTCTAAGAGGAGGGCTAGTGG - Intronic
1018949756 6:168371441-168371463 GGGTCAGAGGTGAGAGCTGCTGG + Intergenic
1019427882 7:985924-985946 GGTTCACAAGCGAGAGCAGGGGG + Intronic
1019904904 7:4054579-4054601 GGTTAGAAAGGAAGAGCTGGAGG - Intronic
1019998508 7:4740934-4740956 TCTTCAGAGGGGAGATCTGGGGG - Exonic
1021441526 7:20682440-20682462 GGTTAAAAGGTGGGAGTTGGGGG + Intronic
1021593776 7:22293334-22293356 GATTCCAAGGGGAGAGCTGAGGG - Intronic
1021637654 7:22707666-22707688 GGTTCTAAGGGGTGGGCTAGTGG - Intergenic
1022177861 7:27889281-27889303 GGTTCAATGGGGAAATATGGGGG + Intronic
1023002565 7:35825945-35825967 AGTAAAAAGAGGAGAGCTGGGGG + Intronic
1024642351 7:51340636-51340658 GGTGCAAAGGGGAGAGTTTCAGG + Intergenic
1026729144 7:72896056-72896078 AGTTCAAAGGGGAGAGTAAGGGG + Intronic
1027114862 7:75471058-75471080 AGTTCAAAGGGGAGAGTGAGGGG - Intronic
1028310688 7:89330207-89330229 GGTTTCAAGGGGCGGGCTGGTGG + Intronic
1029728599 7:102424934-102424956 CTTTCAAAGAGGAGAGCTGATGG - Intronic
1030521054 7:110598665-110598687 GGTTTAAAGGAGGCAGCTGGTGG - Intergenic
1030849131 7:114460864-114460886 GGTTGAAAGGGGAGAACTTGGGG + Intronic
1032487767 7:132300826-132300848 GGTCCCCAGGGGAGTGCTGGCGG + Intronic
1034469686 7:151248636-151248658 GACTCAGAGGGGAGAGTTGGAGG - Exonic
1035483806 7:159206845-159206867 GGTGCAAAGGAGAGAGGTGGGGG + Intergenic
1035483829 7:159206970-159206992 GGTGCAAAGGAGAGAGGTGGGGG + Intergenic
1036072256 8:5454075-5454097 CTTTCACAGTGGAGAGCTGGTGG - Intergenic
1036471687 8:9058124-9058146 GGGTCAAAGGCAGGAGCTGGAGG + Intronic
1038319426 8:26513941-26513963 GGTGCTCAGGGGAGGGCTGGAGG - Exonic
1038614005 8:29076341-29076363 GGTCCACAGGGCACAGCTGGTGG + Intronic
1039020471 8:33199018-33199040 GGATAAAAGGGGAGAAATGGAGG + Intergenic
1039195695 8:35028991-35029013 GGGTCAAGGGGTAGAGCTGGAGG + Intergenic
1039228855 8:35420637-35420659 GGGACAAAGGGGAGAGTAGGAGG - Intronic
1041292330 8:56319654-56319676 GGTTGAAAGGGGTGATATGGGGG + Intronic
1041353644 8:56976148-56976170 GGGTAAAAGGGGAGACGTGGAGG - Intronic
1042345621 8:67724368-67724390 AGTTGAAAGGGGAGACGTGGGGG - Intronic
1044006618 8:86944658-86944680 GAGTCAAATGGGAGACCTGGTGG + Intronic
1047971422 8:130087810-130087832 GATTCACAGGGGAGATTTGGGGG - Intronic
1049039964 8:140105104-140105126 GTTGGAAAGGGGAGACCTGGGGG - Intronic
1050828120 9:9975275-9975297 GGTTCAAAGAGAGGAGCTAGAGG - Intronic
1051085104 9:13339416-13339438 GTGTCAAAGGAGAGACCTGGTGG - Intergenic
1052720349 9:32166003-32166025 GGTTCTAAGAGGCGGGCTGGTGG + Intergenic
1053136194 9:35651406-35651428 GGTTGAAAGGGGAGGTTTGGGGG - Intergenic
1055347448 9:75353452-75353474 GGTTCTAAGAGGTGGGCTGGTGG + Intergenic
1055781940 9:79829913-79829935 GGATCAAAGCAGAGAGTTGGTGG + Intergenic
1057568968 9:96189247-96189269 GGGTCAATAAGGAGAGCTGGGGG + Intergenic
1058684172 9:107465987-107466009 GGTGCAAATGGGAGCGCTCGCGG - Intergenic
1059803820 9:117777068-117777090 GGCTGAAAGGGGAGATATGGTGG + Intergenic
1060286475 9:122257889-122257911 GGTTTAAACAGGAAAGCTGGAGG + Intronic
1060884864 9:127144015-127144037 GGCTCAAAGAGGGGATCTGGGGG - Intronic
1060967778 9:127721248-127721270 GGGTCAGCGGGGAGGGCTGGAGG + Intronic
1062011728 9:134270817-134270839 GGCTGAAAGGGGTGAGCTGGGGG + Intergenic
1062229253 9:135472347-135472369 TGCCCAGAGGGGAGAGCTGGGGG - Intergenic
1062261160 9:135663909-135663931 GGGACATAGGGGAGACCTGGGGG + Intronic
1188380140 X:29481564-29481586 GCTTCAAAAGAGAGAACTGGAGG + Intronic
1190082924 X:47370968-47370990 GGTTAAGAGGGGAGTGATGGAGG - Intronic
1190444666 X:50511952-50511974 GCTTGAGAGGGGAGAGTTGGAGG - Intergenic
1192192485 X:68999917-68999939 GTTTCAAAGGAGAGGGCTGGTGG - Intergenic
1192496511 X:71619922-71619944 AGGGCAAAGGGGAGAGCTGAGGG - Intergenic
1192706788 X:73534450-73534472 GGAATAAAGGAGAGAGCTGGGGG - Intergenic
1194768677 X:97873487-97873509 TGTTCATAGAGGTGAGCTGGAGG + Intergenic
1195944997 X:110200150-110200172 GTTTCAAAGAGGTCAGCTGGGGG - Intronic
1196742014 X:119033441-119033463 GTTTGAAGGGGGTGAGCTGGAGG - Intergenic
1199382733 X:147189914-147189936 GGTGAAAAGGGGAGTGCTAGGGG - Intergenic
1199383637 X:147199256-147199278 GGATGAAAGGGGAGCACTGGGGG - Intergenic
1199385005 X:147213695-147213717 GATGAAAAGGGGAGTGCTGGGGG - Intergenic