ID: 1102238250

View in Genome Browser
Species Human (GRCh38)
Location 12:111308229-111308251
Sequence CTCTCCTCCAGCCCGGGGGC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 471
Summary {0: 1, 1: 1, 2: 4, 3: 55, 4: 410}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1102238244_1102238250 -10 Left 1102238244 12:111308216-111308238 CCTCTTGAAAGACCTCTCCTCCA 0: 1
1: 0
2: 4
3: 32
4: 324
Right 1102238250 12:111308229-111308251 CTCTCCTCCAGCCCGGGGGCTGG 0: 1
1: 1
2: 4
3: 55
4: 410
1102238243_1102238250 1 Left 1102238243 12:111308205-111308227 CCGGGTCAGTGCCTCTTGAAAGA 0: 1
1: 0
2: 0
3: 6
4: 121
Right 1102238250 12:111308229-111308251 CTCTCCTCCAGCCCGGGGGCTGG 0: 1
1: 1
2: 4
3: 55
4: 410

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1102238250 Original CRISPR CTCTCCTCCAGCCCGGGGGC TGG Intronic
900188321 1:1343118-1343140 CTGTCCTCCTACCTGGGGGCTGG - Intronic
900322449 1:2091826-2091848 CTGTCCTCCCGCCTGGGGTCAGG - Intronic
900347104 1:2215133-2215155 CCCTCCTCAGGCCCGAGGGCTGG - Intergenic
900363926 1:2302905-2302927 CCCTCCACCAGCCCCGTGGCTGG - Intronic
900463471 1:2812423-2812445 TTCTCCTGCAGCCTGGGGCCTGG - Intergenic
900534288 1:3169392-3169414 CTCTCCTCAGGGCCGGGGGTTGG + Intronic
900571988 1:3363147-3363169 AAGTCCTCCAGCCCGGGGGTCGG + Intronic
900657158 1:3764062-3764084 CTTGCCTCCAGCCCAGGGACAGG - Intronic
900673341 1:3869376-3869398 GTCTCACCCAGCCTGGGGGCTGG + Intronic
901208097 1:7508789-7508811 CTCTCCTCCAGGGCCAGGGCTGG - Intronic
902235987 1:15057781-15057803 CCCTCCTGCTGCCCTGGGGCTGG - Intronic
902363066 1:15952664-15952686 CTTTCCTCCAGCTCGGTGACTGG - Intronic
903410041 1:23134744-23134766 CTATACTCCAGCCTGGGGGACGG + Intronic
903542203 1:24102903-24102925 TATTCCTCCAGCCCTGGGGCTGG + Intronic
904039558 1:27575957-27575979 CTCTGCCCCGGCCCGGGGACTGG + Intronic
904590643 1:31613577-31613599 CTCTCCTCAACACCAGGGGCGGG + Intergenic
905179347 1:36156650-36156672 CCCTCCCCCACCCCGGGTGCCGG + Intronic
905856294 1:41316938-41316960 CTCTCTTCCAGCCTTGGGGCTGG + Intergenic
906010913 1:42524689-42524711 CTCTCCTCCACCCCTGTGGCAGG - Intronic
906284094 1:44574747-44574769 CTGACCTCCAGCCCGGGGTGGGG + Intronic
906727230 1:48052823-48052845 AGCTCCTCCAGCCCAAGGGCTGG + Intergenic
908572388 1:65422963-65422985 CTCTGCTACAGCCCTGGTGCAGG - Intronic
908999904 1:70205703-70205725 CTGTCCTCCAGCCCAGGCGCTGG - Exonic
912306067 1:108568799-108568821 CTCTCCTCCTTCCCAGTGGCTGG - Intronic
912798587 1:112707148-112707170 CCCTCCTCCAGCGCCGCGGCGGG + Intronic
915111348 1:153566325-153566347 CTCTTCTCCAGCTTGAGGGCTGG + Intronic
915170959 1:153977093-153977115 ATCTCCCCCAGCCCCGAGGCCGG + Intronic
915463337 1:156082215-156082237 CCCACCCCCACCCCGGGGGCTGG - Intergenic
917837784 1:178954395-178954417 CTCTCTTCCAGCCTGGGTGGGGG + Intergenic
918511192 1:185316427-185316449 CCCTACTCCAGGCCCGGGGCTGG + Intronic
919842272 1:201618247-201618269 GCCTCATCCAGCCCGGGTGCAGG - Intergenic
920260566 1:204685373-204685395 CTCGCCTTCCGCCCGGGGCCGGG + Intronic
921168226 1:212522848-212522870 CTCTCCTCCAGCCCCTGCACAGG - Intergenic
922211130 1:223487623-223487645 CTCTCCTGGAGCCTGGGGCCTGG - Intergenic
922719601 1:227893521-227893543 CTCACCCCTAGCTCGGGGGCTGG + Intergenic
1062874082 10:931471-931493 CTCGCCTCAACCCCGGGGCCCGG + Exonic
1064096393 10:12427458-12427480 TTGTCCTCCAGCTTGGGGGCCGG - Intronic
1065352498 10:24807967-24807989 CTGTACTCCAGCCTAGGGGCAGG + Intergenic
1065817524 10:29495589-29495611 CTCTCCTCCAGGCTGAGGGGAGG + Intronic
1065917888 10:30367703-30367725 AGCAGCTCCAGCCCGGGGGCAGG - Intronic
1065955337 10:30688809-30688831 CTCTCCTCCAGGCTGAGGGGAGG - Intergenic
1066997603 10:42578205-42578227 CTTTCCTGCAGCCCTGTGGCTGG - Intronic
1067029132 10:42868627-42868649 CTTTCCTCCTGCCCTGAGGCTGG + Intergenic
1067437342 10:46287388-46287410 CTCTCCTGGAGCCCAGGGCCAGG - Exonic
1070103795 10:73413728-73413750 CCCTCCACCTGCCCGAGGGCGGG + Intronic
1070546323 10:77455742-77455764 CTCTGCTCTGGCCCAGGGGCTGG - Intronic
1071344075 10:84674729-84674751 CTCTCCTCCACCCCCAGGGAGGG + Intergenic
1071353400 10:84768687-84768709 CTTTCCTCCATACAGGGGGCAGG + Intergenic
1073146391 10:101284553-101284575 CTCGCCTCCAGCCCGGGGTAAGG + Intergenic
1073176721 10:101561420-101561442 CTCTCCCCCAGCTTTGGGGCTGG + Intergenic
1074564182 10:114562123-114562145 CCCTCCTCCAGGTCAGGGGCTGG + Intronic
1074771753 10:116739496-116739518 CTCTCCTCAAGCCCGTGCCCTGG + Intronic
1075038835 10:119091590-119091612 CTCTACTCCAGCCTGGGTGATGG + Intergenic
1075079174 10:119371244-119371266 CTCTCCCCTAGCCCGGTGGGAGG + Intronic
1075389571 10:122083006-122083028 CTCTCTTCCAGCACTGGGGACGG - Exonic
1075717541 10:124565828-124565850 CCCTGCTCCAGCCCGGCGTCGGG + Intronic
1075723964 10:124602441-124602463 CTCTCCACCAGCCAGTGGGCAGG - Intronic
1076080853 10:127579107-127579129 CTCACCTCCAGCCTGGGGGTAGG + Intergenic
1076499589 10:130926919-130926941 CTCACCTCCAGCACTGGTGCAGG - Intergenic
1076841728 10:133049175-133049197 GTCTCCTGTAACCCGGGGGCTGG + Intergenic
1077009169 11:372651-372673 CTCTCCTGCAGCCCGAAGGTCGG + Exonic
1077072015 11:679276-679298 CTGCCCTCCAGCCTGGGGGATGG + Intronic
1078432367 11:11297963-11297985 CTCTCCTCCAGGCCAGGGGTAGG + Intronic
1081487980 11:43546766-43546788 CCCTCCTCCAGCCTGGGGTTGGG - Intergenic
1082831096 11:57617892-57617914 CACTCCTCCAGTCTGGGGGATGG + Intergenic
1083366212 11:62142935-62142957 CTGTCCTCCAGCCAGGAAGCTGG + Intronic
1083445558 11:62706159-62706181 GTCCCCTCCAGCTCGGGGGTGGG + Intronic
1083623730 11:64061338-64061360 CTCACCTCCAGGCTGCGGGCTGG - Intronic
1083684567 11:64368693-64368715 TTCGCCTCCAGCCTGGGGGACGG - Exonic
1084177940 11:67433223-67433245 CCCTCCTCCTCCCCGGGGGCTGG - Intronic
1084412096 11:69011154-69011176 CACTCCTCCCGCCCGGGGGCGGG + Intronic
1084574888 11:69982727-69982749 CACTCCTCCAGGCTGGAGGCTGG + Intergenic
1084966812 11:72749096-72749118 CTCTGCTCCAGAGCGGGGACTGG + Intronic
1085350531 11:75795503-75795525 CCCACCTCCTGCCCTGGGGCTGG - Intronic
1087439954 11:98170893-98170915 CTCTACTCCAGCCTGAGGGACGG - Intergenic
1088537277 11:110874994-110875016 CTCTCATCCAGCATGGGGGTGGG + Intergenic
1088869802 11:113880834-113880856 CTCTACTCCAGCCTGGGTGATGG + Intergenic
1088920668 11:114258031-114258053 CTCTCCTCCCTGCCTGGGGCAGG + Intronic
1088922654 11:114272398-114272420 CTCTACTTCAACCCTGGGGCAGG + Intronic
1089168993 11:116499647-116499669 CTCTCTCCCAACCCAGGGGCGGG + Intergenic
1089457547 11:118634288-118634310 CTCCCCTCCTGCCCAGGGTCGGG - Intronic
1089523519 11:119081558-119081580 CTGACCTCCAGCCTGGAGGCTGG + Exonic
1089609541 11:119661721-119661743 CTCTCTTGCAGCCCGGGCACTGG + Exonic
1089647462 11:119889644-119889666 CTCACTTCCTGCCCGGGGACTGG - Intergenic
1090335059 11:125956521-125956543 AGCTCCCCCAGCCTGGGGGCGGG - Exonic
1091235707 11:134020796-134020818 CTCTCCTCCACCGCGGGGTTAGG + Intergenic
1091402530 12:189536-189558 TTCTCCTGCAGCCCCTGGGCGGG + Intergenic
1091556508 12:1577567-1577589 GTTTCCTCCAGCCTGGGGGCGGG - Intronic
1091793877 12:3286388-3286410 CTCCCGTGCTGCCCGGGGGCAGG - Exonic
1091837401 12:3595358-3595380 CCCTTCTGCAGCCCAGGGGCAGG - Intergenic
1091965484 12:4737465-4737487 CTCTCCTCCCTCCCAGAGGCAGG - Intronic
1092963816 12:13622374-13622396 CTGTCCTGCAGCCCCGGGGCAGG + Intronic
1095245613 12:39917636-39917658 ATCTCCTCCTGCCCTGGGACTGG + Intronic
1096007395 12:48184056-48184078 CCCTCCCCCACCCCGGAGGCCGG + Exonic
1096155088 12:49337160-49337182 CTCCCCTCCCTCCCGGGCGCGGG + Exonic
1097678979 12:62631893-62631915 GGGTCCTCCAGCGCGGGGGCGGG + Intergenic
1101023122 12:100573584-100573606 CTTCCCGGCAGCCCGGGGGCGGG + Intergenic
1101942619 12:109111187-109111209 CGCTGCTCCAGGCCGGGGGTTGG - Intergenic
1102050100 12:109855970-109855992 CTCTCCTCCAGGCCTGGTGCTGG + Intronic
1102111767 12:110370706-110370728 CCCTCCTGCTGCCCTGGGGCAGG + Intergenic
1102238250 12:111308229-111308251 CTCTCCTCCAGCCCGGGGGCTGG + Intronic
1103488185 12:121296726-121296748 CTCTCCTCCGCCCGGGCGGCGGG + Intronic
1103880179 12:124159978-124160000 CTGACCTCCAGCCTGGGGCCTGG + Intronic
1103948163 12:124538441-124538463 CTCTGCTCCAGCCAGGGCCCTGG - Intronic
1104203695 12:126616611-126616633 CCCTGGACCAGCCCGGGGGCAGG + Intergenic
1104374527 12:128252122-128252144 CTCTCCTGCAGCCAGGGTTCTGG - Intergenic
1104885031 12:132102180-132102202 CTCTCCTCCCAGCCGGGGTCAGG + Intronic
1105203024 13:18195151-18195173 CTTTCTTCCACCCCTGGGGCTGG + Intergenic
1105608570 13:21947676-21947698 CTCTCCTCCACCCCCAGGGGTGG + Intergenic
1106157223 13:27170955-27170977 CTTTCCCCCAGCGCGGGGTCGGG + Intronic
1107508901 13:41061752-41061774 CTCTCCTCCCGCCCTTCGGCCGG + Intronic
1107865127 13:44695954-44695976 CTCTGCTCCAGCACTGGGGCTGG - Intergenic
1108096513 13:46907414-46907436 CTGTACTCCAGCCTGGGTGCTGG - Intergenic
1110098249 13:71559909-71559931 CCCTCCTCCAGAGAGGGGGCAGG + Exonic
1112503028 13:99956760-99956782 CTCTCCCCCAGCCCGCGGCCCGG - Intergenic
1113668086 13:112154692-112154714 CTGTCCTCCTGGCCGGGAGCTGG - Intergenic
1113910304 13:113838473-113838495 CCCTCCTCCTGCTCCGGGGCTGG - Intronic
1113937502 13:114002084-114002106 TTCTCCTCCAGCTCGGCCGCCGG - Intronic
1113957279 13:114105517-114105539 CCCTCCTCCAGCACGGGGACAGG + Intronic
1114445262 14:22783435-22783457 CTGTACTCCAGCCTGGGGGACGG - Intronic
1115651217 14:35404137-35404159 CCGTCCTCTAGGCCGGGGGCGGG - Intronic
1118319247 14:64743506-64743528 CTCTCCTCCAGCCCTGCAGTGGG - Exonic
1119261130 14:73238332-73238354 CTCTCCTGCCGCCCGAGGGCAGG - Intronic
1121441027 14:93949553-93949575 CTCTCCCTCAGGCCGGAGGCAGG - Intronic
1122081899 14:99272562-99272584 ATCTCCTCCATCCTGGGAGCAGG + Intergenic
1122278914 14:100609967-100609989 CTCTGCTCCTGCCCCAGGGCTGG + Intergenic
1122278919 14:100609974-100609996 CCCTCCCCCAGCCCTGGGGCAGG - Intergenic
1122776276 14:104118274-104118296 CCCACCTCCAGCCAGGGGCCGGG + Intergenic
1123181744 14:106477759-106477781 CTCTGCACCTGCCCTGGGGCTGG + Intergenic
1202945160 14_KI270726v1_random:18969-18991 CTCTGCACCTGCCCTGGGGCTGG - Intergenic
1123473163 15:20569496-20569518 GGCAGCTCCAGCCCGGGGGCAGG + Intergenic
1123644843 15:22430857-22430879 GGCAGCTCCAGCCCGGGGGCAGG - Intergenic
1123705516 15:22948090-22948112 CCCTCCTCCAGCACTGGCGCAGG + Intronic
1123733464 15:23164507-23164529 GGCAGCTCCAGCCCGGGGGCAGG + Intergenic
1126189170 15:45861653-45861675 CTCTACTCCAGCCTGGGCGATGG + Intergenic
1126691975 15:51294723-51294745 CTCACCTCCCTCCCGGGGGGCGG - Intronic
1128582272 15:68818515-68818537 CCCGCCTCCAGGCAGGGGGCAGG + Intronic
1128772359 15:70291860-70291882 CTTTCCTCCTCCCTGGGGGCAGG - Intergenic
1129410501 15:75348080-75348102 CCCTCCCCCAGGCCCGGGGCAGG + Intronic
1130252198 15:82306944-82306966 CCCTGCTCCAGCCCGGGGACTGG - Intergenic
1131097872 15:89667242-89667264 TTCCCCTCTAGCCCTGGGGCTGG - Intronic
1131118803 15:89810340-89810362 CTGTACTCCAGCCTGGGGGACGG + Intronic
1132247900 15:100311378-100311400 CCCTCCTCCAGCCTCAGGGCTGG + Intronic
1132527834 16:426226-426248 CCTCCCTCCAGCCCCGGGGCCGG - Exonic
1132586883 16:709467-709489 CTGTGCTCCAGGCAGGGGGCAGG - Intronic
1132614154 16:832042-832064 CTCTCCTCCCGGCTGGGGCCCGG + Intergenic
1132690174 16:1178593-1178615 CTCTCCCACAGCCTGGAGGCTGG - Intronic
1132976020 16:2711578-2711600 CACTCCTCCAGCCCAGGGGTGGG - Intergenic
1133316250 16:4885809-4885831 CTCTCCTCCAGCACGGGATCCGG + Exonic
1133791642 16:9013570-9013592 CTCTGCTCCAGCACGAGGCCTGG - Intergenic
1133972589 16:10578545-10578567 CCCTCCTCCAGCCCGAGGTGGGG + Intronic
1134578448 16:15351495-15351517 CTGTCCCCCAGCCAGGCGGCCGG + Intergenic
1134724141 16:16406049-16406071 CTGTCCCCCAGCCAGGCGGCCGG - Intergenic
1134943288 16:18305820-18305842 CTGTCCCCCAGCCAGGCGGCCGG + Intergenic
1135325086 16:21520782-21520804 CTCTCGTCAAGCCTGGGAGCGGG + Intergenic
1136131987 16:28228589-28228611 CTATCCTCTAGCCAAGGGGCAGG + Intergenic
1136336569 16:29614050-29614072 CTCTCGTCAAGCCTGGGAGCGGG + Intergenic
1137655162 16:50153226-50153248 CGCTCCTCCGGCCCCGGGGCGGG - Intronic
1138132398 16:54491923-54491945 CTGTACTCCAGCCCGGGTGACGG + Intergenic
1138180426 16:54937255-54937277 CGTTCCCCCAGCCCGGGTGCGGG + Intergenic
1138206404 16:55128501-55128523 CTCTACTCCATCCCTGGGCCTGG + Intergenic
1138500783 16:57442569-57442591 CTCTCCTCCACCCCAGTAGCTGG - Intronic
1141976079 16:87517520-87517542 CTCTCTCCCTGCCCAGGGGCTGG - Intergenic
1142037295 16:87869834-87869856 CTCTCGTCAAGCCTGGGAGCGGG + Intergenic
1142226103 16:88878347-88878369 ATCTCCTCCCACCCCGGGGCTGG + Intronic
1142232289 16:88905591-88905613 CTCTCCTCCAGCCCCTAAGCGGG - Intronic
1142263859 16:89054653-89054675 GCCTCCTCCAGCCTGGGGCCTGG - Intergenic
1142619134 17:1154011-1154033 CTCTGCTCCCACTCGGGGGCGGG + Intronic
1143282349 17:5764406-5764428 CTCCCCACCAGCCAGAGGGCTGG - Intergenic
1143538874 17:7558023-7558045 CTCTGCTCCCACCTGGGGGCTGG - Intronic
1143768071 17:9150615-9150637 CTCTCCGCCTGCCCGGCGGGCGG - Intronic
1144058229 17:11559782-11559804 CCCGCCTCCAGCCTGGGGGTTGG + Exonic
1144580265 17:16454967-16454989 CTGTACTCCAGCCTGAGGGCGGG - Intronic
1144910037 17:18672964-18672986 CTCTCCTCTCGCGCCGGGGCGGG + Exonic
1145941358 17:28744851-28744873 CTCCCCTCTCTCCCGGGGGCTGG + Intronic
1146056843 17:29585549-29585571 CTTTCCCCCAGCCTGGGGGAGGG + Intronic
1146683275 17:34823884-34823906 CTGTCCTCCAGCCAGGAGGTAGG + Intergenic
1147110119 17:38256274-38256296 GCCTGCTCCAGCCCAGGGGCTGG - Intergenic
1147157756 17:38552772-38552794 TTCTCCTCCAGCTCAGGGCCGGG + Exonic
1147238979 17:39078037-39078059 CTCTCCTGCAGGCAGAGGGCAGG - Exonic
1147579043 17:41618266-41618288 CTCTCCTCGTGCCTGGAGGCTGG - Intergenic
1147960310 17:44163346-44163368 CTGTACTCCAGCCTGGGCGCTGG + Intergenic
1148385613 17:47232517-47232539 CTGTACTCCAGCCTGGGAGCAGG - Intergenic
1148419394 17:47532147-47532169 GCCTGCTCCAGCCCAGGGGCTGG + Intronic
1148677305 17:49452760-49452782 CTCTCATTCAGCCCTGGGGGTGG + Intronic
1148715111 17:49710557-49710579 CTCTCCGCCCGCCCCAGGGCTGG - Exonic
1149597869 17:57874769-57874791 CTCCCCTCCAGTGAGGGGGCGGG - Intronic
1150615129 17:66764484-66764506 CTTTCTTCCAGCCCGGGCACAGG - Intronic
1151305214 17:73258751-73258773 CTCTCGTCCTGCCAGGGAGCGGG + Intronic
1151540214 17:74760968-74760990 CCCTCCTCCAGGCCTGGTGCAGG - Intronic
1151573185 17:74937447-74937469 CTCTCCTCCAGCCCCCAAGCAGG - Intronic
1151584705 17:75002053-75002075 GTCTCCGTCAGCCTGGGGGCGGG - Exonic
1151786834 17:76279227-76279249 CTCCCTTCCAGGCCGGGGGCGGG - Intronic
1152020960 17:77780021-77780043 CTCTCCCCCAGCCCCGGGACAGG + Intergenic
1152112871 17:78366705-78366727 AGCTCCTGCAGCCCGGGCGCAGG + Intergenic
1152242568 17:79168013-79168035 CCCTCACCCAGCCCTGGGGCTGG - Intronic
1152419674 17:80185663-80185685 CTTTCCCCCAGCCCAGGGTCGGG + Intronic
1152468457 17:80478016-80478038 CTCTGCTCCCGCCCGAGGGGCGG - Intergenic
1153526621 18:6001046-6001068 CCATCCTCCAGCCCTGTGGCAGG + Intronic
1153719690 18:7889371-7889393 CTGTACTCCAGCCCGGGTGATGG - Intronic
1154106492 18:11527949-11527971 ATCTCCTCCAGCAGGAGGGCCGG + Intergenic
1154387683 18:13910626-13910648 CTCTCCTCCAGGCAGGCTGCAGG - Intronic
1156036056 18:32769762-32769784 CGCTCCACCAGCTCCGGGGCCGG + Exonic
1160054674 18:75467263-75467285 CTTTCCTCCAGCACAGGGGCTGG + Intergenic
1160679687 19:407024-407046 CTCTCCTCCACACCGGGTGCTGG - Exonic
1160724200 19:610460-610482 CTCTCCTGGAGCCCAGGAGCCGG + Intronic
1160764559 19:801648-801670 CTCCCCTCCAGCTCAGAGGCTGG - Intronic
1160864387 19:1250570-1250592 CTTTGTTCCCGCCCGGGGGCCGG - Intronic
1160874117 19:1289481-1289503 CTCTCCTCCTCCCCTGGGGACGG + Intronic
1161011552 19:1961626-1961648 CTCTCTTCCAGCACAGGGACTGG - Intronic
1161337375 19:3721809-3721831 CCCTCCCCCAGCCCGGGGTGGGG + Exonic
1161578037 19:5065660-5065682 CTCCCCTCCAGCCAGCGGACAGG - Intronic
1161680311 19:5676808-5676830 CTCCCCTCCATCCAGGCGGCCGG - Intronic
1161821050 19:6531509-6531531 CTGTACCCCAGGCCGGGGGCGGG + Intronic
1161938330 19:7386047-7386069 CTCCCCGCCACCCCCGGGGCTGG + Intronic
1162824763 19:13244668-13244690 CCCTCCTCTAGCCCCGGGCCTGG - Intronic
1163747132 19:19055222-19055244 CTCACCTCCAGCCAGGCCGCTGG - Intronic
1164390453 19:27815166-27815188 CTCACCTCCAGCCCTAAGGCTGG - Intergenic
1165099329 19:33429180-33429202 CTCTCCTCCAGCAGGGATGCAGG - Intronic
1165389728 19:35531492-35531514 CTCCCCTGCAGCCCCGGGGTAGG - Intergenic
1165767371 19:38359865-38359887 GTGTTCTCCAGCACGGGGGCAGG - Intronic
1166144076 19:40822381-40822403 ATCTCCTCCTGCACGTGGGCTGG + Intronic
1166183530 19:41124715-41124737 ATCTCCTCCTGCACGCGGGCTGG - Exonic
1166185639 19:41137158-41137180 CTCTGCCCCAGCCAAGGGGCAGG + Intergenic
1166746717 19:45145273-45145295 CGGTCCTGCAGCCCTGGGGCGGG + Intronic
1166782539 19:45350028-45350050 CTGTCCTCCATCCCCAGGGCAGG + Exonic
1167576550 19:50320523-50320545 CTCTCCTCCCTCCCCTGGGCAGG + Intronic
1167662664 19:50805010-50805032 CCCGCCTCCAGCCCAGTGGCTGG - Intergenic
1167888248 19:52519480-52519502 CTCACCTCCAGCCACAGGGCAGG - Intergenic
1168152011 19:54454433-54454455 CTCTCATCCATGCCGGGGACTGG - Exonic
1168315573 19:55483429-55483451 CCCTCCTCCAGTGCTGGGGCTGG + Exonic
925017581 2:543634-543656 CTACCCTCCAGCCTGTGGGCAGG - Intergenic
925104758 2:1281903-1281925 GTCTCCTCAAGCCCGGGAGGAGG + Intronic
925662197 2:6213979-6214001 CTGCCCTCCAGCCTGGGGGACGG + Intergenic
926622043 2:15055488-15055510 ATCTTCTCCAGCTGGGGGGCGGG + Intergenic
927920826 2:26970853-26970875 CCCTCCCCCAGCCCGGGCCCTGG - Intronic
928394188 2:30931512-30931534 CTCTCCTCCTGTCTGGGGGGTGG - Intronic
929460999 2:42101928-42101950 CTCTCCTCCAGCCCAGTTGCCGG + Intergenic
932699756 2:73984793-73984815 CTCTCGCCCGGCCCGGGGCCCGG + Intergenic
932866036 2:75344110-75344132 CTCTCCTCCACCACCTGGGCTGG + Intergenic
934518958 2:95007333-95007355 CTCACCTCCAGCCCCTGGGGTGG + Intergenic
935632881 2:105226567-105226589 CTCTACTCCAGCCTGGGCGATGG - Intergenic
937265833 2:120614123-120614145 TTCCCTTCCAGCCCGGGGCCTGG - Intergenic
937313103 2:120914335-120914357 GTCTCCTCCAGCTCCTGGGCTGG + Intronic
937917839 2:127107547-127107569 CTCACCTCCCGCCCGGTGCCCGG + Intergenic
938222909 2:129587265-129587287 GTCTCATCCAGCCCTGGGGAAGG - Intergenic
940005258 2:149004043-149004065 CTGCCTTCCAGCCCAGGGGCAGG - Intronic
940842488 2:158599857-158599879 ATCCCCTCCAGCCAGAGGGCAGG - Intronic
942955122 2:181764516-181764538 CTCTCCTCCCACATGGGGGCTGG + Intergenic
944154194 2:196593426-196593448 CCTTCCTCCCGCCCGGGTGCCGG + Intronic
944375391 2:199035532-199035554 GTCTCCTCCAGCCTGGCGACAGG - Intergenic
944431025 2:199633788-199633810 CTCTCTGCCAGCCCTGGGGCTGG + Intergenic
945816681 2:214613487-214613509 CTGTACTCCAGCCTGGGGGATGG - Intergenic
946008923 2:216549187-216549209 CTCTCCCCCCGCCATGGGGCTGG + Intronic
946012557 2:216577885-216577907 CTCTCTTCCATCCTTGGGGCTGG - Intronic
946329527 2:219001611-219001633 CTCAGCACCAGCCCGGGGGCCGG - Intergenic
946371313 2:219283150-219283172 TTCTCCTTCAGTCCTGGGGCTGG + Exonic
947527159 2:230885766-230885788 GCCTCCTCAAGCCCAGGGGCAGG - Intergenic
947589496 2:231377342-231377364 CTCTCCTCTGGCCCCTGGGCAGG + Intergenic
947870732 2:233436454-233436476 CTCCCCTCCAGCCCGGGCGCAGG - Intronic
947907748 2:233777958-233777980 CACTCCTCCTTCCCGGGGACTGG - Intronic
948177475 2:235955294-235955316 CTCTCCATCAGCACGTGGGCAGG + Intronic
948206653 2:236166269-236166291 GTCTCCTCCAGCGCGTGGCCCGG + Exonic
948402654 2:237694756-237694778 CTCTCCTACAGCTCCAGGGCTGG - Intronic
948653954 2:239465287-239465309 CTCTCATCCAGCCGGGAGGTGGG + Intergenic
948661219 2:239507837-239507859 CCGTCCTCCAGCCCGAAGGCTGG - Intergenic
948785428 2:240350013-240350035 CTCTCCTCTAGCCTGCAGGCTGG + Intergenic
948796396 2:240404483-240404505 CCGTTCTCCAGCCTGGGGGCTGG + Intergenic
1169524332 20:6406980-6407002 CTGCACTCCAGCCCGGGGGATGG + Intergenic
1171374852 20:24685487-24685509 ATCTCATCAAGCCCCGGGGCAGG - Intergenic
1172490613 20:35333946-35333968 CTCTCCTGAAGGCCGGGGGCTGG + Intronic
1172864137 20:38082421-38082443 CTCTACTCCAGCCTGGGGGACGG - Intronic
1172959323 20:38787416-38787438 CTGACCTCCAGCCTGGGGACAGG - Intergenic
1173335193 20:42106910-42106932 CTCTCTTCCAGTGCTGGGGCTGG - Exonic
1174162646 20:48562650-48562672 CTCTCCTCCAGCCCCTGGGGTGG - Intergenic
1174190683 20:48738360-48738382 CTCTCCTTCAGCCTGTGGGAAGG + Intronic
1174402225 20:50282253-50282275 GTGTCCCCCAGCCAGGGGGCGGG + Intergenic
1174544833 20:51317551-51317573 GTCTCCTCTTGCCCGGGAGCTGG + Intergenic
1174605610 20:51759228-51759250 CTCTCCTCCAGCCCAGAGAGGGG + Intronic
1175108111 20:56628731-56628753 CTCTCCTCCCGCCCGGGGGCCGG + Intergenic
1175267244 20:57710108-57710130 CCCTCCCCGAGCCGGGGGGCGGG + Intronic
1175877429 20:62237014-62237036 TTCTCCCCCACCCCAGGGGCTGG - Intronic
1176113605 20:63421735-63421757 TCCTCCTCCAGCACGGGGGCAGG + Intronic
1176160257 20:63644013-63644035 CTCTCGCCCAGCCCTGGGGTTGG - Intronic
1176385866 21:6138314-6138336 CTCTCCTCCCCTCCGGGGTCAGG + Intergenic
1176414519 21:6467204-6467226 CACTCCGCCGGCGCGGGGGCTGG + Intergenic
1176426595 21:6552479-6552501 ATCCCCTCCGGCCCAGGGGCTGG - Intergenic
1176714935 21:10342854-10342876 CTTTCGTCCACCCCTGGGGCTGG - Intergenic
1178361909 21:31955552-31955574 CTCTACTCCAGCCTGGGCGATGG + Intronic
1178505105 21:33156060-33156082 CTATACTCCAGCCCGGGTGATGG - Intergenic
1178617324 21:34145438-34145460 CTTTCCTCCAGCCAGGGGGCAGG - Intergenic
1179097619 21:38329631-38329653 CTGTGCTCCAGCCCTGGGACAGG + Intergenic
1179308717 21:40178107-40178129 CTCTCCTCCTGCCAGGAGGCGGG + Intronic
1179520734 21:41942767-41942789 CTCTCCTACCCCCCAGGGGCTGG + Intronic
1179690017 21:43075526-43075548 CACTCCGCCGGCGCGGGGGCTGG + Intronic
1179702086 21:43160801-43160823 ATCCCCTCCGGCCCAGGGGCTGG - Intronic
1179737607 21:43399938-43399960 CTCTCCTCCCCTCCGGGGTCAGG - Intergenic
1179783856 21:43719020-43719042 CTTCCTCCCAGCCCGGGGGCGGG + Intergenic
1179878694 21:44284542-44284564 CTCTCCTCTAGACCAGGGGTCGG - Intergenic
1180092837 21:45541840-45541862 CTTTCCTCCAGACCCGGGGGTGG + Intronic
1180099534 21:45578066-45578088 CTCACCTCCAGCCCCATGGCGGG - Intergenic
1180603413 22:17037084-17037106 CTTTCGTCCACCCCTGGGGCTGG + Intergenic
1180623055 22:17174797-17174819 CTGTACTCCAGCCTGGGGGATGG + Intergenic
1181521406 22:23450609-23450631 CTGACCTCCAACCCCGGGGCTGG + Intergenic
1181677349 22:24464325-24464347 CTCTACTCCAGCCTGGGTGACGG - Intergenic
1182233905 22:28860676-28860698 CTGCCCTCCAGCCCGGGGGACGG - Intergenic
1182576546 22:31276791-31276813 CTCTCCTGCGGCCCCGGGGGGGG - Exonic
1183244733 22:36685178-36685200 GTCTCTCCCAGCCTGGGGGCGGG + Intronic
1183352302 22:37341121-37341143 CTCACCAGCAGCCAGGGGGCAGG + Intergenic
1183393737 22:37560383-37560405 GTCTCCTCCCGCCCGCGGGCGGG - Intergenic
1183476855 22:38040366-38040388 CTCTGCTCCAGCCCATGGCCTGG - Intronic
1183486232 22:38089064-38089086 CCCTCCTGCCGCCCCGGGGCGGG + Intronic
1183739551 22:39662322-39662344 CAGTCCTCATGCCCGGGGGCCGG - Exonic
1183776161 22:39967540-39967562 CCCACGTCCAGCCCGGCGGCAGG + Intronic
1184479734 22:44739299-44739321 CAGTCCTCCTGCCCTGGGGCAGG + Intronic
1184479739 22:44739306-44739328 CTCCCCTCCTGCCCCAGGGCAGG - Intronic
1184679421 22:46062081-46062103 CGCACCTCCCGCCCCGGGGCCGG + Intronic
1184943804 22:47786991-47787013 CCCTCCTTCAGCCTTGGGGCAGG + Intergenic
1184949693 22:47832528-47832550 CTCTCCACCAGATCTGGGGCAGG + Intergenic
1185049415 22:48546017-48546039 CTCTCCTCCCGCCCAGCGACGGG - Intronic
1185085737 22:48740126-48740148 CTCTCCTCCAACCCTGGAGAGGG + Intronic
1185231402 22:49686281-49686303 CCCTCCACCAGCCAAGGGGCAGG - Intergenic
949563345 3:5222777-5222799 CGCCCCTCCAGCCCTGGGGAGGG - Intergenic
949920814 3:8999152-8999174 CTCTCCTGTAGCTCAGGGGCTGG - Intronic
949930553 3:9074917-9074939 CTCTCCTGCAGCCCTGGGCTTGG + Intronic
950555005 3:13690043-13690065 CTCCCCTCCTGCCTGGGGGAGGG + Intergenic
953605635 3:44411450-44411472 CTCTGCTCCAGCCAGGGGACGGG + Intergenic
953927068 3:46987956-46987978 GTCTCCTCCCGCCCCGGGGCTGG - Intronic
954363282 3:50133620-50133642 CTCTTCTCCAGCCAGGAGGCAGG - Intergenic
954653148 3:52177535-52177557 CTCTACTCTAGCCCAAGGGCAGG - Intergenic
954698287 3:52439030-52439052 GTCTCCTCCAACCCTGGGGTGGG + Intronic
954800349 3:53183593-53183615 CCCTCCTGCAGCCCAGGGGCGGG - Intronic
955019470 3:55105343-55105365 CTCCCCTCCAGCATGGGAGCTGG + Intergenic
958942867 3:100334655-100334677 CTCTCCTCCCGGCCGGGGCCAGG + Intergenic
961486008 3:127217007-127217029 CTCTCCACCATCCCGGGCCCTGG + Intergenic
961559620 3:127719473-127719495 CTCCTCTCCAGCCCAGGAGCAGG - Intronic
962588204 3:136862780-136862802 CTCACCTCCAGCCCGAGAGGAGG + Intronic
963919011 3:150888068-150888090 CTGTACTCCAGCCCGGGAGCCGG + Intronic
966469650 3:180274848-180274870 TTCTCCTTCAGGCAGGGGGCGGG - Intergenic
966750092 3:183313692-183313714 TTCTCCTCCAGCCTGAGTGCGGG - Intronic
967382305 3:188872686-188872708 GTCTCCTCCTGGCCCGGGGCTGG - Exonic
968151242 3:196338337-196338359 CACTCCTCCAGCTCCAGGGCTGG + Exonic
968879783 4:3292997-3293019 CTCGCCTCGACCCCGGGGGGCGG + Intergenic
969046349 4:4339345-4339367 CTCACCTCCACCCAGGGGACGGG + Intergenic
969614112 4:8242383-8242405 CTTCCCTCCAGCCCCGCGGCGGG - Intergenic
973317829 4:48780019-48780041 TTCTCTTCCAGCCCCGGGGCAGG - Intronic
974899093 4:67974478-67974500 CTGTACTCCAGCCTGGGGGATGG - Intergenic
977568789 4:98609350-98609372 CTCTCCCCCAGCCAGTGGTCGGG - Intronic
983332619 4:166350732-166350754 CTCTACTCCAGCCTGGGTGACGG + Intergenic
984638932 4:182142977-182142999 CTTTCCTGCAGACAGGGGGCGGG + Intergenic
984824285 4:183910506-183910528 CCCTCCCCCAGCCCTGGGGATGG + Intronic
985071667 4:186171582-186171604 CTCTCCTGCTTCCCAGGGGCAGG - Intronic
986668587 5:10124440-10124462 CTCTTCTCCAGCCCAGCTGCTGG - Intergenic
986730653 5:10632575-10632597 CCCTCCTCCTGCCCGGGGTTGGG + Intronic
987243916 5:16029092-16029114 CTCACTTCCAACCCAGGGGCAGG + Intergenic
989474438 5:41857674-41857696 CACTCCTTCAGACCTGGGGCTGG + Intronic
989475511 5:41869610-41869632 CTCCCCTGCAGCCCAGGCGCGGG + Intronic
990553696 5:56909565-56909587 CTCTCCTCCCGGGCCGGGGCGGG + Exonic
991234856 5:64381774-64381796 CTCTACTCCAGCCTGGGTGATGG - Intergenic
991298182 5:65103067-65103089 CTCTCCTCCCGCTCGGGCCCGGG - Intergenic
991674293 5:69076025-69076047 CTCTCTTCCAGCCCTGAGGCTGG - Intergenic
992091842 5:73324479-73324501 CTCTCCTGCAGCTCCAGGGCAGG - Intergenic
992671919 5:79069708-79069730 CCCGCCCCCAGCCCGGGGGGAGG - Exonic
995256209 5:110049660-110049682 CACTTCTCCATCCCTGGGGCTGG + Intergenic
996513699 5:124346127-124346149 CTGCACTCCAGCCTGGGGGCCGG + Intergenic
997130336 5:131270022-131270044 CTCTACTCCAGCCTGGGCGATGG + Intronic
997305237 5:132831206-132831228 CTCTCCCCCACCCCGGTAGCAGG - Intergenic
997428805 5:133823402-133823424 CTCTCCTCCTCTCCAGGGGCTGG + Intergenic
997600942 5:135137925-135137947 GTCCCCTCCAGCCCTGAGGCTGG - Intronic
997608090 5:135191231-135191253 CTCGACTCCACCCCCGGGGCTGG - Intronic
998149358 5:139748030-139748052 CACTGCGCCAGCCCGCGGGCGGG + Intergenic
999736509 5:154517305-154517327 CTCTCCACTAGGCCGGGAGCAGG + Intergenic
1001230546 5:169983684-169983706 CTCTGCTCCACCCTTGGGGCAGG - Intronic
1001568434 5:172715087-172715109 CTGCCCTGCAGCCCTGGGGCTGG - Intergenic
1002098063 5:176843777-176843799 CTCTCCTCCCACTCGGCGGCTGG + Intronic
1002314911 5:178337297-178337319 CTCTGCTCCTTCCCGGGGTCTGG - Intronic
1002641784 5:180633871-180633893 CTCTCCTGCAGTCATGGGGCTGG - Intronic
1005813026 6:29530727-29530749 CTCTGCTCCAGCCTGGAGGTAGG + Intergenic
1006082477 6:31575390-31575412 TTCTTCTCCATCGCGGGGGCGGG - Intergenic
1007162577 6:39803843-39803865 CTCTCCAGCAGCCCCTGGGCAGG - Intronic
1007337109 6:41161939-41161961 CTCTCCTCTCGGCCTGGGGCTGG + Intronic
1007371111 6:41427622-41427644 CTCTTCACCTGCCCCGGGGCAGG - Intergenic
1007785262 6:44276183-44276205 ATCTGCGCCAGCCCGCGGGCCGG + Exonic
1008928303 6:56910519-56910541 CTGTACTCCAGCCTGGGTGCTGG - Intronic
1009797895 6:68495317-68495339 CTCTCTTCAAGCCAGTGGGCAGG - Intergenic
1010141901 6:72622194-72622216 CTCTCCTCCCGCGTGGTGGCGGG - Exonic
1010969339 6:82247500-82247522 CTTCCCTTCAGCCCGGGGGCAGG - Intronic
1011516935 6:88165846-88165868 CTCTCGCCCAGCTCAGGGGCTGG + Exonic
1013273275 6:108561149-108561171 CTCTCCTCTCGCGCCGGGGCGGG - Exonic
1014986987 6:128023434-128023456 CTCTCCTTCTGCCCTGGAGCTGG + Intronic
1016356822 6:143227462-143227484 GTGTCCTCCAGCCTGGGGCCTGG + Intronic
1017731812 6:157323637-157323659 CCCTCCTCCCGCGCCGGGGCCGG + Intergenic
1018956049 6:168411243-168411265 CACTCGTCCAGCCCCGAGGCAGG - Intergenic
1019167268 6:170107043-170107065 CTCTCCTCCAACCCGGGGCTGGG - Intergenic
1019265036 7:110390-110412 CTCCCCTCCGCCCCGTGGGCAGG + Intergenic
1019342937 7:517075-517097 CGCTCCCCCGGCCCGAGGGCAGG + Intronic
1019530389 7:1500140-1500162 CTCGCCTCCTGCCAGGGGCCCGG + Intronic
1019589924 7:1825839-1825861 CTGACCTCCAACCCCGGGGCTGG - Intronic
1019700096 7:2470669-2470691 CTCTGGGCCAGCCTGGGGGCTGG + Intergenic
1019701778 7:2477700-2477722 CTCTGCACCACCCAGGGGGCTGG - Intergenic
1019768335 7:2867371-2867393 CTCCCCTGCAGCCTGGGGGTGGG + Intergenic
1020008123 7:4792952-4792974 CTCCCCTCCTGCCCTGGGGCGGG + Intronic
1020152359 7:5692647-5692669 CTCGCCTCCAGCCCGAGGCAAGG + Intronic
1021106599 7:16645714-16645736 CTCTCCTCCCTCCCGCGGGCTGG + Exonic
1021106602 7:16645721-16645743 CTGTCCGCCAGCCCGCGGGAGGG - Exonic
1021692981 7:23248067-23248089 CTCCCCGCCAGCCTAGGGGCTGG + Intronic
1022094671 7:27131036-27131058 CCCTCCCCCAGCCCAGGGGCCGG - Intronic
1023843178 7:44107904-44107926 CTCTCCTCCGGGGCTGGGGCCGG - Exonic
1024570878 7:50722096-50722118 CTCTCCTGCACCCCAGAGGCAGG + Intronic
1026306981 7:69150850-69150872 CTGCACTCCAGCCTGGGGGCTGG + Intergenic
1026918261 7:74136200-74136222 CTGTACTCCAGCCTGGGGGACGG - Intergenic
1029458230 7:100681683-100681705 CTGGCCTACAGCCCAGGGGCTGG + Exonic
1029646420 7:101859227-101859249 CTCTCCCCCAGCTCAGGTGCAGG - Intronic
1029684962 7:102140826-102140848 CTGTACTCCAGCCTGGGGGATGG + Intronic
1031368017 7:120927155-120927177 CTCTCCTCCAGCCCTCTGGGAGG + Intergenic
1032002451 7:128274263-128274285 TTCTCCTCCAGCACTGGGGATGG + Intergenic
1032196600 7:129792915-129792937 CTCTCCTCCTCCCCGGCGGGGGG - Intergenic
1032314393 7:130821512-130821534 CTGCACTCCAGCCCGGGGGACGG - Intergenic
1034036849 7:147833821-147833843 CTCTCCTACAGCACAGGGACTGG - Intronic
1034559405 7:151870618-151870640 CGATCCTCCAGCCCCGGGGCAGG + Intronic
1034943193 7:155245168-155245190 CTCTCACCCATCCCAGGGGCCGG + Intergenic
1035022268 7:155806718-155806740 CTCTTCCCCAGCCCAGGGCCCGG - Intronic
1035306934 7:157939418-157939440 CTCTCCTGCAGCCAGAGGCCTGG - Intronic
1035433593 7:158840880-158840902 CTCTGCTCCAGCCAGTGGGCTGG - Intergenic
1036692088 8:10950388-10950410 CTCTCCCCCAGCCCTGGCACAGG - Intronic
1038420867 8:27433361-27433383 CTCTTCTCCAGCCCTGGGGGTGG + Intronic
1038494076 8:27989643-27989665 CTCTCCTCCAGCCTATGGGAGGG + Intronic
1040902239 8:52428837-52428859 TGTTCCTCCAGCCCTGGGGCAGG - Intronic
1042170725 8:65988513-65988535 CTCTCCTCCAGCCAAGGGAATGG - Intergenic
1042533090 8:69834243-69834265 CACTCCTCCAGCCTGGGGCAAGG + Intronic
1042611594 8:70607586-70607608 CACTCCTCAGACCCGGGGGCCGG + Intronic
1043072420 8:75655728-75655750 CTCTACTCCAGCCTGGGTGATGG - Intergenic
1048009222 8:130443186-130443208 CTCGCCTCCAGCTCGGGAGAGGG - Intronic
1049283150 8:141760749-141760771 CTCTGCGGCAGCCCAGGGGCCGG - Intergenic
1049419227 8:142509693-142509715 TTCTCCTGAAGTCCGGGGGCAGG + Intronic
1049660779 8:143818841-143818863 CACCCCTCCAGTCTGGGGGCTGG + Intronic
1049681556 8:143920855-143920877 CTCTCCAGCAGCTCGGCGGCTGG + Exonic
1049854349 8:144852302-144852324 AGCTCTTCCAGCCCGGGGGTTGG - Intronic
1051123508 9:13777605-13777627 TTCTCCTCCAGCCCTCTGGCTGG + Intergenic
1057490092 9:95513822-95513844 CTTTCCTCCAGCCTGGGGAGGGG - Intronic
1058663027 9:107283449-107283471 CTCTCCCCCAGCCCGTGCCCCGG - Exonic
1058735338 9:107888946-107888968 CTCTCCTTCTGCCCAGGGCCTGG + Intergenic
1059061374 9:111038192-111038214 CTCTCCTGCCGCCCCCGGGCTGG + Intronic
1059342087 9:113602989-113603011 TTCCCCTCCAGTCTGGGGGCGGG - Intergenic
1060111103 9:120906903-120906925 CTGTACTCCAGCCTGGGGGACGG - Intronic
1060195826 9:121622752-121622774 CTCTCCTCCCTCCTGGGGGCAGG - Intronic
1060793319 9:126499856-126499878 CCCTCCCCCAGCCCGCGGGCCGG + Intronic
1060793325 9:126499863-126499885 CTCTCTCCCGGCCCGCGGGCTGG - Intronic
1061246951 9:129405432-129405454 CCCCCCTCCAGCCCTGGGGAGGG - Intergenic
1061743471 9:132723743-132723765 GTCTCCTCCAGCCTGGGGGCTGG + Intergenic
1061777790 9:132977542-132977564 TGCTCTTCCAGCCCGGGTGCTGG - Intronic
1062038162 9:134391881-134391903 CTCCCCTGCAGGACGGGGGCAGG + Intronic
1062094360 9:134695290-134695312 CTCTCCTGCACCCTGGGGCCTGG + Intronic
1062165618 9:135105917-135105939 AACTCCTCCTGCCCGGAGGCCGG - Intronic
1062196055 9:135274830-135274852 CTCTCCTCCTGCCTGCTGGCTGG + Intergenic
1062218919 9:135403922-135403944 CTCTCCTCCTGCCCTGAGGGAGG + Intergenic
1062296195 9:135828465-135828487 CTCTCCTACAGCCAGGGGCCAGG + Intronic
1062626963 9:137447775-137447797 CTGTCCCCCAGCCACGGGGCAGG + Exonic
1062680514 9:137776783-137776805 CCCTTCTCCTGCCCGGGGACTGG - Exonic
1185786819 X:2897968-2897990 CTCTCCTCCACCCCTCTGGCTGG + Intergenic
1186965387 X:14781395-14781417 CTCTACTCCAGCCTGGGTGATGG + Intergenic
1187281658 X:17861597-17861619 CTCTTCTCCATCCTGGGGTCTGG - Intergenic
1189744991 X:44159832-44159854 CTTTCCTCAAGTCAGGGGGCTGG - Intronic
1190055729 X:47180079-47180101 CTCGTCTCCACCCCGGGGGCCGG - Intronic
1190833824 X:54082149-54082171 CTCCACTCCAGCCTGGGGGACGG + Intronic
1192234931 X:69289724-69289746 CTCTCCCCCAGCCTGGGGGAGGG - Intergenic
1195269303 X:103215024-103215046 CCCTCCTGCAGCCCGGAGTCAGG - Intergenic
1195279003 X:103311052-103311074 CCCTCCTGCAGCCCGGAGTCAGG + Intergenic
1196966889 X:121065810-121065832 CTCTCCTCCAGCTCTGGGAAGGG - Intergenic
1197186505 X:123593134-123593156 TACTCCTCCAGCCCAGGGACAGG + Intergenic
1201395772 Y:13546118-13546140 CTGTACTCCAGCCTGGGGGATGG + Intergenic