ID: 1102236749

View in Genome Browser
Species Human (GRCh38)
Location 12:111298556-111298578
Sequence TCTCCAGGTTGGTCATGATC AGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 197
Summary {0: 1, 1: 0, 2: 1, 3: 22, 4: 173}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1102236749_1102236753 -6 Left 1102236749 12:111298556-111298578 CCTGATCATGACCAACCTGGAGA 0: 1
1: 0
2: 1
3: 22
4: 173
Right 1102236753 12:111298573-111298595 TGGAGAAAGCTAATCAGGTGAGG 0: 1
1: 0
2: 1
3: 31
4: 305
1102236749_1102236755 15 Left 1102236749 12:111298556-111298578 CCTGATCATGACCAACCTGGAGA 0: 1
1: 0
2: 1
3: 22
4: 173
Right 1102236755 12:111298594-111298616 GGAGGCGCAGTTCCCACCCGTGG 0: 1
1: 0
2: 1
3: 8
4: 97
1102236749_1102236757 25 Left 1102236749 12:111298556-111298578 CCTGATCATGACCAACCTGGAGA 0: 1
1: 0
2: 1
3: 22
4: 173
Right 1102236757 12:111298604-111298626 TTCCCACCCGTGGGTGCCAGAGG 0: 1
1: 0
2: 2
3: 7
4: 110
1102236749_1102236754 -3 Left 1102236749 12:111298556-111298578 CCTGATCATGACCAACCTGGAGA 0: 1
1: 0
2: 1
3: 22
4: 173
Right 1102236754 12:111298576-111298598 AGAAAGCTAATCAGGTGAGGAGG 0: 1
1: 0
2: 2
3: 49
4: 423
1102236749_1102236756 16 Left 1102236749 12:111298556-111298578 CCTGATCATGACCAACCTGGAGA 0: 1
1: 0
2: 1
3: 22
4: 173
Right 1102236756 12:111298595-111298617 GAGGCGCAGTTCCCACCCGTGGG 0: 1
1: 0
2: 1
3: 6
4: 54

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1102236749 Original CRISPR TCTCCAGGTTGGTCATGATC AGG (reversed) Exonic
900650317 1:3727195-3727217 TCTCCAGGGTGATGATGATGAGG - Exonic
901582823 1:10259698-10259720 TCACCATGTTGGTCCTGGTCTGG + Intronic
902597399 1:17518976-17518998 TCTCCATGTTGGTCAGGCTGGGG - Intergenic
903008529 1:20314407-20314429 TCCCCAGGTTGGCCACGAACAGG - Exonic
904214309 1:28907260-28907282 TCCCCATGTTGGTCATGGGCTGG + Intronic
904719579 1:32498037-32498059 TGTCCAGGCTGGTCTTGAACTGG - Intronic
905010147 1:34741789-34741811 CCTCCAGGTTGGTACTGAGCTGG - Intronic
905068558 1:35205497-35205519 TGCCCAGGTTGGTCTTGAACTGG - Intergenic
906106337 1:43295149-43295171 TCTCCATGTTGGTCGGGCTCAGG - Intergenic
906337150 1:44943232-44943254 AGTCCAGGTTGGTCTTGAACTGG + Intronic
906477416 1:46179114-46179136 TATCCAGGCTGGTCTTGAACTGG - Intronic
907357755 1:53890319-53890341 TCCCCAAGATGATCATGATCAGG + Intergenic
907480044 1:54739219-54739241 TCTCCAGGCTGGTCTTGAACTGG + Intronic
908276878 1:62482529-62482551 TCTCCATGTTGGTCAGGCTTAGG + Intronic
908584036 1:65549422-65549444 TCTCCAAGTTGGTCACTTTCAGG + Intronic
909867655 1:80694504-80694526 TAGCCAGGATGGTCTTGATCTGG - Intergenic
914784219 1:150813821-150813843 TCTCCATGTTGGTCAGGCTGGGG + Intronic
915143022 1:153778547-153778569 TCTCCAGGTTGGTGGTGTTCTGG + Exonic
917064195 1:171073933-171073955 TTCCCAGGTTGGTCTTGAACTGG - Intergenic
917345482 1:174024037-174024059 TCTCCACGTTGGTCAGGCTCCGG - Intergenic
918866670 1:189909437-189909459 TTTCCAGGTTTGTCATGATTAGG + Intergenic
920077375 1:203347322-203347344 TCTCCAGGTTGGTGTTGACTGGG + Exonic
923014858 1:230118931-230118953 TTTCCAGGGTGGTCATGGACAGG - Intronic
1063349004 10:5337467-5337489 TCTCCACCTTGGACTTGATCTGG - Intergenic
1065094089 10:22263662-22263684 CCTCCAGGTAGGTCCTGAGCGGG - Intergenic
1065636135 10:27736542-27736564 TCCTCAGTTTGGTCATGTTCTGG - Intronic
1066603869 10:37139423-37139445 TCTCCAGGGTGGGGATGACCAGG - Intronic
1067663574 10:48254945-48254967 TCTCCAAGTTTTTCATGGTCTGG + Intronic
1068510598 10:57960740-57960762 TGTCCCGGTTGCTCATGTTCTGG - Intergenic
1069713400 10:70505402-70505424 TCTCCATGTTGGTCTCGAACAGG - Intronic
1071300359 10:84251954-84251976 TCTCCAGATGGGTTTTGATCGGG - Intronic
1072999234 10:100274053-100274075 TGTCCAGGCTGGTCTTGAACTGG - Intronic
1075477707 10:122750534-122750556 TCTCCAGACTTGTCATGAACAGG - Intergenic
1081756590 11:45549202-45549224 TCCCCACATTGGTCAAGATCAGG + Intergenic
1081848936 11:46261380-46261402 TCTCCAGGTGGGATATGATGAGG - Intergenic
1083843821 11:65319675-65319697 CCTCCAGGTGGGACATGATTGGG + Intronic
1084272896 11:68038581-68038603 TCTCCAGGGTGGTCAAGAGCAGG + Intergenic
1084556098 11:69876848-69876870 TCTCCATGTTGGTCATGGTCAGG - Intergenic
1084734999 11:71099139-71099161 TCTCCCTGTTGGTGATGACCTGG - Intronic
1088228032 11:107643167-107643189 TCACCATGTTGGTCAGGATGGGG - Intronic
1091698805 12:2646362-2646384 TCTCCATTTTGGTCCTGTTCAGG + Intronic
1092618963 12:10242375-10242397 CCTCCAGGTTGGACATAAACAGG + Intergenic
1096474500 12:51899913-51899935 TCACCATGTTGGCCATGGTCAGG - Intergenic
1100890745 12:99123386-99123408 TCTCCTGGCTGGTCCTGATCCGG - Intronic
1101683776 12:106996039-106996061 TCTCCATGTTGGTCAGGGGCTGG + Intronic
1102236749 12:111298556-111298578 TCTCCAGGTTGGTCATGATCAGG - Exonic
1102641689 12:114372515-114372537 TGCCCAGGTTGGTTTTGATCTGG + Intronic
1103685628 12:122730043-122730065 TCTTCACGTTGGCCATGAACAGG - Exonic
1104828451 12:131731523-131731545 TACCCAGGTTGGTCATGATTAGG + Intronic
1108397066 13:49999585-49999607 TCCCCAGGCTGGTCTTGAACTGG + Intronic
1108745305 13:53387487-53387509 CCTCCTGGATGGACATGATCAGG - Intergenic
1112346303 13:98592842-98592864 TCTCTAGGTAGGACATGATGGGG + Intergenic
1112475200 13:99725444-99725466 GCCCCAGGATGGTCAGGATCAGG + Intronic
1113123046 13:106944672-106944694 TCTTGATGTTGGTCATGACCAGG - Intergenic
1113254185 13:108488571-108488593 TCACCATGTTGGTCAGGCTCAGG - Intergenic
1116922493 14:50594642-50594664 TCTCCAGGTTTATTATGCTCTGG + Intronic
1119351963 14:73973248-73973270 GCACAAGGTTGGCCATGATCTGG - Intronic
1119675389 14:76549821-76549843 TGTCCAGGCTGGTCCTGAACTGG + Intergenic
1120099488 14:80428030-80428052 TGGCCAGGTTGGTCTTGAACTGG - Intergenic
1122949723 14:105035676-105035698 TCTCCATGTTGGTCAGGCTGGGG + Intergenic
1127564182 15:60170286-60170308 TGTCCAGGCTGGTCTTGAACTGG + Intergenic
1128289287 15:66464720-66464742 TCTCCATGTTGGTCACGCTGTGG + Intronic
1128620917 15:69149226-69149248 TCTGCAGGTTGATCATTATGGGG - Intergenic
1129806847 15:78468451-78468473 TGTCCAGGCTGGTCTTGAACTGG + Intronic
1130635657 15:85617440-85617462 TCGCCATGTTGGCCACGATCTGG + Intronic
1130709171 15:86262820-86262842 TCTTCAGGTCGGTCAAGACCAGG - Exonic
1133602419 16:7352327-7352349 TCTCCGACTTGGTCATCATCAGG - Intronic
1133780285 16:8933657-8933679 TGCCCAGGTTGGTCTTGAACTGG + Intronic
1135276598 16:21118646-21118668 TGCCCAGGTTGGTCTTGAACTGG + Intronic
1135514140 16:23115446-23115468 TGCCCAGGTTGGTCTTGAACTGG - Intronic
1135560294 16:23471025-23471047 TCTCCATGTTGGTCAGGCTGGGG + Intronic
1136011182 16:27364205-27364227 CCTCCACGTGGGCCATGATCTGG - Exonic
1139416498 16:66815561-66815583 TGTCCAGGCTGGTCTTGAACTGG + Intronic
1140922994 16:79556375-79556397 TCCACAGGTTTGCCATGATCTGG + Intergenic
1141429181 16:83962155-83962177 TCTCTAGGGTGGCCATGATGGGG - Intronic
1142305428 16:89281789-89281811 TCTCGAAGCTGGTCATCATCAGG + Exonic
1142749924 17:1981172-1981194 TGTCCAGGCTGGTCTTGAACTGG - Intronic
1143171611 17:4933792-4933814 GCTCCAGGGTGGTCATGTTTGGG - Exonic
1146364143 17:32205721-32205743 TCTCCACGTTGGTCAGGCTAGGG - Intronic
1146784853 17:35710859-35710881 TGTCCAGGCTGGTCTTGAACTGG - Intronic
1147490869 17:40864862-40864884 TCTCCAGGTCGGTCCTGGTCAGG + Exonic
1147563885 17:41524899-41524921 TCTCCAGGTCGGTCCTGGCCAGG + Exonic
1147705899 17:42424444-42424466 TCTCCATGTTGGTCAGGCTGAGG - Intergenic
1147914381 17:43877887-43877909 TCTCCAGGTTGCTATTGACCAGG + Exonic
1148930367 17:51122226-51122248 TCTCCAGGTGGGTCATGCGTAGG - Intergenic
1150483501 17:65528422-65528444 CCTCCAGGTGGGTCCAGATCAGG + Intergenic
1151370511 17:73644083-73644105 TCTCCAGGCTGGTCACCATGTGG - Exonic
1151529390 17:74694997-74695019 TCCCCGGGTTGGTCCTGATGAGG + Exonic
1151613718 17:75194141-75194163 TCTCCATGTTGGTCAGGCTGGGG + Intergenic
1154343702 18:13525425-13525447 TGTCCAGGATGGCCAGGATCTGG - Intronic
1159786093 18:72716437-72716459 CCTCCAGGTTGGCACTGATCTGG - Intergenic
1162021721 19:7871107-7871129 TCTCCAGAGGGGGCATGATCAGG + Exonic
1162389825 19:10382789-10382811 TGCCCAGGTTGGTCTTGAACTGG - Intergenic
1162562714 19:11426766-11426788 TCTCCAGGTTCCGCATGGTCTGG + Exonic
1165044336 19:33092797-33092819 TTCCCAGCTTGGTCATGCTCGGG + Intronic
1165104559 19:33461408-33461430 TCCCCAGGTTGGGCAGGGTCGGG + Intronic
1167069940 19:47215487-47215509 TCTCCATGTTAGTCAAGATGGGG - Intergenic
1167207221 19:48110720-48110742 CCTCCAGGTTGGCCCTGCTCAGG - Exonic
928445461 2:31329931-31329953 TCTCCAGGAGGTTAATGATCAGG - Intergenic
928951907 2:36820695-36820717 CCTCCAGGATGGTCTTCATCTGG + Intergenic
929990550 2:46782584-46782606 TCTCCATGATGGTCATGTGCAGG + Intergenic
933746376 2:85574721-85574743 TCTCCATGTTGGTCAAGAGCTGG + Intronic
934110735 2:88739822-88739844 TGTCCAGGCTGGTCTTGAACTGG + Intronic
934880871 2:97977730-97977752 CCTCAAGGTTGATCAGGATCAGG + Intronic
937520617 2:122709123-122709145 TCTCCAGTTTCTTCAGGATCTGG + Intergenic
937980623 2:127612535-127612557 TCTCCAGGTTGGACATGGGCCGG - Exonic
938693315 2:133812676-133812698 TCTCCAGGTAGGTGATGCTCTGG + Intergenic
940190838 2:151038497-151038519 TCTGCAGGATGTTCAAGATCGGG + Intronic
940658264 2:156515201-156515223 TCGCCATGTTGGTCTTGAACTGG - Intronic
942389060 2:175473083-175473105 TCTCAAGGTCCTTCATGATCTGG - Intergenic
943836272 2:192517634-192517656 TCACTAGGTTGGTGATGAACAGG + Intergenic
944861468 2:203819425-203819447 CCTCAAGATTGGACATGATCTGG - Intergenic
945480148 2:210336096-210336118 CCTTCAGGATGGTCATCATCTGG + Intergenic
945602625 2:211887636-211887658 TCCCCAGGTTGTTCATATTCAGG + Intronic
946421780 2:219569230-219569252 TCATCAGGTTGGTGCTGATCTGG - Intronic
946638549 2:221757547-221757569 TTTCCAGGTTGGGCATGGGCAGG - Intergenic
947584443 2:231344971-231344993 TCCCCGTGTTGGTCATGATCTGG - Exonic
1169562948 20:6821681-6821703 TCTGCAGGCTGGTCATCACCTGG + Intergenic
1171106754 20:22440843-22440865 TCTCCAGCTTGTTCAGGAGCAGG - Intergenic
1171941066 20:31330461-31330483 TGGCCAGGATGGTCTTGATCTGG + Intergenic
1174241450 20:49138706-49138728 TGTCCAGGCTGGTCTTGAACTGG + Intronic
1178951131 21:36986613-36986635 TCTCCATGTTGGTCAGGCTCAGG + Intronic
1179909395 21:44439927-44439949 TGCCCAGGCTGGTCATGAACTGG + Intronic
1181079486 22:20404528-20404550 TACCCAGGCTGGTCTTGATCTGG + Intronic
1181455069 22:23054537-23054559 TCTCCAGGATCATCATGAACAGG + Intergenic
1181752772 22:25000854-25000876 TTTCCAGGCTGGTCATGAACTGG + Intronic
1182295638 22:29310043-29310065 TCTCCATGTTGGTCAGGCTCAGG - Intronic
953630411 3:44611039-44611061 TCTCAAGGTTGGTCAGCATCTGG + Intronic
954088017 3:48261700-48261722 TCTCAAGGTTTGTCTTCATCTGG + Intronic
955797316 3:62650984-62651006 TCTCCAAGTTGGCCATGAGCAGG + Exonic
957264048 3:77937879-77937901 TTTCCAAGTTGGTCATTATGTGG + Intergenic
959028556 3:101270883-101270905 TCACCAGATGGGTCATGATGGGG + Intronic
960626990 3:119690839-119690861 TTTCGAGGTTGCTCATGATTTGG + Intergenic
962186370 3:133264390-133264412 TGTCCAGATTGCTCATGAGCAGG + Intronic
963539110 3:146563912-146563934 TGCCCAGGCTGGTCTTGATCTGG + Intergenic
964313136 3:155415282-155415304 TCTCCAAGTTGTTCCTGATGGGG - Intronic
967946205 3:194806144-194806166 GCTGCAAGTTGGGCATGATCAGG - Intergenic
968773432 4:2523818-2523840 TCTCCATGTTGGTCAAGAGCTGG - Intronic
976192517 4:82501640-82501662 TCTCCATGTTTCTCATGTTCTGG + Intronic
977527247 4:98160044-98160066 TCTCCATGTTGGTCAGGCTGGGG - Intergenic
978546860 4:109879655-109879677 TCTCCAGGTCGGTCCTGGCCAGG + Intergenic
986748460 5:10763840-10763862 TCTCCAGGTTTGTACTGATTGGG + Intergenic
986761371 5:10882858-10882880 TCTCCATGTTGGTCAAGCTGGGG - Intergenic
987967713 5:24897045-24897067 TAGCCAGGTTGGCCATGATGAGG - Intergenic
988440785 5:31229879-31229901 TCTCCTGGCTGGTGATTATCAGG + Intronic
995818960 5:116205092-116205114 TTTCCTAGATGGTCATGATCTGG + Intronic
997444164 5:133929262-133929284 TCCCCAGTTTGGTCAGGCTCTGG - Intergenic
998906152 5:146907522-146907544 TCTCCAACTTGGTGATGACCAGG - Intronic
999238355 5:150113385-150113407 GGTCCAGGTGAGTCATGATCAGG - Intergenic
1000241389 5:159411718-159411740 TCTCCATGATGTTCATGATTTGG + Intergenic
1001295801 5:170498011-170498033 TGTCCCGGTTGATCATGTTCTGG - Intronic
1003102849 6:3190441-3190463 TTTCCTGGTTGGTGATGCTCTGG + Intergenic
1003913445 6:10763651-10763673 TCACCATGTTGGTCAGGCTCAGG - Exonic
1004257244 6:14076340-14076362 TGGCCAGGTTGGTCTTGAACTGG - Intergenic
1005968718 6:30744473-30744495 CCTGCAGGATGGTCATGGTCGGG + Exonic
1006313805 6:33278857-33278879 TCTCCAGGTTTGTGGTGTTCTGG - Intronic
1008511471 6:52279521-52279543 TCTCCTGGATGGTGATGGTCTGG + Exonic
1010057685 6:71585293-71585315 TCTCCAGGTCGGTAATGGCCAGG - Intergenic
1011856690 6:91701854-91701876 TTGCTAGGTTGGTCATGAACTGG + Intergenic
1014138964 6:117919103-117919125 TCCCCAGGCTGGTCTTGAACTGG + Intronic
1014584318 6:123180283-123180305 TCTCCAGGTAGGTCATGTCCAGG + Intergenic
1014808850 6:125862785-125862807 TGGCCAGGCTGGTCTTGATCAGG - Intronic
1015294391 6:131574218-131574240 TCTCCAGGTTTCTCAGGATCTGG + Intronic
1016088396 6:139944554-139944576 TCTCCAGGCTGGCCAGGATACGG + Intergenic
1017217767 6:151930178-151930200 TCTCCATGTTGGTCAGGCTGGGG + Intronic
1019389050 7:775035-775057 CCTCCAGGGTGGTCAGGACCTGG - Exonic
1022903682 7:34835096-34835118 TCTCCAGGTTGACCTTGGTCAGG - Intronic
1024198771 7:47086106-47086128 TCCCTATGTTGGTCATGTTCAGG - Intergenic
1026059864 7:67016348-67016370 TCTCCATGTTGGTCAGGCTGGGG - Intronic
1026671345 7:72393254-72393276 TAGCCAGGATGGTCTTGATCTGG - Intronic
1026718242 7:72808722-72808744 TCTCCATGTTGGTCAGGCTGGGG + Intronic
1030633747 7:111924707-111924729 TGGCCAGGTTGGTCTTGAACTGG - Intronic
1033366749 7:140678008-140678030 CATCCAGGTGGGTCATGATTTGG - Intronic
1038021538 8:23555378-23555400 TCTCCAGGTTGGATGTGATCTGG + Intronic
1039078705 8:33715306-33715328 TGGCCAGGCTGGTCTTGATCAGG + Intergenic
1039820317 8:41128819-41128841 CCTGCAGGTTGGTCAGGGTCGGG + Intergenic
1039859055 8:41440664-41440686 TTTCAAGGTTGGGCATGATGTGG - Intergenic
1041506871 8:58608812-58608834 TCTCCAGGCTGGTCATTACAGGG - Intronic
1047479360 8:125266286-125266308 TCTCCATGTTGGTCAGGCTGAGG + Intronic
1049480217 8:142819069-142819091 TCTCCAGGGAGGTCATGCCCTGG - Intergenic
1055081846 9:72275446-72275468 GCTCGAGGTTGGACATGGTCTGG - Intergenic
1055581224 9:77708987-77709009 TCTCCAGGTTGGTTAGACTCTGG + Intergenic
1055724663 9:79214431-79214453 TCTGCAGGTTTTTAATGATCTGG - Intergenic
1057747362 9:97762761-97762783 TCTCCAGTTCCCTCATGATCTGG + Intergenic
1058714548 9:107712080-107712102 TCTCCCAGTTGTCCATGATCTGG + Intergenic
1062264143 9:135679151-135679173 TCTCCAGATGGGTCATGAAAAGG + Intergenic
1187898377 X:24003876-24003898 TGTCCAGGCTGGTCTTGAGCTGG - Intronic
1187953759 X:24495671-24495693 TCTCCAGGTTGGTGAACATATGG - Intronic
1189148572 X:38681197-38681219 TTTCCAGGGTTGTTATGATCTGG + Exonic
1189766868 X:44381030-44381052 TGTCCAGGCTGGTCTTGAACTGG - Intergenic
1190126697 X:47711903-47711925 TCTCCAAGATGTTCAGGATCAGG - Intergenic
1190777374 X:53563806-53563828 TCTCCAGGTTGAGAATGAGCTGG - Exonic
1194459343 X:94147268-94147290 CCTCCAGTTTGGTCATGCTCTGG + Intergenic
1194637329 X:96362077-96362099 AATACACGTTGGTCATGATCAGG + Intergenic
1195017968 X:100797224-100797246 TCTCCAGGTTGCAGATGACCAGG - Intergenic
1196723745 X:118877996-118878018 TCTCCAGGCTGGACATGCCCAGG + Intergenic
1198789522 X:140328489-140328511 TGTCCAGGCTGGTCTTGAACTGG + Intergenic