ID: 1102233117

View in Genome Browser
Species Human (GRCh38)
Location 12:111277226-111277248
Sequence CCCTCCCTGCGCAGGCTGGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 512
Summary {0: 1, 1: 0, 2: 4, 3: 44, 4: 463}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1102233117_1102233126 -3 Left 1102233117 12:111277226-111277248 CCTCCCAGCCTGCGCAGGGAGGG 0: 1
1: 0
2: 4
3: 44
4: 463
Right 1102233126 12:111277246-111277268 GGGGAAAGGAGATTGGCACTGGG 0: 1
1: 1
2: 14
3: 38
4: 366
1102233117_1102233127 7 Left 1102233117 12:111277226-111277248 CCTCCCAGCCTGCGCAGGGAGGG 0: 1
1: 0
2: 4
3: 44
4: 463
Right 1102233127 12:111277256-111277278 GATTGGCACTGGGCGTCCCCTGG 0: 1
1: 0
2: 1
3: 3
4: 83
1102233117_1102233128 8 Left 1102233117 12:111277226-111277248 CCTCCCAGCCTGCGCAGGGAGGG 0: 1
1: 0
2: 4
3: 44
4: 463
Right 1102233128 12:111277257-111277279 ATTGGCACTGGGCGTCCCCTGGG 0: 1
1: 0
2: 1
3: 7
4: 72
1102233117_1102233125 -4 Left 1102233117 12:111277226-111277248 CCTCCCAGCCTGCGCAGGGAGGG 0: 1
1: 0
2: 4
3: 44
4: 463
Right 1102233125 12:111277245-111277267 AGGGGAAAGGAGATTGGCACTGG 0: 1
1: 0
2: 3
3: 46
4: 415
1102233117_1102233124 -10 Left 1102233117 12:111277226-111277248 CCTCCCAGCCTGCGCAGGGAGGG 0: 1
1: 0
2: 4
3: 44
4: 463
Right 1102233124 12:111277239-111277261 GCAGGGAGGGGAAAGGAGATTGG 0: 1
1: 1
2: 12
3: 177
4: 1420

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1102233117 Original CRISPR CCCTCCCTGCGCAGGCTGGG AGG (reversed) Intronic
900229795 1:1550866-1550888 CCCTCCCTGCTGGGCCTGGGAGG + Intronic
900288972 1:1915819-1915841 CCCTTCCTGCCCAGGCTCCGTGG - Intronic
900565308 1:3329118-3329140 CCTTCCCTGGGCAGTTTGGGAGG - Intronic
900948135 1:5842862-5842884 CACTCCCAGCGCAGGCTTTGGGG + Intergenic
901681005 1:10912819-10912841 CCCTGTCTGGTCAGGCTGGGAGG + Intergenic
902205868 1:14867730-14867752 GCCTCCATGCCCAGGGTGGGGGG - Intronic
902610705 1:17595645-17595667 CCCTCTGTGCACAGGATGGGCGG + Intronic
902665026 1:17931424-17931446 GTCACCCTGGGCAGGCTGGGTGG - Intergenic
902697523 1:18150339-18150361 CCTTCCTTACGGAGGCTGGGAGG + Intronic
902940685 1:19798729-19798751 CCCTCCCTCCCCAGGCTGAAGGG + Intronic
904427282 1:30437188-30437210 CCCTCCCATCACAGGCTTGGAGG + Intergenic
904470308 1:30731922-30731944 CCCTCCTACCGCAGACTGGGGGG + Intergenic
904744607 1:32703025-32703047 CCTTCCCTGTCCAGCCTGGGAGG + Exonic
905863764 1:41366147-41366169 CCCTGCTGGAGCAGGCTGGGGGG - Intronic
905872804 1:41414826-41414848 CTGTCCCTGCTGAGGCTGGGGGG + Intergenic
906306727 1:44724461-44724483 CGCTCCGTGCGCCGGGTGGGCGG + Intronic
906357072 1:45115754-45115776 TCCTCACTTCCCAGGCTGGGCGG + Intronic
909192548 1:72572841-72572863 CCCTCCCATCACAGGCTTGGAGG + Intergenic
909376731 1:74950180-74950202 CCCTCCCATCACAAGCTGGGAGG + Intergenic
909657268 1:78045888-78045910 CCATCCCGGGGGAGGCTGGGCGG + Exonic
912369749 1:109164773-109164795 TCCTCCCTGCCCAGCCTGAGGGG - Intronic
912907133 1:113718842-113718864 CCCTCCCTTCACAGGCCTGGAGG - Intronic
913101676 1:115573515-115573537 CCCTCCCATCACAGGCTTGGAGG + Intergenic
915326824 1:155085083-155085105 CCCTCTCGCCGCAGGCTGTGGGG - Exonic
915629333 1:157139061-157139083 TCCTCCCTGGGAAGACTGGGGGG + Intergenic
916214208 1:162382112-162382134 CCCACACTGCCCAGGCTGGAGGG - Exonic
916501724 1:165393163-165393185 CCTCCCCTGGGGAGGCTGGGCGG + Intergenic
919741234 1:200982762-200982784 CCCTCCCTGCCCAGGTGAGGAGG + Intronic
920125787 1:203692848-203692870 CGGCCCCTGCCCAGGCTGGGTGG - Intronic
922725842 1:227922665-227922687 CCCTCCCTGCTGAGGGTGAGGGG - Intronic
922979065 1:229809639-229809661 CCCTCCCTGCACTTGGTGGGTGG + Intergenic
923172602 1:231431027-231431049 CCCTCACTGCCCAGGCCGGCGGG + Intergenic
924767595 1:247047915-247047937 CCCTCCCATCACAGGCTTGGAGG - Intronic
1063281351 10:4632887-4632909 CTCCCCATGCGCAGGCTGGTCGG - Intergenic
1065320247 10:24502595-24502617 ACCTCCCTGCCCTGGCTGGTAGG + Intronic
1067086565 10:43243406-43243428 CCCTCACTTCCCAGGCGGGGTGG - Intronic
1067086578 10:43243443-43243465 CCCTCACTTCCCAGGCGGGGTGG - Intronic
1067086697 10:43243815-43243837 TCCTCACTTCCCAGGCTGGGTGG - Intronic
1067113936 10:43420507-43420529 CCCACCCGGAGCAGGCGGGGCGG + Intergenic
1067287177 10:44915003-44915025 CCCTCCATGCCCAGCCTGGACGG - Intronic
1070756124 10:78994239-78994261 CCCCCACTCCCCAGGCTGGGTGG - Intergenic
1070982299 10:80659433-80659455 CCCTCCCTCCACAGGCTGCCTGG + Intergenic
1071538256 10:86454727-86454749 TCCTCACTTCCCAGGCTGGGCGG - Intronic
1073153388 10:101327616-101327638 CCCTCCCATCACAGGCTAGGAGG + Intergenic
1074061192 10:109967421-109967443 CCCGCACTGAGCAGGCTGTGCGG - Intergenic
1074965792 10:118489905-118489927 CCCTCCCATCGCAGGCTTGGAGG + Intergenic
1075037349 10:119080521-119080543 CTCTCCCCGCGCGGGCCGGGCGG + Intronic
1075549758 10:123383504-123383526 CACTCCCTATGCAGGCTGGAGGG - Intergenic
1076164731 10:128272671-128272693 CCCTCCCTTCCCAGGCCCGGGGG - Intergenic
1076371029 10:129953751-129953773 CCCTCCTTGCTTGGGCTGGGTGG - Intronic
1077043876 11:535916-535938 CCCTCCCTGCGCCGGCAGCGCGG + Intronic
1077183605 11:1227014-1227036 TCCTCCCTGCGCAGACAGCGGGG - Exonic
1077339467 11:2019599-2019621 CCCACCCTGCTCTGGCTTGGTGG - Intergenic
1077376886 11:2209389-2209411 CCTTCCCAGCCCAGGCTGGGCGG + Intergenic
1077405224 11:2379595-2379617 TCCTGCCTGCCCAGGCTGAGAGG + Intronic
1077481247 11:2815672-2815694 CCCTCCCTATGCAGGCAGAGGGG + Intronic
1077827424 11:5826319-5826341 CCTTCCCATCACAGGCTGGGAGG + Intronic
1079031865 11:16992078-16992100 ACCTGCATGCCCAGGCTGGGGGG - Intronic
1079916154 11:26371072-26371094 CCCTCCCATCGCAGGCCTGGAGG + Intronic
1080204412 11:29712753-29712775 CCCTCACTGCCCGGGCTGGTGGG - Intergenic
1080912193 11:36613595-36613617 CCCTCCAAACACAGGCTGGGTGG - Intronic
1081717722 11:45262690-45262712 CCCTCTTTGCCCAGGCTGGAGGG - Intronic
1082675516 11:56096288-56096310 CCTTCCCTGTGCTTGCTGGGAGG - Intergenic
1082848404 11:57744370-57744392 ACCTCCCTGCTCAAACTGGGTGG - Exonic
1082997562 11:59265752-59265774 CCCTTCCTGCCCTGCCTGGGAGG + Intergenic
1083264484 11:61540237-61540259 CCCTCCCTGCAAGGGGTGGGTGG + Intronic
1083307736 11:61769806-61769828 GCCTCCCCGCTCAGGCTGGGGGG + Intronic
1083362055 11:62116603-62116625 CACTCCCTCTGGAGGCTGGGAGG + Intergenic
1083952811 11:65966220-65966242 CACGGCCTGGGCAGGCTGGGTGG + Intronic
1084402918 11:68955719-68955741 GCCTCCCTGTCCAGGCTGGATGG + Intergenic
1084857148 11:71996596-71996618 CCCTCCCTGCCTAAGCAGGGTGG + Exonic
1084857149 11:71996597-71996619 CCCACCCTGCTTAGGCAGGGAGG - Exonic
1084913758 11:72412069-72412091 CCCTCCCAGCCCTGGCTGGCAGG - Intronic
1085107833 11:73861401-73861423 CCCTTGCTGCCCAGGCTGGAAGG + Intronic
1085306690 11:75490416-75490438 CCCTCCCTGTGCTGGGTGTGGGG + Intronic
1085341460 11:75734225-75734247 CCATCCTAGCCCAGGCTGGGGGG - Intergenic
1085389541 11:76175512-76175534 CCCTCACTGGGCTGGCTGGGAGG - Intergenic
1088843976 11:113649597-113649619 CCCTCACTGCCCAGGCCGGCCGG + Intergenic
1089047538 11:115516184-115516206 CCTTCCCTCCCCAGCCTGGGAGG + Intergenic
1089443338 11:118533324-118533346 CCCTCCTTGCCCAGGGTGGCTGG - Intronic
1089477848 11:118780072-118780094 CACTCACTGCACAGCCTGGGGGG + Intronic
1089566904 11:119376430-119376452 CCCTCCCTGCCCAGTGCGGGGGG + Intronic
1089671507 11:120060409-120060431 CCCTGCCTGGGCTAGCTGGGTGG + Intergenic
1090405841 11:126475438-126475460 CCCTCCCTGCCCGGCCTTGGAGG + Intronic
1202822452 11_KI270721v1_random:74788-74810 CCCACCCTGCTCTGGCTTGGTGG - Intergenic
1091397436 12:162670-162692 CTGTCCCTGCACAGACTGGGAGG - Intronic
1091645710 12:2270870-2270892 CCCTCTCTGGCCAGGCTGGAGGG + Intronic
1096491312 12:52014680-52014702 CCGTCTCTGCGCAGGCCTGGTGG + Exonic
1097055128 12:56244568-56244590 CCCTGCCTGTGGAGGCTGGCTGG - Intronic
1097110143 12:56652083-56652105 TCCTCACTTCCCAGGCTGGGCGG + Intergenic
1097188096 12:57206319-57206341 CCCTCCCTGCTCAGGGTTGCAGG - Intronic
1097302801 12:58036042-58036064 CCCTCCCATCACAGGCTTGGAGG - Intergenic
1097848576 12:64390224-64390246 CCCTCCCCGCGCAGGAGGGCTGG + Intronic
1099204346 12:79711042-79711064 CCCTCACTGCCCAGGCCGGGAGG - Intergenic
1100309238 12:93378494-93378516 CCGCCCCTGCGCAGGCTGCGGGG + Intronic
1100856462 12:98761852-98761874 CCCTCCTGACCCAGGCTGGGAGG + Intronic
1101839333 12:108316625-108316647 CCCTCCCTGCCCACACCGGGTGG - Intronic
1101891728 12:108722437-108722459 GCCTCCCTGTGCAGGCTGTGTGG - Intronic
1102233117 12:111277226-111277248 CCCTCCCTGCGCAGGCTGGGAGG - Intronic
1102758714 12:115366812-115366834 CCCTCCCATCACAGGCCGGGAGG + Intergenic
1102780612 12:115561439-115561461 TCCTCCCTGGGCTGGCTGTGTGG - Intergenic
1103586620 12:121961041-121961063 CCCTCCCCGTGCACACTGGGAGG - Intronic
1103925928 12:124423316-124423338 CTCTCCCTGCGAAGGCTGTGGGG - Intronic
1104953066 12:132451105-132451127 CCCTCCCTGCAGAAGCCGGGCGG - Intergenic
1105777644 13:23678065-23678087 CCCTCACTGCTCAGGCCGGCGGG + Intergenic
1105841401 13:24256715-24256737 ACCTGCCTTCGCAGGCTGTGTGG - Intronic
1106106563 13:26738426-26738448 CCCTCCCATCACAGGCTTGGAGG + Intergenic
1106917004 13:34526570-34526592 CCCTCCCTCAGGAGTCTGGGAGG - Intergenic
1107452902 13:40527658-40527680 CTCTTGCTGCCCAGGCTGGGGGG - Intergenic
1107562635 13:41571842-41571864 CCCTCACTTCCCAGACTGGGCGG - Intronic
1108175723 13:47790916-47790938 CCCTCCCATCGCAGGCCTGGAGG + Intergenic
1108845899 13:54678246-54678268 CCCTCCCTGTGCTTGCTGAGGGG - Intergenic
1109098198 13:58144668-58144690 CCCTCCCATCACAGGCTTGGAGG + Intergenic
1109201861 13:59440017-59440039 CCCTCACTGCCCAGGCCGGCAGG - Intergenic
1109346991 13:61126096-61126118 CCCTCCCATCGCAGGCCTGGAGG - Intergenic
1109905156 13:68830797-68830819 CCCTCCCATCACAAGCTGGGAGG + Intergenic
1111002601 13:82205278-82205300 ACCTTTCTGCGCAGGCTTGGAGG + Intergenic
1111041811 13:82758092-82758114 CCCTCCTTGCTCAGGCTTAGAGG - Intergenic
1111323738 13:86664193-86664215 CCCTCCCAACACAGGCTTGGAGG - Intergenic
1112857289 13:103787010-103787032 CCCTCCCATCACAAGCTGGGAGG - Intergenic
1114550513 14:23530189-23530211 CCTTCCCTGTGTAGGATGGGGGG + Exonic
1115010552 14:28540138-28540160 TCCTCCCATCACAGGCTGGGGGG + Intergenic
1115752066 14:36504002-36504024 CCGTCCCTGCGCAGCCCGGCGGG + Intronic
1119617688 14:76109681-76109703 TCCTCACTGTGCAGGCGGGGTGG + Intergenic
1119702411 14:76764115-76764137 CCCTGCCTGCCCAGGTTGGAAGG + Intronic
1120179449 14:81328723-81328745 CCCTCCCTGGGGAGGCAAGGGGG + Intronic
1120808898 14:88782515-88782537 CCCTCCCATCACAGGCTCGGAGG + Intronic
1121733682 14:96203841-96203863 CCCTCCCTGGCCTGGCTGTGTGG - Intergenic
1122182611 14:99967096-99967118 CCCTCAGTGGGCAGGCTGGCTGG - Intergenic
1122458848 14:101879093-101879115 CCCTCCCTGGCCAGGCTGCCTGG - Intronic
1122481586 14:102050844-102050866 CCCTCCCTGGGCAGCATGGAAGG - Intergenic
1122490361 14:102111224-102111246 CCCTCCCATCACAGGCTTGGAGG + Intronic
1122690712 14:103530995-103531017 CCCTCCCTGGGGTGTCTGGGTGG + Intronic
1122723232 14:103734144-103734166 CCCTGCCTGGGCTGGCTGTGAGG - Exonic
1122790256 14:104181386-104181408 CCCTCCCGGGGCAGCCTGGATGG + Intergenic
1123024877 14:105419858-105419880 CCGTCCCTGCGCGGCCTCGGCGG + Exonic
1123499253 15:20865795-20865817 CCCTCCTGGCGCAGGGAGGGAGG - Intronic
1123556488 15:21439414-21439436 CCCTCCTGGCGCAGGGAGGGAGG - Intronic
1123592729 15:21876760-21876782 CCCTCCTGGCGCAGGGAGGGAGG - Intergenic
1124247033 15:28079765-28079787 CGTGCCCTGCGCAGGCTGTGGGG + Intronic
1124889360 15:33717941-33717963 CCATCCCTTCCCAGGCTGGAAGG + Intronic
1126514963 15:49524188-49524210 CCCTCCCATCACAGGCTTGGAGG + Intronic
1128481713 15:68045699-68045721 CCCTCCCCCCTCAGGCTTGGGGG + Intergenic
1128520200 15:68370093-68370115 CACTCCCTCCGCAGGCTCTGGGG - Intronic
1128676754 15:69615423-69615445 TCCACCCTGCTCTGGCTGGGAGG - Intergenic
1128812858 15:70585176-70585198 CCGTCCCTGCCCAGGCTGCCCGG + Intergenic
1128869588 15:71143600-71143622 CCCTGCCTGTGCAGCCTGGGTGG - Intronic
1129457351 15:75682997-75683019 CCATCCCTGCGGAGGCTCTGAGG - Exonic
1129680773 15:77657305-77657327 ACCACCCTGGGCAGGCTAGGTGG + Intronic
1129726438 15:77903948-77903970 CCATCCCTGCGGAGGCTCTGAGG + Intergenic
1129873736 15:78958597-78958619 GCCTCCCTGCTGAGGCTGGAAGG + Intergenic
1129879721 15:78998685-78998707 CCCTCCCTGGGCAGGCTGCTGGG - Intronic
1130024560 15:80260271-80260293 CCCTGCCTTGGCATGCTGGGTGG + Intergenic
1130275587 15:82474671-82474693 GTCTCCCTGAGCAGGATGGGTGG + Intergenic
1131558266 15:93417896-93417918 CCCTCCCGGGGCAGGCTGGGAGG + Intergenic
1131874495 15:96790263-96790285 CTCTCCCTGAGCAGGCTCTGAGG - Intergenic
1131984984 15:98033922-98033944 CCATCTCTCCACAGGCTGGGTGG + Intergenic
1132626222 16:892846-892868 CCCTCCCTTCACGGGGTGGGTGG - Intronic
1132709916 16:1261841-1261863 CACACCGTGCTCAGGCTGGGAGG - Intergenic
1132746742 16:1439388-1439410 CCTTCCCTGGGCAGCCTCGGTGG - Intronic
1132889310 16:2196256-2196278 CCCGCCCGGCGCCGGGTGGGGGG + Intronic
1132937445 16:2488288-2488310 CCCTCCCTGGGAAGGCTGCTGGG + Intronic
1134205318 16:12232885-12232907 CCCTCCAAGCCCATGCTGGGTGG - Intronic
1134552607 16:15145009-15145031 CCCACCCTTCACAGCCTGGGTGG + Intergenic
1135207049 16:20492655-20492677 CCCTTCCTCCACAGGCTTGGGGG + Intergenic
1135207070 16:20492722-20492744 CCCTTCCTCCACAGGCTTGGGGG + Intergenic
1135211815 16:20530910-20530932 CCCTTCCTCCACAGGCTTGGGGG - Intergenic
1135211836 16:20530977-20530999 CCCTTCCTCCACAGGCTTGGGGG - Intergenic
1135526118 16:23214971-23214993 CCGACCCTGCACAGGCTGGGAGG - Intronic
1135725697 16:24852515-24852537 CCCTCCCTGTGCCCGCGGGGAGG - Intronic
1139559618 16:67733924-67733946 CACTCCCAGAGCAGGCTTGGTGG - Intronic
1139583114 16:67884831-67884853 CCCTCCCTCCGGGGGCTGGGCGG + Exonic
1139694810 16:68666435-68666457 CCACCCCTGGGCATGCTGGGAGG - Intronic
1140718430 16:77748343-77748365 CCCTCCCTCCAAAGGCTGTGGGG - Intergenic
1141196407 16:81864824-81864846 TCCTCCCTGCTCAGCCCGGGAGG - Intronic
1141806553 16:86345642-86345664 CCCTGCCTGCCCTGGCTGGCCGG + Intergenic
1141807541 16:86351869-86351891 CCCTGCCTGCCCTGGCTGGCCGG - Intergenic
1141830013 16:86505322-86505344 CCTTCCCTGTGCTGGCTGTGCGG + Intergenic
1141908392 16:87042376-87042398 GCCACCCTGTGCAGGCTGGGTGG - Intergenic
1142470947 17:162973-162995 CACACCCGGCCCAGGCTGGGAGG + Intronic
1142574949 17:900552-900574 CCCTCCCTTCCCACCCTGGGAGG - Intronic
1142603671 17:1070108-1070130 TCCCCTCTGAGCAGGCTGGGGGG - Intronic
1142828815 17:2532346-2532368 CCCTCACTGCCCGGGCTGGCGGG + Intergenic
1143591116 17:7886124-7886146 CACTCCCTGAGCACGTTGGGGGG + Intronic
1143783210 17:9240144-9240166 CCCACCCTGCGCGCTCTGGGCGG + Exonic
1143783650 17:9241909-9241931 CAATCCCTGTGCAGGCTGGGAGG + Exonic
1144061908 17:11590569-11590591 CCCTCCCTTCTAAGGCAGGGAGG + Intergenic
1144650522 17:17004267-17004289 ACCTCCCTCCGCAGACTGGCCGG + Intergenic
1144666754 17:17107332-17107354 CCCGCCCTGCCCAGGCTCTGAGG - Intronic
1146004804 17:29154552-29154574 CCCTGCCTGAGAAGCCTGGGGGG - Intronic
1146126494 17:30235612-30235634 GCCTCCCCGCGCAGCCTGGCAGG - Exonic
1146339507 17:32007345-32007367 CGCCCCCTTCCCAGGCTGGGCGG + Intergenic
1146571734 17:33958679-33958701 CACTCCCATCACAGGCTGGGAGG - Intronic
1146920255 17:36705288-36705310 CCCTCCCTGCCCAGGGAAGGGGG - Intergenic
1147210704 17:38870951-38870973 CCCACCCGGCTCAGGCTGGACGG - Intronic
1147382802 17:40065636-40065658 CCCCCCCTGCGCAGCCTCTGGGG + Intronic
1147383886 17:40070821-40070843 CCCACCCCATGCAGGCTGGGGGG - Intronic
1147834459 17:43320006-43320028 CCCTCCCATCACAGGCTTGGAGG - Intergenic
1147949224 17:44097725-44097747 CCTTCCCTGGGCAGGCAGGCTGG - Intronic
1148242644 17:46010638-46010660 CCCAGCCTGCGCAGGCTGTGTGG + Intronic
1149753966 17:59172630-59172652 CCCTCACTGCCCGGGCTGGCCGG - Intronic
1150780286 17:68116288-68116310 CCCTCACTTCCCAGACTGGGCGG + Intergenic
1151051584 17:70984464-70984486 CCCTCCCCTCGCAGGCTGGCAGG - Intergenic
1151501038 17:74488957-74488979 CCCTCCCATCACAGGCTTGGAGG - Intergenic
1151627414 17:75285880-75285902 CCCGCCATGTGCAGGCTGTGTGG + Intronic
1151660585 17:75516183-75516205 CCCTCCTTGCCCAGCCCGGGCGG + Intronic
1151682504 17:75629356-75629378 GCCTCCCCGCTCGGGCTGGGGGG + Exonic
1151725076 17:75878723-75878745 GCCTCCCTGCGTTGTCTGGGCGG - Intergenic
1151765710 17:76132298-76132320 CCCTGCCAGCTCAGGCTGGCTGG + Intergenic
1151898248 17:76994855-76994877 GCCTCCCTGAGCAGGCCGGACGG + Intergenic
1151948330 17:77331509-77331531 GCCTCCCTGCCCAGGCTGGGCGG - Intronic
1152255609 17:79237656-79237678 CCCTCCCTGATGCGGCTGGGAGG - Intronic
1152351691 17:79787091-79787113 AGCTCACTGCGCAGCCTGGGAGG + Exonic
1152352986 17:79793602-79793624 CCCGCCCTCCCCAGGCAGGGAGG + Exonic
1152659701 17:81536560-81536582 CCTTCCCTGTCCAGGCCGGGCGG - Exonic
1152791549 17:82282943-82282965 CCAGCCCTGCGCAGGGAGGGTGG - Intergenic
1152886825 17:82856745-82856767 CCCTCGCTGCGCATCCAGGGCGG + Intronic
1152886835 17:82856789-82856811 CCCTCGCTGCGCATCCAGGGCGG + Intronic
1152886856 17:82856877-82856899 CCCTCGCTGCGCATCCAGGGCGG + Intronic
1152895376 17:82907882-82907904 CCCTGCCTGGGGAGGGTGGGAGG - Intronic
1153536471 18:6107417-6107439 TCCTCACTGCGCGGGCTGTGAGG + Intronic
1154173365 18:12066977-12066999 GCCTCCCTGCTCAGGGTGAGGGG - Intergenic
1154457296 18:14542549-14542571 CCCTCCTGGCGCAGGGAGGGAGG - Intronic
1158460738 18:57643867-57643889 CCCTCACTGCCCGGGCTGGCGGG + Intergenic
1159410814 18:68072867-68072889 CCCTCCCATCACAGGCTTGGAGG + Intergenic
1160535368 18:79588769-79588791 CCCTCCGTGCAGGGGCTGGGAGG - Intergenic
1160939141 19:1611993-1612015 CCTTCCTTGAGAAGGCTGGGGGG + Intronic
1161043472 19:2122168-2122190 TCTTCCCTGCACTGGCTGGGTGG - Intronic
1161220751 19:3116962-3116984 GCCTCCCAGCGCAGGCAGGGAGG + Intronic
1161492881 19:4571891-4571913 TCATCCCTGCCCAGCCTGGGAGG + Intergenic
1162080717 19:8216042-8216064 CCCTCCCTGAGAAGGTAGGGAGG - Intronic
1162145516 19:8610689-8610711 CCCTTCCTGCGCGCGCGGGGCGG - Intronic
1162636379 19:11970895-11970917 CTCTCCTTGCCCAGGCTGGAGGG - Intronic
1162951483 19:14074099-14074121 CCACCCCCGCGCAGCCTGGGTGG - Intronic
1163149332 19:15401698-15401720 CCCACCCTGCCCTGGTTGGGAGG + Intronic
1163556966 19:17998540-17998562 CTCTGCCTGGGCAGTCTGGGCGG - Exonic
1164414115 19:28031851-28031873 CCCTCCCATCACAGGCAGGGAGG - Intergenic
1165149186 19:33750923-33750945 CCCTCCCTGGCTTGGCTGGGAGG - Intronic
1165403316 19:35615401-35615423 CCCACCCTCACCAGGCTGGGTGG + Intronic
1165894207 19:39131714-39131736 CCGACCCTTCCCAGGCTGGGAGG + Intronic
1166046932 19:40235342-40235364 CCGTCTCTGCACAGGCTTGGTGG - Exonic
1167691136 19:50984088-50984110 CCCTCCCTCCGAAGGACGGGCGG + Intronic
925217060 2:2106094-2106116 CCCTCCATGAGCTGGCTGCGTGG - Intronic
925825616 2:7846068-7846090 CCCTCCCCTCTCAGGCTGGAAGG - Intergenic
925917088 2:8614526-8614548 CCCTCCCTGAGCACGCGGGGAGG + Intergenic
927033820 2:19150962-19150984 CCCTCCCTTCACAGGCCTGGAGG - Intergenic
927492081 2:23527320-23527342 CCCACCCTGGGGTGGCTGGGGGG - Intronic
927787181 2:25982114-25982136 TCCTCTCTGCACCGGCTGGGAGG + Exonic
927926116 2:27014848-27014870 CCCTTCCTGCCCAGGCCCGGGGG - Intronic
928366262 2:30705765-30705787 CCCTCTCTGTTCTGGCTGGGAGG + Intergenic
928496993 2:31843125-31843147 TCCTACCTGAGCAGGGTGGGAGG + Intergenic
930088337 2:47514236-47514258 CTCTGCCTACCCAGGCTGGGTGG + Intronic
932758352 2:74423960-74423982 CTGTCCCTGGGCAGGCTCGGTGG - Exonic
933049907 2:77590581-77590603 CCCTCACTGCTCAGGCTGGCAGG - Intronic
933531625 2:83518279-83518301 CCCTCACTGCCCAGGCAGGCGGG - Intergenic
934112967 2:88759496-88759518 CCCTCCCATCACAGGCCGGGAGG + Intergenic
934648544 2:96073343-96073365 CCCTCCCTGGGCAGGGGTGGGGG - Intergenic
936238899 2:110770184-110770206 CCCTCCCAGACCATGCTGGGTGG - Intronic
936251965 2:110874144-110874166 CCCACCCTCAGCAGCCTGGGGGG + Intronic
937080115 2:119134769-119134791 CCCTCCGGGCTCAGGCTAGGGGG - Intergenic
937442957 2:121932552-121932574 TCCTCCCTGGGGAGGCAGGGAGG - Intergenic
937912377 2:127081850-127081872 CCCTTCCTGTGCAGGCAGGTGGG - Intronic
940121950 2:150276965-150276987 CCCTCTCATCACAGGCTGGGAGG - Intergenic
941424104 2:165320821-165320843 CCCTCCCGTCACAGGCTCGGAGG - Intronic
942643215 2:178082768-178082790 CCCTCACTGTGCATTCTGGGTGG + Intronic
945328799 2:208515324-208515346 CCCTCCCATCACAGGCTTGGAGG - Intronic
945767533 2:213999177-213999199 CCCTCCCATCACAGGCTAGGAGG + Intronic
945870206 2:215219165-215219187 CCCTCACTACCCAGGCTGGCAGG - Intergenic
946590960 2:221246581-221246603 TCCTCCCTGCCCCGGCTGTGTGG - Intergenic
946881665 2:224182791-224182813 CCCTCCCTGAGCGGGATGGAGGG - Intergenic
947327358 2:228992841-228992863 CCCTGCCTTCACAGGCTTGGTGG - Intronic
948283587 2:236767751-236767773 GCCTCCCTGTCTAGGCTGGGAGG + Intergenic
948896731 2:240931143-240931165 CCCTCCCTGTGCAAGCTTGCTGG - Intronic
1168944289 20:1738735-1738757 CCCTCCCTGCAGAGGGTGGGGGG + Intergenic
1169130418 20:3163937-3163959 CCCTCCCTGGGCAGATTGGCAGG - Exonic
1169609636 20:7364560-7364582 CCCTCCCATCGCAGGCCTGGAGG + Intergenic
1169985258 20:11436341-11436363 CCCTCCCTTCACAGGCCAGGAGG - Intergenic
1170706286 20:18747372-18747394 CCCGCCCTGCCCAGGCTGCTGGG - Intronic
1170771949 20:19340584-19340606 TCCTCCCTGCCCAGGCTGTGGGG - Intronic
1170864702 20:20142963-20142985 CCCTCCATGCCTAGGGTGGGGGG + Intronic
1170872542 20:20220117-20220139 TCCTCTCCGCGGAGGCTGGGGGG - Intronic
1171358891 20:24572696-24572718 CCCTCCCAGAGCAAGCTGGATGG + Intronic
1171848384 20:30291627-30291649 CCCTCCCGGACCAGGCTGGCCGG + Intergenic
1173023489 20:39287199-39287221 CCCTCCCATCGCAGGCCTGGAGG + Intergenic
1173263841 20:41460414-41460436 CCCTCCCATCACAGGCTCGGAGG + Intronic
1173500521 20:43549561-43549583 CCCTTCCCACCCAGGCTGGGAGG - Intronic
1173655664 20:44698715-44698737 CCTTCCATGTCCAGGCTGGGAGG + Intergenic
1173837585 20:46136004-46136026 TGCTCCCTGCGGAGGGTGGGGGG + Intergenic
1174410555 20:50332198-50332220 ACCTCCCTGCACATGCTGTGTGG + Intergenic
1174481070 20:50831833-50831855 CCCTCCCTCTGCAGCTTGGGAGG - Intronic
1174531471 20:51217831-51217853 CCCTCCCATCACAGGCTTGGAGG - Intergenic
1176016836 20:62938215-62938237 CCCGCGCTGCGCGGTCTGGGCGG - Exonic
1176092401 20:63325089-63325111 CCCTCACTGCTCACCCTGGGAGG - Intronic
1176243140 20:64084220-64084242 TCCTCCCTCCGCAGGGCGGGAGG - Exonic
1176252901 20:64134058-64134080 CCCTCCCTGAGCTGCCTTGGGGG - Intergenic
1176816863 21:13610804-13610826 CCCTCCTGGCGCAGGGAGGGAGG + Intronic
1176962176 21:15171684-15171706 CCCTCCTCGCCCAGGCTGGCAGG + Intergenic
1178308339 21:31509193-31509215 CCCTACCTGCTGAGACTGGGAGG + Intronic
1179075025 21:38112998-38113020 CTCTCACTGCCCAGGCTGGAGGG - Intronic
1180014263 21:45072605-45072627 CCCACCCACCGCAGGCTGGCCGG - Intergenic
1180094981 21:45552287-45552309 CCCCTGCTGCTCAGGCTGGGAGG - Intergenic
1180195254 21:46190116-46190138 CACTCCCTGGGCTGGCTGGCAGG - Exonic
1182342193 22:29632397-29632419 CCCTACCTGCCCAGGATAGGAGG + Intronic
1182462023 22:30490028-30490050 CCCTGCCTTCCCAGGCAGGGTGG - Exonic
1183009695 22:34934701-34934723 GCCTTCCTGCCCAGGATGGGAGG - Intergenic
1183186278 22:36293320-36293342 CCCTCCATGCCCAGGTTTGGAGG - Exonic
1183301554 22:37061395-37061417 CCCCTCCTCCCCAGGCTGGGAGG - Intronic
1183349162 22:37325048-37325070 CCCTCCCGGCGGCGGCAGGGAGG - Intergenic
1183454704 22:37916140-37916162 CCCTCTCTGGGCAGCCTGGTGGG + Intronic
1183465814 22:37979956-37979978 CCCTCCCTCCCCAGGCTGGGCGG + Intronic
1184616125 22:45639856-45639878 CCCTCCCTGAGCAAGCTCCGTGG - Intergenic
1184784749 22:46666210-46666232 CCCTCCCTGTGGAGGCTGAGGGG + Intronic
1185240442 22:49740364-49740386 CCCTCCCTTCACAGGCCTGGAGG + Intergenic
1185315133 22:50175693-50175715 CCCTCCCTGAGCAGGCTGTCTGG + Intronic
1185315864 22:50178852-50178874 CCCACCCAGTGCAGGCTGGCGGG - Intronic
1185380296 22:50504774-50504796 CCCTCCCAGGGCGGGCAGGGTGG - Intronic
950032686 3:9862847-9862869 GCTTCCCAGCGCAGGCTGGGTGG + Intergenic
950259606 3:11534724-11534746 CCCTCCCAGCGCAGCCTGGTAGG + Intronic
950415941 3:12869121-12869143 CTCTCTTTGCCCAGGCTGGGCGG + Intronic
950417389 3:12876236-12876258 CTCTCTTTGCCCAGGCTGGGCGG + Intergenic
950469863 3:13177827-13177849 CCCTGCCTTCCCAGGCTGAGAGG - Intergenic
950853158 3:16081859-16081881 CCCTCCCATCACAGGCCGGGAGG - Intergenic
951022037 3:17791649-17791671 TCCTCCCTGCCTAGGCTGGAAGG + Intronic
952275237 3:31870227-31870249 CCCTCACTGCCCGGGCCGGGAGG - Intronic
953790369 3:45942796-45942818 CCCACCCTGCGTAGGCTGGCTGG - Intronic
953793515 3:45966221-45966243 CTCTCCCTGGGCAGGCCTGGTGG - Intronic
954421955 3:50423564-50423586 CCCTCCCTGGACAGGGTTGGTGG - Intronic
954686049 3:52370841-52370863 CCCTCCCTGTGCAGTCTCTGGGG - Intronic
955462969 3:59205496-59205518 CCCTCCGTGCACAGGTAGGGCGG + Intergenic
956659003 3:71581735-71581757 TCTTCCCCGTGCAGGCTGGGGGG + Intronic
957885490 3:86282347-86282369 CCCTCACTGCCCAGGCGGGCAGG - Intergenic
958042555 3:88244524-88244546 CCCTCCCATCACAGGCTTGGAGG + Intergenic
960101296 3:113746057-113746079 AGCTCCCTGCCCAGGCTAGGAGG - Exonic
960322807 3:116257276-116257298 CCATCCCTCAGAAGGCTGGGAGG + Intronic
960538486 3:118839365-118839387 CCCTCCCGTCACAGGCTTGGAGG - Intergenic
961377374 3:126475821-126475843 CCCTCCGCGCGCAGTCGGGGCGG + Exonic
962284860 3:134077026-134077048 ACTTCCCTGTGCAGGCTGTGGGG - Intronic
963743012 3:149098102-149098124 CCCTCACTGCCCAGGGTCGGTGG + Intergenic
965897476 3:173595005-173595027 CCCTCCCATCACAGGCTTGGAGG - Intronic
966165946 3:177016537-177016559 CTCTCGTTGCCCAGGCTGGGGGG + Intergenic
966362947 3:179148961-179148983 CCCTCCACCCGCGGGCTGGGTGG - Intronic
967412548 3:189181174-189181196 CCCTCCCATCACAGGCTGGGAGG - Intronic
967876512 3:194271473-194271495 CCCTCCAGGCCCAGGCTGGGTGG + Intergenic
967991995 3:195138451-195138473 CCCTCACTCCTCAGGCTTGGAGG - Intronic
968000240 3:195200625-195200647 CCTGCCCTGCACAGGCTGTGAGG - Intronic
968809996 4:2795517-2795539 CCATCACTGTGCAGCCTGGGTGG + Intronic
968913927 4:3489014-3489036 CCCTTCCTGCCCAGGCAGGGTGG - Intronic
968943945 4:3653867-3653889 CCCTCCCCTCGCTGGCTGTGGGG + Intergenic
969299977 4:6292030-6292052 CCCTGCAGGTGCAGGCTGGGAGG - Intronic
969299995 4:6292105-6292127 CCCTGCAGGCGCAGGCTGGGAGG - Intronic
969384821 4:6837415-6837437 TCCTCACTTCCCAGGCTGGGCGG + Intronic
969508409 4:7602660-7602682 TCCTCACTTCCCAGGCTGGGCGG + Intronic
969672593 4:8598005-8598027 CCCTCCCTGTCCAAGCTGGCAGG - Intronic
970678322 4:18477575-18477597 CCCTCCCATCACAGGCTTGGAGG - Intergenic
971111536 4:23591602-23591624 CCCTCCCATCACAGGCTTGGAGG + Intergenic
972660148 4:41108650-41108672 CCCTCCCTGGGCAGGGTGTTTGG - Intronic
973095666 4:46196256-46196278 ACCTCCTTGGGCAGGCTGGTTGG - Intergenic
974733562 4:65899974-65899996 CCCTCCCTTCACAGGCCTGGAGG + Intergenic
975028059 4:69576586-69576608 CCCTCACTGCCCAGGGCGGGCGG + Intergenic
977904066 4:102455581-102455603 CCCTCCCATCGCAGGCTTGCAGG - Intergenic
978376178 4:108077449-108077471 CCCTCACTTCCCAGACTGGGCGG - Intronic
980458662 4:133076605-133076627 CCCTCCCATCACAGGCTTGGAGG - Intergenic
982482941 4:155934062-155934084 CCCTCCCATCACAGGCTCGGAGG + Intronic
984241837 4:177227780-177227802 CCCTCACTGCCCAGGCCGGTGGG + Intergenic
985073426 4:186190941-186190963 CCCTCCCTTCCCGGGCTGGGTGG + Intergenic
985551004 5:533613-533635 CCCTGCCTGGGGAGGCTGCGTGG + Intergenic
985713441 5:1442874-1442896 GCCTCCCTGAGCATGCTGGCCGG - Intronic
985749915 5:1667917-1667939 CTCTCCCAGCGCAGGATGAGGGG - Intergenic
985752127 5:1686701-1686723 CTCTCCCTGGGCAGGGTCGGGGG + Intergenic
985785791 5:1893457-1893479 CCATCCCTGCACAAGCTGGTGGG + Intergenic
986113972 5:4750846-4750868 CCCTCCCATCACAGGCTTGGAGG - Intergenic
986280800 5:6320840-6320862 CTCTCCCTGCACAGACTTGGAGG - Intergenic
986332910 5:6730634-6730656 CCCTCCCTGCCCAGAGTGGGCGG + Intronic
986798057 5:11231830-11231852 CCCTCCCTTCACAGGCATGGAGG + Intronic
987216619 5:15744047-15744069 CCCTCCCTTCACAGGCCTGGAGG - Intronic
987509350 5:18815518-18815540 CCCTCCCTTCACAGGCCTGGAGG - Intergenic
989559671 5:42836477-42836499 CCCTCACTGCCCAGGGTGGCTGG - Intronic
990213764 5:53508322-53508344 CCCTCCCTTCACAGGCCTGGAGG - Intergenic
991735667 5:69629852-69629874 CCCTCCCATCGCAGGCCAGGAGG + Intergenic
991812158 5:70485491-70485513 CCCTCCCATCGCAGGCCAGGAGG + Intergenic
991815116 5:70505968-70505990 CCCTCCCATCGCAGGCCAGGAGG + Intergenic
991882817 5:71231217-71231239 CCCTCCCATCGCAGGCCAGGAGG + Intergenic
994548686 5:101204797-101204819 CCCTCCTATTGCAGGCTGGGAGG + Intergenic
995809009 5:116084466-116084488 CGCTTCCTGGGCAGGCTCGGGGG + Intergenic
995829891 5:116344103-116344125 CCCTCACTGGGCAGGCTGGTTGG + Intronic
997210373 5:132073537-132073559 CCCTCCCTGGGCAGTCTGAATGG - Intergenic
997571605 5:134932583-134932605 CCCTGCCTGAGAAGGCAGGGGGG - Intronic
997586249 5:135045323-135045345 CCCTCACTGGGCTGGCTGGTAGG - Intronic
998135085 5:139670206-139670228 CCCTCCCTGCAGAGGCGTGGGGG - Intronic
998149302 5:139747780-139747802 ACATCCCCGCGCTGGCTGGGGGG - Intergenic
998463400 5:142325350-142325372 ACCTCCTCTCGCAGGCTGGGAGG - Intronic
998926104 5:147127969-147127991 CCCTCCCATCACAGGCTTGGAGG - Intergenic
999132852 5:149297815-149297837 GCCTCCCTTGGCAGGCTGTGAGG - Intronic
999743663 5:154575666-154575688 CCCTCCCCAGGCAGCCTGGGAGG - Intergenic
999978998 5:156940450-156940472 TCCTCACTTCCCAGGCTGGGCGG - Intronic
1000103508 5:158037499-158037521 CCCTCACTTCCCAGACTGGGCGG + Intergenic
1000226476 5:159266641-159266663 CCCTCCCAGCACAGGCCCGGAGG + Intronic
1001576163 5:172765333-172765355 CCCTCCCCGCGCCCGCCGGGTGG - Intergenic
1001636439 5:173213553-173213575 CCCTCACTGCCCAGGCTGGCGGG - Intergenic
1001988268 5:176094473-176094495 CTCTCCCTGCTCAAGATGGGTGG - Intronic
1002227397 5:177733656-177733678 CTCTCCCTGCTCAAGATGGGTGG + Intronic
1002228600 5:177743667-177743689 CTCTCCCTGCTCAAGATGGGTGG + Intronic
1002266748 5:178040115-178040137 CTCTCCCTGCTCAAGATGGGTGG - Intronic
1003036641 6:2645698-2645720 CCCTCTGTGAGCTGGCTGGGGGG - Intergenic
1003497875 6:6679792-6679814 CCCTCCCTGCCCACCCTGGCAGG - Intergenic
1003980226 6:11382192-11382214 CCCTCTCTGGGCAGGCGGGCGGG + Intronic
1004313960 6:14570346-14570368 GCCTCCCTGGGAAGGCTGAGAGG - Intergenic
1004647938 6:17580855-17580877 CCCTCACTGCCCAGGCCGGCGGG - Intergenic
1006508437 6:34506739-34506761 CCCTCCCTGCGTGGGAAGGGAGG + Intronic
1006508438 6:34506740-34506762 CCCTCCCTTCCCACGCAGGGAGG - Intronic
1007074280 6:39056908-39056930 CAGTCCATGCACAGGCTGGGAGG - Intronic
1007178921 6:39914609-39914631 CCCAGCCTGCACAGCCTGGGTGG + Intronic
1007623059 6:43226472-43226494 CCCACCCTGCTCAGGGAGGGTGG + Intronic
1007631297 6:43274988-43275010 CCCTCCCTGCACAGGCTGTGGGG + Intronic
1008820881 6:55629615-55629637 CCCTCCCATCACAGGCTTGGAGG + Intergenic
1009907792 6:69890803-69890825 ACCTCACTGGGCAGGCTGGTTGG + Intronic
1010926831 6:81753914-81753936 CCCTGCCCGCCCAGACTGGGAGG + Intergenic
1013208365 6:107965062-107965084 CATTCCCAGCGCAGGCTGGTTGG - Intergenic
1013282848 6:108655146-108655168 CCATGCCTGTGCATGCTGGGTGG + Intronic
1013829580 6:114255850-114255872 CCCTCCCAGCACAGGCCTGGAGG - Intronic
1013963448 6:115928290-115928312 CCCTCACTGCCCGGGGTGGGCGG + Intergenic
1014460261 6:121686662-121686684 CCCTCACTGACCAGGGTGGGCGG + Intergenic
1015568187 6:134595269-134595291 CCTTGCCTGAGGAGGCTGGGCGG + Intergenic
1016177552 6:141099026-141099048 CCCTCCCACCACAGGCTTGGAGG + Intergenic
1016209031 6:141505670-141505692 CCCTCCCATCACAGGCTTGGAGG - Intergenic
1016693415 6:146965274-146965296 CCTTCCCATCACAGGCTGGGAGG + Intergenic
1019351355 7:555578-555600 CCCTCCCTGGTCGGGCTGGAGGG - Intronic
1019442905 7:1056371-1056393 CCCTCACTGCGGCTGCTGGGCGG + Intronic
1019533584 7:1515946-1515968 CTCTCCCTTCCTAGGCTGGGAGG + Intergenic
1020008277 7:4793636-4793658 CCCTCACTGCCCAGGCTGGCGGG - Intronic
1021762215 7:23913205-23913227 CCCTCCCATCACAGGCTGAGAGG + Intergenic
1023255731 7:38310673-38310695 CCCTCCCTGGGCAGCCAGGCAGG + Intergenic
1023881181 7:44322629-44322651 CCTTCCCTGCTCAGCCTGGCAGG - Intronic
1023954180 7:44871650-44871672 CCCTCACTTCCCAGGCTGGGCGG + Intergenic
1024865868 7:53904543-53904565 CCCTCCCATCGCAGGGTGGGAGG - Intergenic
1024964023 7:55005609-55005631 CCTGTCCTGCGCGGGCTGGGGGG - Intergenic
1026237005 7:68535352-68535374 CCCTCCCTGCCAGGGCTGGCGGG + Intergenic
1027556445 7:79670142-79670164 CCCTCCCATCACAGGCTGAGAGG + Intergenic
1027672625 7:81120166-81120188 CCCTCCCTGCCCAGGCTCCAGGG - Intergenic
1028814609 7:95130131-95130153 CCCTCCCATCACAGGCTGGGAGG + Intronic
1029631825 7:101756849-101756871 CCCTCCCTGGCCAGGCGAGGTGG - Intergenic
1029708120 7:102286179-102286201 CCATCACAGCGAAGGCTGGGTGG + Intronic
1030139671 7:106291898-106291920 CCCTCAGTGGGCAGGCTGGTTGG - Intergenic
1030213053 7:107015386-107015408 CTCTTGCTGCCCAGGCTGGGGGG - Intergenic
1033333384 7:140433335-140433357 TCTTCCCTGGGCAGGCTGAGGGG - Intergenic
1033492069 7:141853660-141853682 CCCTCCCATCACAGGCTTGGAGG - Intergenic
1034264486 7:149774244-149774266 CCCTCCCTGCCCAGGTTACGAGG + Intergenic
1035135475 7:156698738-156698760 CCCTCCCATCACAGGCTGGGAGG - Intronic
1035547264 8:492545-492567 CCCATCCTGGTCAGGCTGGGAGG - Exonic
1035826856 8:2654053-2654075 CCCTCCCTCTGAAGGGTGGGGGG + Intergenic
1036699490 8:11002584-11002606 GCCTTCCTGTGCTGGCTGGGAGG - Intronic
1037776439 8:21838829-21838851 CCCACCCTGAGCAGGCGGTGTGG - Intergenic
1037892121 8:22628945-22628967 CCCACTCTGGGGAGGCTGGGGGG + Intronic
1037903502 8:22702127-22702149 CCCTCACAGCACAGGATGGGGGG + Intergenic
1039071336 8:33651900-33651922 CCCTCCCACCACAGGCTTGGAGG + Intergenic
1040470838 8:47734708-47734730 CCATCCCTGACCAGGCTGAGAGG - Intronic
1040756724 8:50784138-50784160 CCCGCCCTGAGTAGGGTGGGTGG + Intronic
1042528661 8:69793009-69793031 CACTCTCTGCCCAGGCTGGATGG + Intronic
1043670629 8:82880797-82880819 CCCTCACTGCCCGGGCTGGTGGG - Intergenic
1043954169 8:86342518-86342540 CCCTCGCTGCGCATGCTCGGGGG + Intergenic
1045394623 8:101748524-101748546 CCCACCATGGGCAGGGTGGGAGG - Intronic
1046618152 8:116499855-116499877 CCCTCCCCTCACAGGCTAGGAGG - Intergenic
1047971178 8:130085979-130086001 CCTGCGCTGCCCAGGCTGGGAGG - Intronic
1048726195 8:137387624-137387646 CTCTCCCATCACAGGCTGGGAGG - Intergenic
1049064413 8:140301694-140301716 ACCTTCCTGCGGAGGCCGGGAGG - Intronic
1049378883 8:142302285-142302307 ACCTGCCTGGGCAGGCAGGGTGG - Intronic
1050313944 9:4381948-4381970 CAGTCCCAGCACAGGCTGGGTGG + Intergenic
1051128674 9:13835003-13835025 CCCTCCCATCACAGCCTGGGAGG + Intergenic
1053242122 9:36504589-36504611 CCCTCCCTGCAGAGGCTGTTGGG + Intergenic
1055180530 9:73380721-73380743 CCCTCCCATCACAGGCTCGGGGG - Intergenic
1056765798 9:89443723-89443745 CCCTCCCTCCACAGCATGGGTGG + Intronic
1057298608 9:93863580-93863602 CCCTAGCTTCCCAGGCTGGGAGG - Intergenic
1057332461 9:94128746-94128768 CCCACCCATCACAGGCTGGGAGG + Intergenic
1057907202 9:98992357-98992379 CCCTCACTGCCCAGGGTCGGTGG + Intronic
1059375266 9:113876243-113876265 CCCGCCCCGCTCAGGCCGGGGGG - Intergenic
1059567726 9:115399878-115399900 CCCTCCTTGCCCATGGTGGGAGG - Intronic
1060485014 9:124041197-124041219 CACTTCCTCAGCAGGCTGGGTGG + Intergenic
1060885469 9:127149165-127149187 CCCACCCTGTCCAGGCTGGCCGG + Intronic
1061280829 9:129597040-129597062 TCCTCCCTGCGGGGGATGGGAGG - Intergenic
1061783315 9:133008325-133008347 CCATCCCTGAGCAGGGTCGGGGG - Intergenic
1061842623 9:133368198-133368220 GCGTCACTGGGCAGGCTGGGAGG - Intronic
1203530498 Un_GL000213v1:138690-138712 CCCTCCTGGCGCAGGGAGGGAGG - Intergenic
1186926260 X:14336087-14336109 CCCTCCCATCACAAGCTGGGAGG - Intergenic
1187364049 X:18651987-18652009 CCCGCCCTGAGCTGGCTGAGGGG + Intronic
1187844476 X:23522827-23522849 CCCTCACTTCCCAGGCGGGGCGG - Intergenic
1189196804 X:39160343-39160365 CCCTCCCTGCATGGGCAGGGTGG + Intergenic
1189196805 X:39160344-39160366 CCCACCCTGCCCATGCAGGGAGG - Intergenic
1190107114 X:47568900-47568922 CCACCCCTCCCCAGGCTGGGAGG - Intronic
1190213930 X:48467871-48467893 CCCTCCCTTCGGATGCTGTGGGG - Exonic
1190344169 X:49322273-49322295 CCTTCCCTTCACAGGCTGCGAGG + Intronic
1190345264 X:49331818-49331840 CCTTCCCTTCACAGGCTGCGAGG + Intronic
1190346358 X:49341384-49341406 CCTTCCCTTCACAGGCTGCGAGG + Intronic
1190347609 X:49532413-49532435 CCTTCCCTTCACAGGCTGCGAGG + Intronic
1190348710 X:49541969-49541991 CCTTCCCTTCACAGGCTGCGAGG + Intronic
1190349810 X:49551525-49551547 CCTTCCCTTCACAGGCTGCGAGG + Intronic
1190350915 X:49561078-49561100 CCTTCCCTTCACAGGCTGCGAGG + Intronic
1190352016 X:49570636-49570658 CCTTCCCTTCACAGGCTGCGAGG + Intronic
1190353117 X:49580185-49580207 CCTTCCCTTCACAGGCTGCGAGG + Intronic
1190354218 X:49589732-49589754 CCTTCCCTTCACAGGCTGCGAGG + Intronic
1190355320 X:49599256-49599278 CCTTCCCTTCACAGGCTGCGAGG + Intronic
1190513334 X:51195910-51195932 CCCTCCCATCACAGGCTTGGAGG - Intergenic
1190888247 X:54547835-54547857 TCATCCCTGCGCAGGCAGGGAGG + Intronic
1192186754 X:68952265-68952287 CCCTCACTGCCCAGGCCGGCGGG - Intergenic
1192504996 X:71676175-71676197 CCCTCACTTCCCAGGCAGGGCGG - Intergenic
1192885890 X:75335425-75335447 CCCTCACTTCCCAGGCAGGGCGG + Intergenic
1194982294 X:100453113-100453135 CCCTCCCATCACAGGCTGGGAGG + Intergenic
1195072071 X:101291115-101291137 GCCTCGCTGTGCAGGCTGGCTGG + Intronic
1196970261 X:121100264-121100286 CCCTCCCATCATAGGCTGGGAGG - Intergenic
1197301751 X:124789281-124789303 CCCTCCCATCACAGGCTGGGAGG - Intronic
1199623008 X:149715739-149715761 CCCTCTCTCCCCAGGCTGTGGGG + Exonic
1199806542 X:151305861-151305883 CCCTCCCATCACAGGCTTGGAGG - Intergenic
1202028935 Y:20552350-20552372 CCCTCACCTCGCAGGCAGGGCGG - Intergenic