ID: 1102235735

View in Genome Browser
Species Human (GRCh38)
Location 12:111293484-111293506
Sequence ACCGAGGGAAGCCGCCTCCC AGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 123
Summary {0: 1, 1: 0, 2: 2, 3: 9, 4: 111}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1102235725_1102235735 23 Left 1102235725 12:111293438-111293460 CCCTGCAGAGCAGAGAGAGGGGA 0: 1
1: 0
2: 8
3: 60
4: 428
Right 1102235735 12:111293484-111293506 ACCGAGGGAAGCCGCCTCCCAGG 0: 1
1: 0
2: 2
3: 9
4: 111
1102235732_1102235735 -9 Left 1102235732 12:111293470-111293492 CCGGGCCCACGCTGACCGAGGGA 0: 1
1: 0
2: 1
3: 8
4: 80
Right 1102235735 12:111293484-111293506 ACCGAGGGAAGCCGCCTCCCAGG 0: 1
1: 0
2: 2
3: 9
4: 111
1102235729_1102235735 -5 Left 1102235729 12:111293466-111293488 CCTGCCGGGCCCACGCTGACCGA 0: 1
1: 0
2: 0
3: 3
4: 132
Right 1102235735 12:111293484-111293506 ACCGAGGGAAGCCGCCTCCCAGG 0: 1
1: 0
2: 2
3: 9
4: 111
1102235726_1102235735 22 Left 1102235726 12:111293439-111293461 CCTGCAGAGCAGAGAGAGGGGAC 0: 1
1: 0
2: 3
3: 38
4: 323
Right 1102235735 12:111293484-111293506 ACCGAGGGAAGCCGCCTCCCAGG 0: 1
1: 0
2: 2
3: 9
4: 111

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1102235735 Original CRISPR ACCGAGGGAAGCCGCCTCCC AGG Exonic
900185959 1:1333374-1333396 ACCCAGGTGAGCCGCCTTCCCGG + Exonic
901235722 1:7666657-7666679 GCCGTGGGCAGCCACCTCCCAGG - Intronic
903231249 1:21923544-21923566 ACCCAGGGGAGCTGGCTCCCAGG + Intronic
904937679 1:34143256-34143278 ACCCAGAGCAGCAGCCTCCCAGG + Intronic
905526799 1:38646034-38646056 ACCAAAGGAATCAGCCTCCCAGG + Intergenic
906290108 1:44614292-44614314 CTCGAGGTAAGCCACCTCCCAGG + Exonic
916563867 1:165956286-165956308 GCAGAGGGAAGCTGCCTGCCTGG + Intergenic
918851369 1:189694549-189694571 ACCAAGGGAAGACACTTCCCAGG + Intergenic
1062840167 10:663975-663997 ACCGAGGACAGCCTCCTCCCAGG + Intronic
1063623031 10:7666771-7666793 GCCGAGGGGAGCCGGGTCCCGGG - Intronic
1067720142 10:48722005-48722027 ACTGAGGGCAGCAGCCACCCAGG - Intronic
1074501046 10:114025186-114025208 ACCCAGGGCAGCCACCTCCATGG + Intergenic
1075129540 10:119726225-119726247 CCCGCGGGCCGCCGCCTCCCTGG + Exonic
1075281009 10:121138435-121138457 GCGGAGGGAACCCGCCTGCCAGG - Intergenic
1075555395 10:123427237-123427259 ACTGAGAGATGCCTCCTCCCTGG + Intergenic
1076160792 10:128242928-128242950 CCCCAGGGAAGCTCCCTCCCTGG + Intergenic
1078316228 11:10294809-10294831 ACCGAGGAACGCGGCATCCCCGG + Intergenic
1080540263 11:33257902-33257924 AGCGAGGGGCGCCGCCACCCCGG + Intronic
1080553372 11:33393646-33393668 ACCGAGGCATGTTGCCTCCCGGG + Intergenic
1083341547 11:61961671-61961693 CCAGCTGGAAGCCGCCTCCCAGG - Intronic
1083343137 11:61971894-61971916 TCCCAGGACAGCCGCCTCCCAGG + Intergenic
1083618076 11:64036126-64036148 CCCGAGGAGACCCGCCTCCCCGG + Intronic
1083730560 11:64650353-64650375 ACCGAGGGAAGCAGCGTCGCAGG + Intronic
1084531653 11:69731173-69731195 ACCCAGGGAAGGGGCCTCCGGGG - Intergenic
1084720016 11:70899501-70899523 CCCAAGGGAAGCCGCCACTCAGG - Intronic
1086424743 11:86672281-86672303 ACCGAGGCAAGCCACCACGCGGG - Intronic
1087136294 11:94723968-94723990 ACAGAGGGAAGTCTCCTCCTGGG - Intronic
1089694989 11:120211274-120211296 ACCCCGGGAAGGCGCATCCCCGG - Exonic
1096244522 12:49976681-49976703 TCCCAGGGAAGCCTCCTCCCAGG + Exonic
1096879864 12:54658757-54658779 CTTGAGGGGAGCCGCCTCCCAGG + Intergenic
1101992301 12:109496398-109496420 ACCCAGGGAAGTCTACTCCCAGG - Intronic
1102235735 12:111293484-111293506 ACCGAGGGAAGCCGCCTCCCAGG + Exonic
1104895721 12:132162693-132162715 AGCCAGGGAAGCAGCCTCCTGGG + Intergenic
1110176843 13:72567313-72567335 ATCCTGGGAAGCGGCCTCCCAGG - Intergenic
1111902244 13:94213605-94213627 ACCGAGGCAAGTCCCATCCCAGG - Intronic
1113412772 13:110104972-110104994 ACCGTGGGAAGCAGCCTGCATGG - Intergenic
1119198687 14:72736963-72736985 ACCCAAGCCAGCCGCCTCCCTGG + Intronic
1119877161 14:78070793-78070815 AAGGAGGGAAACCACCTCCCAGG + Intergenic
1120981285 14:90291601-90291623 AGCGAGGCAAGAGGCCTCCCAGG + Intronic
1122282718 14:100633569-100633591 ACCCCGGGCAGGCGCCTCCCCGG + Intergenic
1122789601 14:104178734-104178756 CCCGAGGGAGGCCCCCACCCAGG + Exonic
1122800086 14:104225080-104225102 ATGGAGGGAAGATGCCTCCCAGG + Intergenic
1122814945 14:104307672-104307694 GCAGAGGGCAGCCCCCTCCCCGG - Intergenic
1126133020 15:45362159-45362181 AGCAATGGAAGCCTCCTCCCAGG + Exonic
1126934601 15:53692550-53692572 ACCTAGGCAAGCTGACTCCCAGG + Intronic
1132954817 16:2585969-2585991 GGCAAGGGAAGCCACCTCCCCGG - Intronic
1133333629 16:4991951-4991973 ACCGAGGGACCCCAGCTCCCTGG + Exonic
1141915529 16:87093994-87094016 GCCGTGGGAAGCCAGCTCCCAGG - Intronic
1142836982 17:2594230-2594252 AGCGAGGGCAGCGCCCTCCCCGG - Intronic
1143568676 17:7740754-7740776 CCGGAGGGAACCCGCCTTCCCGG + Intronic
1146177703 17:30677043-30677065 TCTGAGGGAAGCCACCTGCCAGG - Intergenic
1152561967 17:81083128-81083150 ACCGGGCGATGCTGCCTCCCAGG - Intronic
1155218238 18:23662292-23662314 ACCCACGGATGCCTCCTCCCCGG - Intronic
1157847539 18:51017716-51017738 ACCCAGGGGAGCCGGCTCCCAGG - Intronic
1158648061 18:59264882-59264904 ACCGAGCGAGGGCGCCTCCGCGG + Intergenic
1159904172 18:74075485-74075507 AGAGAGGGAAACAGCCTCCCTGG + Intronic
1161238127 19:3207966-3207988 ACCGAGGGCGGCCGGCTCCCAGG - Exonic
1161621034 19:5297172-5297194 CCCAAGGGCAGCCGCCTCCTGGG - Intronic
1168649467 19:58084584-58084606 ACCACAGGAAGCCGCCACCCAGG + Exonic
925140779 2:1548691-1548713 ACCGAGGGAACTCGCCTCTTGGG + Intergenic
925164851 2:1709639-1709661 ACCGATGGGAGCCGCCTTGCCGG - Intronic
926698750 2:15788623-15788645 CCCCAAGGAGGCCGCCTCCCAGG + Intergenic
930089441 2:47521103-47521125 GCCGAGGGCCGCCGCCTCTCGGG - Exonic
934098156 2:88626858-88626880 GCCGAGGGAAGACGCCCGCCCGG + Intronic
938672997 2:133603126-133603148 ACAGAAGGAAGCAGCCTCCTCGG + Intergenic
941032749 2:160531969-160531991 ACTGAGGGGACCAGCCTCCCAGG - Intergenic
945235384 2:207627247-207627269 ACCGCGGGAAGCAGGCTCCCGGG - Intergenic
1174454241 20:50638365-50638387 ACAGAGGGAAGCGGCCTCCCTGG - Intronic
1174472597 20:50771680-50771702 ACAGAGGGAAGCGGCCTCCCTGG + Intergenic
1180090992 21:45533783-45533805 GCCGAGCCACGCCGCCTCCCCGG + Intronic
1180170626 21:46056455-46056477 GCGAAGGGAAGCTGCCTCCCTGG - Intergenic
1181610080 22:24006344-24006366 ACCAAGGGCAGCCGCCACACGGG + Intergenic
1182427534 22:30282846-30282868 ACCGTGGGCAGGCCCCTCCCTGG + Intergenic
1183455297 22:37919212-37919234 ACCCACGGTAGCCCCCTCCCTGG - Intronic
1184478342 22:44733634-44733656 ACAGAGGGAGGCCTCCTCCCTGG + Intronic
1184562311 22:45270222-45270244 ACAGAGGGAAGCGGACTGCCTGG + Intergenic
1185344276 22:50304611-50304633 AGCTAGGGCAGCTGCCTCCCCGG + Intronic
949414304 3:3799546-3799568 GCCTAGGGATGCCGCCGCCCGGG - Exonic
951011280 3:17682965-17682987 ACAGAGGGAAGCCTCCATCCTGG - Intronic
952738001 3:36709437-36709459 TCTGAGGGAGGCCGCCTCTCAGG + Intergenic
952906075 3:38139828-38139850 ACAGAGTAAAGCAGCCTCCCTGG - Intronic
954507278 3:51089281-51089303 ACCCAGGAAAGCCGCTTACCTGG - Exonic
956733864 3:72221257-72221279 ACTGAGTGAGGCCCCCTCCCTGG + Intergenic
959689455 3:109182788-109182810 AGCGAGGGAGGCCGCCTCTTGGG - Intergenic
960902174 3:122564244-122564266 ACCGAGGAGAGCGGCCTGCCGGG - Exonic
969233069 4:5845367-5845389 TCTGAAGGAAGCCGCCTCGCTGG + Intronic
972653776 4:41046771-41046793 CCCAAGGGCAGCTGCCTCCCAGG + Intronic
985579649 5:689939-689961 ACCCAGGGCAGCCCCCACCCAGG - Intronic
985594495 5:781998-782020 ACCCAGGGCAGCCCCCACCCAGG - Intergenic
985899794 5:2779715-2779737 GCTGAGGGAAGCAGCCTCGCAGG + Intergenic
989375502 5:40756111-40756133 ACCGAGAGGAGCCGCCCCCGCGG + Intergenic
997214245 5:132097162-132097184 GCCGAGGGAAGGCGGCTGCCAGG + Intergenic
999299388 5:150481815-150481837 ACCCACGGCAGCCACCTCCCTGG + Intergenic
1001035290 5:168292454-168292476 ACCGAGAGGAGGCGCCTGCCGGG + Intronic
1001333221 5:170777018-170777040 ACCGTGGGAAGCTGCTTCCAGGG - Intronic
1001656225 5:173352562-173352584 ACCGAGGGAGGCGGCCACCTGGG - Intergenic
1001702832 5:173719978-173720000 ACGGAGGGAAGCTGCAACCCCGG - Intergenic
1002525540 5:179813818-179813840 ACAGAGATAAGCCCCCTCCCTGG + Intronic
1006744059 6:36329415-36329437 AGAGAGGAAAGCTGCCTCCCTGG + Intronic
1006928566 6:37673466-37673488 GCCCAGGAAAGCCTCCTCCCAGG - Intronic
1007606123 6:43119427-43119449 ACCATGGGAAGCTGGCTCCCAGG + Intronic
1013738965 6:113260662-113260684 GCTGAGGGAAGCCTCCTTCCTGG + Intergenic
1018237485 6:161740523-161740545 ACCGAGGGAGGCCACCTACATGG - Intronic
1019485484 7:1287457-1287479 ACTCAGGGACGCCGCCTCCCAGG - Intergenic
1019778900 7:2928412-2928434 GAGGAGGGAAGCGGCCTCCCTGG - Intronic
1025927944 7:65974229-65974251 ACCGAGGCCAGCCACCTGCCAGG + Intronic
1026004737 7:66591914-66591936 GCCGAGGGAAGCCGCCGCAGAGG + Intergenic
1026017503 7:66682554-66682576 ACCGAGGGGAGCCGCCGGACAGG - Intronic
1029696193 7:102214781-102214803 CCCGATGGAAGCCTCCTGCCTGG - Intronic
1034276553 7:149826376-149826398 ACCCAGGGCAGCTCCCTCCCTGG + Intergenic
1035689850 8:1553069-1553091 AGGGAGAGACGCCGCCTCCCCGG + Intronic
1035731459 8:1856547-1856569 TCCTGGGGAAGTCGCCTCCCGGG - Intronic
1039257866 8:35739019-35739041 ACTGAGGAAAGATGCCTCCCAGG + Intronic
1047231359 8:123000709-123000731 GCCCAGGGAAGCAGCCTCCAAGG - Intergenic
1047371689 8:124261224-124261246 AGCCAGGGATGCCACCTCCCAGG - Intergenic
1049838680 8:144755930-144755952 TCAGAGGGAAACTGCCTCCCAGG - Intronic
1061263961 9:129495154-129495176 CCAGAGAGAAGCCGCCTCCCTGG + Intergenic
1203771465 EBV:52007-52029 ACCGAGGAAGGCCGCCGCCACGG + Intergenic
1188858416 X:35225927-35225949 GTCAAGAGAAGCCGCCTCCCTGG - Intergenic
1192223957 X:69215860-69215882 ACAGAGGCAAGAGGCCTCCCAGG + Intergenic
1199264843 X:145818065-145818087 ACTGAGGAAAGCCGGCTCACTGG - Intronic
1200212170 X:154351551-154351573 ACCGAGAGAAACCGCCCACCTGG - Intronic
1200306072 X:155027099-155027121 GCCGCGGGGAGCCGCCTTCCTGG + Intronic