ID: 1102235116

View in Genome Browser
Species Human (GRCh38)
Location 12:111289617-111289639
Sequence CGGTGTAAAGGGCTGGGAGA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 294
Summary {0: 1, 1: 0, 2: 1, 3: 21, 4: 271}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1102235106_1102235116 28 Left 1102235106 12:111289566-111289588 CCTGGAAGAAGTGAGGCAGGACT 0: 1
1: 0
2: 3
3: 23
4: 323
Right 1102235116 12:111289617-111289639 CGGTGTAAAGGGCTGGGAGAGGG 0: 1
1: 0
2: 1
3: 21
4: 271
1102235109_1102235116 5 Left 1102235109 12:111289589-111289611 CCAGAGTGTAAGGAAGCGGATGT 0: 1
1: 0
2: 0
3: 7
4: 80
Right 1102235116 12:111289617-111289639 CGGTGTAAAGGGCTGGGAGAGGG 0: 1
1: 0
2: 1
3: 21
4: 271

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1102235116 Original CRISPR CGGTGTAAAGGGCTGGGAGA GGG Intronic
900438234 1:2641335-2641357 CCGTGATTAGGGCTGGGAGAGGG + Intronic
900904584 1:5544408-5544430 GGGGGTAGAGGGCTGGGGGAGGG + Intergenic
901244113 1:7715171-7715193 CGGGGGAATGGGCTGGGACAGGG + Intronic
901257036 1:7838372-7838394 GGTTGCAAAGGGTTGGGAGAAGG - Intronic
901669921 1:10850093-10850115 CCCTGGAAAGGGCTGGGAGTGGG + Intergenic
901783040 1:11607153-11607175 GGTTGCCAAGGGCTGGGAGAGGG + Intergenic
901966106 1:12868001-12868023 GGGTGTGGAGGGCTAGGAGAGGG - Intronic
901981497 1:13038254-13038276 GGGTGTGGAGGGCTAGGAGAGGG - Intronic
902000585 1:13190659-13190681 GGGTGTGGAGGGCTAGGAGAGGG + Intergenic
902019829 1:13336426-13336448 GGGTGTGGAGGGCTAGGAGAGGG + Intergenic
903048837 1:20586069-20586091 CGGTGTGAAGGCCTGGGAGCAGG + Intergenic
903482344 1:23662999-23663021 CGGGGTGAGGAGCTGGGAGAGGG - Intergenic
903833235 1:26187253-26187275 GGGTGTGATGGGCTGGGGGATGG + Intronic
905358999 1:37405360-37405382 CAGAGAAAAAGGCTGGGAGAGGG + Intergenic
905442004 1:38001593-38001615 CAGGGAAAAGGGCAGGGAGAGGG - Intronic
905893941 1:41533353-41533375 TGGTGGAAGGGGCTAGGAGAGGG - Intronic
906058441 1:42933312-42933334 AGGCGTAGAGGGGTGGGAGATGG - Intronic
907337865 1:53712175-53712197 CTGTGCAAAGGCCTGGTAGAAGG - Intronic
907389884 1:54151404-54151426 CTGTGGGTAGGGCTGGGAGAAGG - Intronic
908257670 1:62316260-62316282 CGGTGAACAGGCCAGGGAGAGGG + Intronic
912634539 1:111279509-111279531 AGGGGTAGAGGGCTGGGAAAGGG + Intergenic
914682528 1:149949003-149949025 CCCTGGAAAGGGCTGGGAGTGGG - Exonic
915249844 1:154580138-154580160 CTTTGTAAAGGGCTGGGCGGAGG + Intergenic
915384303 1:155475511-155475533 CAGATTAAAGGGCTGGCAGAAGG - Intronic
916863984 1:168836764-168836786 CGGTGCAAAGGAGAGGGAGAGGG - Intergenic
918224725 1:182471208-182471230 CAGTGTGCAAGGCTGGGAGAGGG + Intronic
923012983 1:230103860-230103882 CGGAGTAAATGACTAGGAGAAGG - Intronic
923799059 1:237189055-237189077 GGTTGTCAAGGGCTGGGAGGAGG - Intronic
924947265 1:248855035-248855057 GAGTGAAACGGGCTGGGAGATGG - Intronic
1068526064 10:58131065-58131087 CGGGGTAGAGGGCCGGGGGAGGG + Intergenic
1069994508 10:72334303-72334325 CAGTGGGAAGGGCTGGGGGAGGG - Exonic
1070815233 10:79318599-79318621 TGGTGTCAGGGGCTGGGGGAGGG - Intergenic
1071930662 10:90466087-90466109 CAGGGTAAAGGGTTGGGTGAAGG + Intergenic
1072560355 10:96567574-96567596 TGGAGGAAAGGGCTGGGGGATGG - Intronic
1073466890 10:103699555-103699577 CTGAGCAAAGGGCTGGGCGAAGG + Intronic
1075258777 10:120945385-120945407 TGGTGTTGAGGGCCGGGAGATGG - Intergenic
1076668884 10:132108337-132108359 AGGATGAAAGGGCTGGGAGAGGG - Intronic
1077377824 11:2213627-2213649 GGGTGTCAGGGGCTGGGGGAGGG - Intergenic
1077892523 11:6429820-6429842 CAGCTTAAAGGGCTGGGAGCTGG - Intergenic
1078005119 11:7526783-7526805 TAGTGACAAGGGCTGGGAGAGGG + Intronic
1078076610 11:8168144-8168166 CGGTGCTGAAGGCTGGGAGAAGG - Intronic
1079233462 11:18669994-18670016 AGCTGTAGAGGGCAGGGAGAGGG - Intergenic
1080458358 11:32434607-32434629 CGGTCAAAAGGGGTAGGAGAGGG + Intronic
1080772558 11:35355333-35355355 GGGTGTGAAGGGTTGGGAGGAGG - Intronic
1082797333 11:57387709-57387731 CGATGGAAAGGTCTGGGAGATGG - Intronic
1083738455 11:64694936-64694958 CAGTGGAAGGGTCTGGGAGAGGG - Intronic
1084234274 11:67776420-67776442 GGGTAGAAAAGGCTGGGAGAGGG - Intergenic
1084587067 11:70068519-70068541 CAGTGGAAGGGGCTGGGAGTGGG + Intergenic
1084970548 11:72769083-72769105 AGGGGTAAAGGGCTGGGGGGTGG + Intronic
1088505568 11:110523459-110523481 CTGTGGAAAGGGGTGGGTGATGG + Intergenic
1089621755 11:119726716-119726738 TGGTGGGAAGGGTTGGGAGAAGG - Intronic
1090752520 11:129759996-129760018 CAGTCTTCAGGGCTGGGAGATGG - Intergenic
1091279629 11:134374592-134374614 CTGTTTCAAGGGCTGGGAGAAGG + Exonic
1091820248 12:3470681-3470703 CGGTGTCCAGGGCGGGGGGATGG + Intronic
1092218733 12:6699357-6699379 AGGGGTGAAGGGCTGGGAGATGG + Intronic
1092358890 12:7819554-7819576 TGGTGGAAAGGGCAGGAAGAAGG - Exonic
1092372010 12:7924482-7924504 TGGTGGAAAGGGCAGGAAGAAGG - Exonic
1092632730 12:10400516-10400538 GGTTGTCAGGGGCTGGGAGAGGG + Intronic
1092721110 12:11441488-11441510 GGGTGTCAAGGGCTGGGGGAAGG + Intronic
1094755984 12:33468716-33468738 GGGTGTAGGGGGCTGGGAGAGGG + Intergenic
1097080028 12:56423164-56423186 AGGTGTCAAGGGCTGGGAGATGG - Intronic
1097233567 12:57525974-57525996 CCCTGTAAAGTGCTGGGAGGGGG - Exonic
1097506741 12:60482929-60482951 GGTTATCAAGGGCTGGGAGAGGG + Intergenic
1098685089 12:73409859-73409881 GGGGGTGAAGGGCTGGGGGAGGG - Intergenic
1099662254 12:85578834-85578856 AGGTGAAATGGGCTGGGGGAGGG - Intergenic
1100214752 12:92435828-92435850 CCATGGAAAGGGCTGTGAGAGGG - Intergenic
1100280313 12:93112304-93112326 CTGGGGAAAGTGCTGGGAGACGG - Intergenic
1100432796 12:94545798-94545820 GGGTGAAGAGGGCAGGGAGACGG + Intergenic
1101444320 12:104726663-104726685 AGGTGTAATGGGCTGGGAAAGGG + Intronic
1101572712 12:105969681-105969703 CGGTGTAAATGCCTAGGAGTGGG - Intergenic
1102235116 12:111289617-111289639 CGGTGTAAAGGGCTGGGAGAGGG + Intronic
1102959805 12:117085134-117085156 GGGTGGACAGGGCTGGCAGAAGG + Intronic
1103316841 12:120062968-120062990 GGGTGTATAGCGCTGGGTGAGGG + Intronic
1103685812 12:122731111-122731133 GGATGTAAAGGGCAGGGAGGTGG - Intergenic
1104691905 12:130832874-130832896 CTGTGGACAGGGCTGGGGGAGGG - Intronic
1105639251 13:22245288-22245310 CTTTGACAAGGGCTGGGAGATGG - Intergenic
1107650136 13:42536561-42536583 CACTATGAAGGGCTGGGAGAAGG + Intergenic
1107872421 13:44759656-44759678 TGGGGTAAAAGGCTGGGAGTGGG + Intergenic
1108201946 13:48053001-48053023 GGGACTAAAGGGCTGGGGGATGG + Intergenic
1108747224 13:53408548-53408570 CGGTGACAAAGGCTGGGGGAAGG + Intergenic
1112744627 13:102512648-102512670 TGGTCTAAAGGACTGGGAGAAGG - Intergenic
1113381675 13:109811164-109811186 CAGTGTGAGGGGCTGGGACAGGG - Intergenic
1113611381 13:111647025-111647047 AGGTGGAAAGGGGTGGGGGAGGG - Intronic
1117252708 14:53952584-53952606 GGGTGAAAAGGGGTGGGGGAGGG + Intronic
1120408799 14:84124022-84124044 CTGTGTCAAGAGCTGGGAGTGGG - Intergenic
1120525577 14:85573234-85573256 AGGAGTGAAGGGGTGGGAGAGGG - Intronic
1121635018 14:95448325-95448347 TGGAGCATAGGGCTGGGAGAAGG + Intronic
1122279182 14:100611068-100611090 CAGCGGAGAGGGCTGGGAGAGGG - Intergenic
1122363327 14:101180244-101180266 CGGTCCCAAGGGCTGGGACATGG - Intergenic
1124516100 15:30368460-30368482 AGGGGTCAAGGGTTGGGAGAGGG - Intronic
1124610770 15:31206915-31206937 CGGTGTGAAGTGCTGGGGGTGGG - Intergenic
1124726820 15:32162271-32162293 AGGGGTCAAGGGTTGGGAGAGGG + Intronic
1127755788 15:62090607-62090629 CGGGGTTAAGGGGTGGGAGAGGG - Intergenic
1128218695 15:65952539-65952561 GGGTGAACAGGGATGGGAGAAGG - Intronic
1128586370 15:68853940-68853962 TGGTGTAAGGGGTTGGGGGAGGG + Intronic
1129454027 15:75667014-75667036 GGGTGTGAAGGGGTGGAAGAGGG + Intergenic
1129620719 15:77142812-77142834 TGTTGTAAGGGGCTGGGGGAAGG + Intronic
1129775236 15:78232491-78232513 TGGTGAAAAGGGGTGGCAGAGGG - Intronic
1130803009 15:87286303-87286325 TGGTGTTAGGGGCTGGGAAATGG + Intergenic
1131783392 15:95884252-95884274 AGGCGTTGAGGGCTGGGAGAAGG + Intergenic
1132717569 16:1299542-1299564 CGGTGAAGAGGGCAGGGAGCTGG - Intergenic
1135872077 16:26160513-26160535 TGGTGGAGAGGGCAGGGAGATGG + Intergenic
1136125547 16:28177121-28177143 AGCTGTAATGTGCTGGGAGAGGG - Intronic
1138458004 16:57132365-57132387 CTGTGCAAAGGTCTGGGAGGAGG + Intronic
1139474249 16:67194655-67194677 GGGTGGTAAGGGATGGGAGATGG - Intronic
1140888093 16:79261907-79261929 CAGTGGAGAGGGCTGGGAGAAGG + Intergenic
1141046462 16:80720018-80720040 CAGTGTCAAGGCATGGGAGAGGG - Intronic
1141124812 16:81393633-81393655 GGTTGCCAAGGGCTGGGAGAGGG + Intergenic
1141434758 16:83993745-83993767 GGGTGTCCAGGGCCGGGAGATGG + Intronic
1143524806 17:7465990-7466012 GGGTCTACAGGGCTGGGAGCTGG - Exonic
1144968754 17:19093969-19093991 AGGTGTGCAGGGCTAGGAGAGGG - Exonic
1144979162 17:19158097-19158119 AGGTGTGCAGGGCTAGGAGAGGG + Exonic
1144989060 17:19220135-19220157 AGGTGTGCAGGGCTAGGAGAGGG - Exonic
1147109622 17:38252407-38252429 CAGTGTAAAGGGAGGGGACAGGG + Intergenic
1147387847 17:40092229-40092251 GGGTCTGCAGGGCTGGGAGAGGG + Intronic
1147486005 17:40815030-40815052 TGGGGTAGAGGGCTGGGGGAGGG + Intergenic
1148054795 17:44787601-44787623 GGGTGAAAAGGGCTGGGTTATGG - Intergenic
1148419827 17:47535660-47535682 CAGTGTAAAGGGAGGGGACAGGG - Intronic
1148859231 17:50595463-50595485 AGGGGTGAAGGGGTGGGAGATGG - Intronic
1151535708 17:74737691-74737713 GGCTGGGAAGGGCTGGGAGATGG + Intronic
1152705628 17:81842082-81842104 CTGTGTGCAGGGCTGGGCGATGG - Intergenic
1156925513 18:42573170-42573192 GGGTGTGAGGGGCTGGGGGAGGG + Intergenic
1157469673 18:47979587-47979609 CTGTCTCAAGGGCTGGCAGAGGG - Intergenic
1159574968 18:70164046-70164068 GGCTGTCAGGGGCTGGGAGAAGG + Intronic
1159624411 18:70675384-70675406 GTGTGTAAAGGGATGGGGGAAGG + Intergenic
1160670960 19:363035-363057 AGGTGCCAGGGGCTGGGAGACGG + Intronic
1161203447 19:3028620-3028642 CGGGGTATAGGGCGGGGAGGAGG - Intronic
1161292839 19:3504783-3504805 GGTTGCCAAGGGCTGGGAGAGGG - Intergenic
1161358817 19:3834665-3834687 CGGTTAAGAGGCCTGGGAGAAGG + Intronic
1162828626 19:13270093-13270115 CCGTATTCAGGGCTGGGAGATGG + Intronic
1162838647 19:13339355-13339377 GGGTGCCAAGGGCTGGGGGAGGG + Intronic
1163693273 19:18749254-18749276 AGGTGGAATGGGCTAGGAGAAGG - Intronic
1164134010 19:22394686-22394708 GGGTGTGAGGGGCTGGGGGAAGG + Intronic
1165027669 19:32973315-32973337 GGGAGGAAAGGGCTGGCAGAGGG - Intronic
1165353838 19:35291916-35291938 GGGTGTACAGGGATGGAAGATGG + Intergenic
1166343113 19:42150418-42150440 GGGTGGAGAGGGCTGGGGGAGGG + Intronic
1166753327 19:45175624-45175646 AGGTGGAATGGGCTGGGAGAAGG + Intronic
1167220666 19:48196333-48196355 CGGTGTCTAGGGCTGGGGAATGG + Intronic
1167238189 19:48327432-48327454 CTGTGGGAAGGGCTGGGAAAAGG - Intronic
926047085 2:9717759-9717781 GGGTTTAAGTGGCTGGGAGAGGG + Intergenic
926447247 2:12957904-12957926 GGATGTAAAGAGCTGGGAAAAGG - Intergenic
926735759 2:16072205-16072227 GGGAGTGCAGGGCTGGGAGAGGG + Intergenic
927391428 2:22599762-22599784 CGGTGTGAAGGACAGGGAGAAGG - Intergenic
929794507 2:45048784-45048806 CGGAGCAAAGGCCTGGGAGCTGG - Intergenic
931755620 2:65371631-65371653 AAGTGTAACGGGCTGGCAGAGGG + Intronic
932437466 2:71711080-71711102 AGGTGAACAGGGCAGGGAGAGGG + Intergenic
932736895 2:74260599-74260621 CTGTCTAAAGGGCTGGTGGATGG - Intronic
934554465 2:95279997-95280019 CGTAAGAAAGGGCTGGGAGAGGG + Exonic
934639160 2:96016487-96016509 CCATGTGAAGGGCAGGGAGAGGG - Intergenic
934794485 2:97088924-97088946 CCATGTGAAGGGCAGGGAGAGGG + Intronic
935080409 2:99787516-99787538 CTGTGGCAAGGGCTGGGAGCTGG - Intronic
936701701 2:115018712-115018734 GGGTGTAAGGGGCTAGGGGAGGG + Intronic
936833787 2:116682026-116682048 GGGGGTGGAGGGCTGGGAGAGGG + Intergenic
939690516 2:145254519-145254541 CTGTGTAAAGGGCTGCGAGTTGG - Intergenic
941748521 2:169111833-169111855 GAGAGTAAAGGGCTGGGAGATGG - Intergenic
944162649 2:196681119-196681141 TGTTGTCAGGGGCTGGGAGAAGG - Intronic
944852902 2:203738278-203738300 CAGTGCAAATGGCTGGGATAAGG - Exonic
946672276 2:222117873-222117895 CTGTGTAAAGATCTGAGAGAGGG - Intergenic
947504400 2:230695987-230696009 AGGGGTAGAGGGCTGGGGGAGGG - Intergenic
947864415 2:233386399-233386421 CAGTGTGAAGGACTGGGAAATGG - Intronic
948737319 2:240017434-240017456 ATGTGTAACCGGCTGGGAGATGG - Intronic
1169051797 20:2584978-2585000 GGTTGTCAAGGGCTGGGAGCTGG - Intronic
1172110949 20:32544566-32544588 CAGGGTAAAGGGGTGGGAGGTGG + Intronic
1173480247 20:43392964-43392986 AGGTGAGAAGGGCTTGGAGATGG + Intergenic
1175943618 20:62548982-62549004 GGGCGTACAGGGCTGGGAGAAGG + Intergenic
1176413212 21:6459891-6459913 GGGTGTGAAGGGCCGGGTGAGGG - Intergenic
1177673063 21:24258646-24258668 AGGTGGAAAGGGTAGGGAGAAGG - Intergenic
1177780024 21:25612275-25612297 GGGTGTAGGGGGCTGGGGGAGGG - Intergenic
1179114196 21:38475220-38475242 CAGTGGCAAGGGATGGGAGATGG + Intronic
1179167737 21:38947797-38947819 CAGGGTAAAGGGCTTGCAGAGGG - Intergenic
1179688708 21:43068213-43068235 GGGTGTGAAGGGCCGGGTGAGGG - Intronic
1179727082 21:43346706-43346728 CACTGAACAGGGCTGGGAGATGG + Intergenic
1180728603 22:17964347-17964369 CTGTGTACATGGCTGGGAGACGG - Intronic
1180730660 22:17979682-17979704 TGGTGTGCTGGGCTGGGAGAAGG - Intronic
1182867172 22:33613876-33613898 CTGTGTAAGGGGCCAGGAGAGGG - Intronic
1183080395 22:35452219-35452241 AGGTGCAAAGGGCTGGGTGCTGG - Intergenic
1183183745 22:36279494-36279516 GGTTGTCAAGGGCTGGGGGAGGG + Intergenic
1183367180 22:37412938-37412960 CTGTGTCAAGGGAAGGGAGAGGG - Intronic
1183731781 22:39622413-39622435 GAGTGTAAAGGGCTTGGGGAGGG + Intronic
1184186131 22:42866535-42866557 CTGTGAAAAGGGGTGGGGGAAGG + Intronic
1185345577 22:50309197-50309219 GGGTGGGAAGGGCTGGGAGCAGG - Exonic
949966771 3:9363269-9363291 GCGGGTAAAGGCCTGGGAGAGGG - Exonic
950172673 3:10850505-10850527 GGGAGCACAGGGCTGGGAGAGGG + Intronic
950270124 3:11607407-11607429 CGGTGCTGGGGGCTGGGAGAAGG + Intronic
950326199 3:12111884-12111906 CGCATTAAGGGGCTGGGAGAAGG + Intronic
950504482 3:13386028-13386050 GAGTGCCAAGGGCTGGGAGAGGG + Intronic
950538665 3:13596719-13596741 GGGTGCCAAGGGCTGGGAGTGGG - Intronic
951740715 3:25919910-25919932 CAATGTAAAGGGATGGGAAAAGG + Intergenic
952706136 3:36380225-36380247 CCCTGGAAAGGGCTGGGGGAAGG - Intergenic
955140908 3:56268833-56268855 GTGTGGAAAGGTCTGGGAGAAGG - Intronic
956755098 3:72378020-72378042 CGGTGGGGAGGGCTGGGAGGGGG - Exonic
957425667 3:80036023-80036045 CAGGTTAAAAGGCTGGGAGATGG + Intergenic
957556844 3:81773299-81773321 TGGTGTAAAGGGCTGGGCGCTGG - Intergenic
960198390 3:114799386-114799408 TGAGGTAAGGGGCTGGGAGATGG + Intronic
961957864 3:130822594-130822616 AGCTGTAAAGGTTTGGGAGATGG + Intergenic
962361781 3:134749019-134749041 TGGTGGAAAGGGCAGGGAGGAGG + Intronic
962784127 3:138750688-138750710 GGGTGTATTGGGCTGGGAAAGGG - Intronic
963637020 3:147810906-147810928 CAGGGGAAAGGGGTGGGAGAAGG + Intergenic
963972545 3:151445532-151445554 CTGAGTAAAGGGAGGGGAGATGG + Exonic
964624317 3:158744696-158744718 CTGTGTAAAGTGCTGGGTGTGGG + Intronic
965405653 3:168264979-168265001 GGTTGCAAGGGGCTGGGAGAGGG - Intergenic
968827361 4:2908907-2908929 CTGTGTAAGGCGCTAGGAGAGGG + Intronic
969820873 4:9719336-9719358 GGGTAGAAAAGGCTGGGAGAGGG + Intergenic
974169139 4:58243859-58243881 GGGGGTGGAGGGCTGGGAGAGGG + Intergenic
974230557 4:59108743-59108765 GGGGGTGGAGGGCTGGGAGAGGG - Intergenic
975788631 4:77922913-77922935 CAGAGAAAAGGGCTGGGATAGGG + Intronic
979728267 4:123991142-123991164 TGGAGGAAAGGGCTGGGACAAGG - Intergenic
979844083 4:125486114-125486136 AGGAGGAAAGAGCTGGGAGAAGG + Intronic
983929989 4:173442893-173442915 CTGTGTAATGGATTGGGAGATGG - Intergenic
984310383 4:178051003-178051025 TGGTGTAAGGGGATGGGGGAGGG - Intergenic
985111011 4:186546469-186546491 AGGAGTTAAAGGCTGGGAGAAGG - Intronic
989846909 5:46156440-46156462 TGGGGTAAGGGGATGGGAGAGGG - Intergenic
990141839 5:52713726-52713748 GGGGGTAGGGGGCTGGGAGAGGG + Intergenic
992076458 5:73196941-73196963 CAGAGCAAAGGGCTGAGAGAAGG - Intergenic
992560026 5:77942353-77942375 GGTTGTCAAGGGCTGGGAGGAGG + Intergenic
992638356 5:78747127-78747149 CGGGGTAAGGGGCAGGGAAAAGG + Intronic
993955535 5:94227823-94227845 GGGGGTTGAGGGCTGGGAGAGGG + Intronic
994652556 5:102546872-102546894 GTGTGTTAGGGGCTGGGAGAGGG - Intergenic
995759092 5:115544770-115544792 TGGTGTAATGGGCTGCGAGCCGG + Exonic
997225804 5:132208602-132208624 AGGTCTGAAGGGCTGGGACAGGG + Intronic
998128763 5:139640689-139640711 CAGTGGACAGGGCTGGGGGATGG + Intergenic
998385114 5:141753127-141753149 CTCTGTCAAGGGCTGGGAGCTGG + Intergenic
999012749 5:148060302-148060324 CGGTATAAAAGTCTGTGAGATGG + Intronic
1000055484 5:157602521-157602543 CTGTGGCAAGGGGTGGGAGACGG + Intergenic
1002826365 6:777713-777735 CTGTGTGGAGGGATGGGAGAGGG + Intergenic
1003023987 6:2537134-2537156 AGGTGTAAGAGGCTTGGAGATGG + Intergenic
1003919898 6:10823360-10823382 CGGTGTCGGGGGCTGGGAGTGGG - Intronic
1006470778 6:34227455-34227477 GAGTGAAAAGGGCTGGGGGAGGG - Intergenic
1007428815 6:41764474-41764496 GGGGGTAAAGTGCAGGGAGAAGG + Intergenic
1007969592 6:46037339-46037361 GGGTGGAAAGGGCTGAGAGAGGG + Intronic
1008058095 6:46966311-46966333 GGGTGTGAAGGGCTGGGGGATGG - Intergenic
1012349580 6:98233878-98233900 GGGTGTAGAGGGCTGGGGAAGGG - Intergenic
1013298621 6:108781958-108781980 CTCTGTGAAGGGCTGGGGGAGGG + Intergenic
1014256025 6:119160533-119160555 CTCTGCAAGGGGCTGGGAGAAGG - Intergenic
1014542591 6:122694812-122694834 AGGTGTACATAGCTGGGAGAAGG + Intronic
1015000462 6:128208319-128208341 TGTTTTAAAGGGTTGGGAGAGGG - Intronic
1015589124 6:134805463-134805485 GCGTGTAAAGGGCTGGAGGAGGG - Intergenic
1017247695 6:152244896-152244918 CAGGGTAGAGGGCTGGGAGAAGG + Intronic
1018528772 6:164741569-164741591 GGGTGTTCAGAGCTGGGAGAGGG - Intergenic
1018818770 6:167356443-167356465 GAGTATAAAGGGCTGGAAGATGG - Intronic
1019171923 6:170137552-170137574 TGGAGTAAAAGGCTGCGAGAGGG - Intergenic
1020955093 7:14730575-14730597 GGGTGCATAGGGCAGGGAGATGG + Intronic
1022032212 7:26502869-26502891 CAGAGTAAAGGGCAAGGAGATGG + Intergenic
1022313285 7:29218182-29218204 GGGTGGAAGGGGGTGGGAGATGG - Intronic
1023024349 7:36037206-36037228 CATTGACAAGGGCTGGGAGAGGG + Intergenic
1025200260 7:56957363-56957385 CTGTCAAAAGGGCTGGGTGAAGG + Intergenic
1025671685 7:63619569-63619591 CTGTCAAAAGGGCTGGGTGAAGG - Intergenic
1026895596 7:74008302-74008324 CGATGTAAACAGCTGGGAGCGGG + Intergenic
1027333461 7:77123279-77123301 CGGTGGAAAGAGCAGGGACAAGG + Intronic
1028662366 7:93294212-93294234 CCATGTAAAAGGCTGTGAGAAGG - Intronic
1029782334 7:102748032-102748054 CGGTGGAAAGAGCAGGGACAAGG - Intergenic
1030025205 7:105316965-105316987 AGGTATAAAGGAGTGGGAGAGGG - Intronic
1031009694 7:116513005-116513027 CGGCATACAGGGCTGGGGGAGGG - Intergenic
1031938992 7:127767219-127767241 CAGTGGAAAGGGATGGGGGAAGG - Intronic
1033333739 7:140435389-140435411 CCGTGGAAGGGGCTCGGAGATGG - Intergenic
1035343144 7:158177536-158177558 CTGTGGACAGGGATGGGAGAGGG - Intronic
1035483715 7:159206266-159206288 CGGTGTAAAGGAGAGAGAGAAGG + Intergenic
1036603468 8:10285214-10285236 GGCTGTCAAGGGCTCGGAGAAGG - Intronic
1037548375 8:19945927-19945949 AGGTGGAAAGGTGTGGGAGAGGG + Intronic
1038160730 8:25035050-25035072 CGGTCCAAAGGGCTGGGAAGGGG + Intergenic
1038515717 8:28186160-28186182 GGTTGTCAGGGGCTGGGAGAGGG + Intronic
1039027622 8:33275095-33275117 CAGTGGGAAGGGCTGGGTGATGG - Intergenic
1039226373 8:35392736-35392758 GGGGGTAAAGGGGTGGAAGATGG + Intronic
1040007547 8:42632934-42632956 AGGGGTAGAGGGGTGGGAGAGGG - Intergenic
1043165318 8:76896239-76896261 GGGTGTGAGGGGCTGGGGGAGGG - Intergenic
1044218917 8:89646817-89646839 AGCTGAAAAGGGCTGGGAAATGG + Intergenic
1045108917 8:98920845-98920867 CAGTGCAAAGAGCTGGGAGGAGG + Intronic
1045227108 8:100259658-100259680 GGTTGTCAAGGGCTGGGAAAGGG - Intronic
1046400068 8:113693433-113693455 AAGTGTAAAGGGGTGGGAGGAGG + Intergenic
1047248050 8:123161177-123161199 CGGTGCAAAGGCCTGGGGGCCGG - Intergenic
1047701289 8:127451890-127451912 TGGTGTAAAGGCCTGGGATCAGG - Intergenic
1047803217 8:128331347-128331369 CTGTGTGAAGTGCTGGGAGTTGG + Intergenic
1049849451 8:144823012-144823034 CGGTGACATGGGCTGGGAGAGGG - Intergenic
1050485210 9:6126853-6126875 AGGTTTCAGGGGCTGGGAGAAGG + Intergenic
1055029092 9:71754063-71754085 AGGGGTGGAGGGCTGGGAGAGGG + Intronic
1056417235 9:86388499-86388521 CTGTGTCCAGGGCTAGGAGAGGG - Intergenic
1057727121 9:97575521-97575543 GTGTGTAAACAGCTGGGAGATGG + Intronic
1057787994 9:98102661-98102683 CGTTACCAAGGGCTGGGAGAGGG + Intronic
1058449727 9:105084844-105084866 TGGTGTGGGGGGCTGGGAGAGGG - Intergenic
1059080076 9:111239488-111239510 CGGGGTGGAGGCCTGGGAGAGGG - Intergenic
1061401903 9:130373137-130373159 TGATGTGATGGGCTGGGAGAAGG + Intronic
1062012546 9:134274795-134274817 GGGTGTAAGGGCCTGGGCGAAGG + Intergenic
1185621734 X:1454084-1454106 GGGTGGGAAGGGCGGGGAGATGG + Intergenic
1186066615 X:5773030-5773052 CGTTGCCAGGGGCTGGGAGAGGG + Intergenic
1187297792 X:18018998-18019020 GGGGGTAGAGGGCTGGGGGAGGG + Intergenic
1188716563 X:33465526-33465548 CAGTGTCAGGGGCTGGGGGAAGG + Intergenic
1189510726 X:41658620-41658642 CAGTGTGAAGAGGTGGGAGAGGG + Intronic
1190935283 X:54994105-54994127 AGGTGGACAGGGCTGGGACAGGG + Intronic
1197256824 X:124272489-124272511 GGTTGCCAAGGGCTGGGAGAGGG + Intronic
1198772749 X:140148325-140148347 GGACTTAAAGGGCTGGGAGAAGG + Intergenic
1198912875 X:141633906-141633928 CTGTGAAAACAGCTGGGAGAGGG + Intronic
1200010270 X:153115092-153115114 TGGGGTCAAGGGCCGGGAGAAGG + Intergenic
1200029330 X:153284830-153284852 TGGGGTCAAGGGCCGGGAGAAGG - Intergenic
1201705845 Y:16935848-16935870 CAGTGTAAAGAGCTTGCAGAAGG - Intergenic