ID: 1102237747

View in Genome Browser
Species Human (GRCh38)
Location 12:111304846-111304868
Sequence CTGCCTGTTGATATGTTGGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 124
Summary {0: 1, 1: 0, 2: 0, 3: 7, 4: 116}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1102237747_1102237750 -2 Left 1102237747 12:111304846-111304868 CCAGCCAACATATCAACAGGCAG 0: 1
1: 0
2: 0
3: 7
4: 116
Right 1102237750 12:111304867-111304889 AGTCATCACCAGGACTGCAGTGG 0: 1
1: 0
2: 1
3: 16
4: 153
1102237747_1102237751 -1 Left 1102237747 12:111304846-111304868 CCAGCCAACATATCAACAGGCAG 0: 1
1: 0
2: 0
3: 7
4: 116
Right 1102237751 12:111304868-111304890 GTCATCACCAGGACTGCAGTGGG 0: 1
1: 0
2: 0
3: 10
4: 158
1102237747_1102237752 0 Left 1102237747 12:111304846-111304868 CCAGCCAACATATCAACAGGCAG 0: 1
1: 0
2: 0
3: 7
4: 116
Right 1102237752 12:111304869-111304891 TCATCACCAGGACTGCAGTGGGG 0: 1
1: 0
2: 1
3: 19
4: 237

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1102237747 Original CRISPR CTGCCTGTTGATATGTTGGC TGG (reversed) Intronic
900198408 1:1389621-1389643 CTGGGTCTTGCTATGTTGGCCGG - Intronic
900246569 1:1638908-1638930 CAGAGTGTTGCTATGTTGGCCGG - Intronic
901400485 1:9012150-9012172 CTGTCTGTTGGGATGTTGGGAGG - Intronic
908269677 1:62410849-62410871 CTGCTGGTTGCTATGTTGCCTGG - Intergenic
910133025 1:83931894-83931916 CTCCCTGCTGATATTTTGGTGGG - Intronic
910536041 1:88298766-88298788 CTCACTATTGGTATGTTGGCTGG + Intergenic
915949536 1:160179291-160179313 CTGGGAGTTGAGATGTTGGCAGG - Intronic
916814644 1:168339526-168339548 CTGCCTGATGTTGTGTTAGCAGG - Intergenic
918213677 1:182374430-182374452 CTGCCTGTTCATATGTTCTTGGG - Intergenic
920681591 1:208077271-208077293 ATGCCTGCTGATATGTTCACTGG + Intronic
922108897 1:222538491-222538513 CTGCCTCTTGATATGGTTGGTGG + Intronic
1064400331 10:15015626-15015648 GTGCCTGTTGACATGCTGGCAGG - Intergenic
1078637270 11:13063588-13063610 CTGCATGGTGATGTGTTGGCTGG - Intergenic
1079592443 11:22196221-22196243 CTGCCTCTTAACATGTTGGAAGG + Intronic
1080145025 11:28971430-28971452 CTGCCTGCTTATATGCTGGCCGG - Intergenic
1085324188 11:75594159-75594181 CTGCCTGCTGAGATGTTGAGAGG - Intronic
1087159859 11:94938082-94938104 CTGTCTCTTGGTATGTTGTCGGG - Intergenic
1088886128 11:114008601-114008623 CAGCCTGTGGATTTGGTGGCGGG - Intergenic
1094298751 12:28937114-28937136 CTGTCTTTTGAAATGTTGGAGGG - Intergenic
1096608473 12:52784922-52784944 CTGGCTGTTTATATGTTGAAGGG + Intergenic
1102149339 12:110677927-110677949 CAGCCTGGTGAGATGATGGCAGG + Intronic
1102237747 12:111304846-111304868 CTGCCTGTTGATATGTTGGCTGG - Intronic
1103738059 12:123072980-123073002 CTGCCTCTTGAGAGTTTGGCTGG + Intronic
1109298016 13:60558466-60558488 ATGCCTATTGATATGTTTTCAGG - Intronic
1109444626 13:62418503-62418525 CTGCCTGTTGTTTCCTTGGCAGG - Intergenic
1111123152 13:83880030-83880052 CTGCCTGTGGACGTGTTCGCTGG - Exonic
1116735469 14:48685391-48685413 CTGGTTCTTGATATGTTGACAGG - Intergenic
1121444643 14:93970852-93970874 CTGCCTGTGGAGGTGTTGTCAGG + Intronic
1121993539 14:98584091-98584113 CTGCTTGTTGAGATGTTGTAGGG - Intergenic
1123713193 15:23006287-23006309 CTGCCTGTTCATATCTTAGATGG - Exonic
1125284934 15:38082294-38082316 CAGTCTTTTGACATGTTGGCTGG + Intergenic
1126108983 15:45164840-45164862 CTGCCTGTTGATGAGCTGACAGG - Exonic
1127914522 15:63444515-63444537 CTTCCTGTTGTTCTGTTGGTTGG - Intergenic
1129011472 15:72421970-72421992 CTGCTTGTTGATTTGATTGCAGG - Intergenic
1129682365 15:77665050-77665072 CTGCCTGTGCACATGTGGGCAGG + Intronic
1131979627 15:97981881-97981903 CTCCCTGTTGATACCTGGGCAGG - Intergenic
1132041560 15:98528907-98528929 CAGCCTGTTGATCTGTTATCAGG + Intergenic
1139754746 16:69132970-69132992 CGGCCAGTATATATGTTGGCGGG + Intronic
1140105956 16:71960137-71960159 CTGCCTCTTGGTTTGTTGGTTGG - Intronic
1140839813 16:78828109-78828131 CTGCCTCCTGTAATGTTGGCAGG - Intronic
1146841229 17:36155997-36156019 CTGCCTGTGAAAATGTTTGCTGG + Intergenic
1146853472 17:36243631-36243653 CTGCCTGTGAAAATGTTTGCTGG + Intronic
1146869382 17:36367523-36367545 CTGCCTGTGAAAATGTTTGCTGG + Intronic
1147072257 17:37968147-37968169 CTGCCTGTGAAAATGTTTGCTGG + Intergenic
1147083781 17:38047684-38047706 CTGCCTGTGAAAATGTTTGCTGG + Intronic
1147099727 17:38171651-38171673 CTGCCTGTGAAAATGTTTGCTGG + Intergenic
1150082733 17:62254945-62254967 CTGCCTGTGAAAATGTTTGCTGG + Intergenic
1151096651 17:71506847-71506869 CTTCCTGTTAATATTCTGGCCGG + Intergenic
1153437347 18:5081808-5081830 CTGCATGTTGCTGAGTTGGCTGG - Intergenic
1156040578 18:32816127-32816149 CTGCCAATTCATATGTTGGGTGG + Intergenic
1157129575 18:44993714-44993736 CTGCTTGTTGAAATTTTGACTGG - Intronic
1157907512 18:51582783-51582805 CTGACTCATGTTATGTTGGCTGG + Intergenic
1159375556 18:67587762-67587784 CTGCCTGTGGAAATGCTTGCAGG - Intergenic
1160365587 18:78323436-78323458 CTGTCTGGTGATCTGTGGGCTGG + Intergenic
1162833281 19:13299998-13300020 CTGCCTGCTGATCTGACGGCAGG + Intronic
1163404551 19:17113960-17113982 TGCCCTGTTGATATGTGGGCTGG + Intronic
933147267 2:78869363-78869385 CTGCCTTTTCATATGGTGGAAGG - Intergenic
935681090 2:105637855-105637877 GTGGCTGTCCATATGTTGGCTGG - Intergenic
935825228 2:106941314-106941336 CTGCTGGATGATATGTTGACAGG + Intergenic
937144810 2:119635495-119635517 CTGCCTGTGGATGGGTTGGGTGG + Intronic
937385896 2:121432527-121432549 ACGCCTGTTGAAATGTTGACTGG + Intronic
938408570 2:131046026-131046048 CTCCCTGTTCAGCTGTTGGCCGG + Exonic
939122926 2:138139787-138139809 CTTCCTCTTGATATCTTGGGAGG - Intergenic
940287437 2:152046693-152046715 CTGCCTGTTGAGCTGTAGCCAGG + Intronic
942806851 2:179940924-179940946 CTGGCTGTTGACATTTAGGCAGG - Intergenic
946587329 2:221204634-221204656 CTGCCTGTTGATTTCTAGCCAGG - Intergenic
1169325360 20:4671208-4671230 CTTCCTGTTGGGATGGTGGCTGG - Intergenic
1169775211 20:9244967-9244989 CTGTCAGCTGACATGTTGGCTGG + Intronic
1177127566 21:17214899-17214921 GTGGCTGTTGATTTCTTGGCTGG - Intergenic
1177305588 21:19311115-19311137 CTGCCTTTCTTTATGTTGGCAGG + Intergenic
1179538073 21:42065176-42065198 CTGCCTGTTGCGATGAGGGCTGG + Intronic
1182749748 22:32632147-32632169 CTGCCTGGTGATATGGGCGCAGG - Intronic
949515641 3:4804585-4804607 CACCCTGTTGTTAAGTTGGCAGG + Intronic
952790929 3:37200262-37200284 CTGCATGTTTGTATGTTGGGTGG - Intergenic
954803635 3:53202290-53202312 CTGACTCTTGATCTGATGGCTGG + Intergenic
956335237 3:68155915-68155937 CTGCCAGGTGCTATGCTGGCAGG - Intronic
956735106 3:72232316-72232338 CTGCCTGCTGAAATGCTGGCTGG + Intergenic
956764456 3:72472620-72472642 CAGCCTATTCACATGTTGGCAGG + Intergenic
966528772 3:180949828-180949850 ATGCCTGTTGACTTGTTGGTAGG + Intronic
969533412 4:7741582-7741604 CTGGCTGGTGATGTGCTGGCTGG + Exonic
969533448 4:7741726-7741748 CTGGCTGGTGACATGCTGGCTGG + Exonic
972633164 4:40859255-40859277 CCTCCTGATGAGATGTTGGCTGG - Intronic
974853572 4:67432504-67432526 CTGCCTGTTGGTCTGTTCCCAGG - Intergenic
977172161 4:93776554-93776576 CTGCATGTTGATATGGAGCCAGG - Intergenic
979560280 4:122094363-122094385 CTGAGTGTAGATATGTTGGAAGG + Intergenic
980150208 4:129037428-129037450 TTTTCTGTTGATATGGTGGCTGG + Intronic
982463912 4:155706270-155706292 CTGCCTGCTGATATGTTAAGTGG + Intronic
982978057 4:162092220-162092242 CTGCATGTTTATATGTTTCCAGG + Intronic
985910344 5:2874690-2874712 CTGCCTGCTCGTATGTTGGCTGG - Intergenic
989516501 5:42349400-42349422 CTGGCTGGTGAAATGTGGGCTGG - Intergenic
996779539 5:127170954-127170976 CTGCATGTTGGAATGTTGGAAGG + Intergenic
1000772351 5:165371498-165371520 CTCTTTGTTAATATGTTGGCTGG + Intergenic
1011773019 6:90695727-90695749 CTGCCTGCTGATGTGTGAGCAGG - Intergenic
1013323137 6:109015162-109015184 CTGCCTGTTTATAGGCAGGCAGG + Intronic
1013865031 6:114686017-114686039 CTACATGTTGAGATATTGGCTGG - Intergenic
1015658858 6:135550406-135550428 CTTCCTGTTGTTCTGTTTGCTGG + Intergenic
1015676505 6:135755936-135755958 CTGCCTGTTTATATTCTAGCTGG - Intergenic
1018039224 6:159906995-159907017 CTGCCAGTTGAGATGTTCGTGGG - Exonic
1018133634 6:160756651-160756673 CTTCATGTTCATATATTGGCTGG + Intergenic
1022684757 7:32586383-32586405 CTGGCTGTTGTATTGTTGGCAGG + Exonic
1024233839 7:47383172-47383194 CTGCCTATTCATTTGTTAGCTGG - Intronic
1024977159 7:55124628-55124650 CTGACTGTTGTCATCTTGGCTGG - Intronic
1026858532 7:73770232-73770254 CTGCCTGTGGCTTTGTGGGCGGG + Exonic
1028659251 7:93249859-93249881 CTGCCTGTTGATAGGCTAGTTGG + Intronic
1033315411 7:140292880-140292902 CTGCTGGATGATATGTTGCCAGG - Intergenic
1034634975 7:152559976-152559998 TTGCCTGTTTATGTGTTGCCTGG - Intergenic
1036424292 8:8629125-8629147 CTGCCATTTGTTATGTTGGGAGG + Intergenic
1039011129 8:33094130-33094152 ATGCCTGTTGAAATATTGGCTGG - Intergenic
1045984378 8:108232226-108232248 CTTCCTGTTGGCATATTGGCAGG - Intronic
1048495643 8:134933587-134933609 CTGCCTCATGACATGGTGGCTGG + Intergenic
1049906748 9:224938-224960 CCACCTGTTGACATGCTGGCTGG + Intronic
1050569520 9:6922766-6922788 CTGCTTGAGGATATGTTGGAAGG - Intronic
1051551988 9:18340011-18340033 CTTCCTGTTGATATGTCTGGTGG + Intergenic
1058394347 9:104533235-104533257 TTGCCTGCTTCTATGTTGGCGGG + Intergenic
1059632095 9:116135705-116135727 CTGCCTCTTGATATGATGCCAGG - Intergenic
1062232578 9:135490340-135490362 GTGCCTGTGGGGATGTTGGCTGG + Intergenic
1186047732 X:5554042-5554064 CTGCCTGTTGAGATAGTGGGTGG + Intergenic
1187481932 X:19664694-19664716 CTGCATGTTGATATTGTGACAGG + Intronic
1189149544 X:38690982-38691004 CTGCCTGATGTTATTTTGGTGGG + Intergenic
1189700291 X:43711652-43711674 CTCCCTGGTGCTGTGTTGGCTGG - Intronic
1190655972 X:52612403-52612425 CTGCCTTTTGCTATGTTTCCAGG + Intergenic
1190794328 X:53726764-53726786 CAGCCTTTTGCTATGTTGCCAGG + Intergenic
1191769191 X:64737569-64737591 CTGCCTGTTTATATTCTAGCTGG + Intergenic
1199571599 X:149272236-149272258 CTGCCAGGTCATTTGTTGGCAGG - Intergenic