ID: 1102239133

View in Genome Browser
Species Human (GRCh38)
Location 12:111312935-111312957
Sequence TGGTGGGGGTGGAGGGAAGC GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 1898
Summary {0: 1, 1: 0, 2: 24, 3: 237, 4: 1636}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1102239133_1102239147 15 Left 1102239133 12:111312935-111312957 CCCGCTTCCCTCCACCCCCACCA 0: 1
1: 0
2: 24
3: 237
4: 1636
Right 1102239147 12:111312973-111312995 TTGGTGTAGTGGAGCTGGACTGG 0: 1
1: 0
2: 1
3: 7
4: 122
1102239133_1102239148 28 Left 1102239133 12:111312935-111312957 CCCGCTTCCCTCCACCCCCACCA 0: 1
1: 0
2: 24
3: 237
4: 1636
Right 1102239148 12:111312986-111313008 GCTGGACTGGCCACAAATTCTGG 0: 1
1: 0
2: 0
3: 8
4: 107
1102239133_1102239144 4 Left 1102239133 12:111312935-111312957 CCCGCTTCCCTCCACCCCCACCA 0: 1
1: 0
2: 24
3: 237
4: 1636
Right 1102239144 12:111312962-111312984 GACCTGTTTGCTTGGTGTAGTGG 0: 1
1: 0
2: 0
3: 11
4: 157
1102239133_1102239146 10 Left 1102239133 12:111312935-111312957 CCCGCTTCCCTCCACCCCCACCA 0: 1
1: 0
2: 24
3: 237
4: 1636
Right 1102239146 12:111312968-111312990 TTTGCTTGGTGTAGTGGAGCTGG 0: 1
1: 0
2: 0
3: 20
4: 332
1102239133_1102239142 -4 Left 1102239133 12:111312935-111312957 CCCGCTTCCCTCCACCCCCACCA 0: 1
1: 0
2: 24
3: 237
4: 1636
Right 1102239142 12:111312954-111312976 ACCACAGTGACCTGTTTGCTTGG 0: 1
1: 0
2: 0
3: 5
4: 128

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1102239133 Original CRISPR TGGTGGGGGTGGAGGGAAGC GGG (reversed) Intronic
900003525 1:29232-29254 CGGAGGGGCTGGAGGGAGGCGGG - Intergenic
900023245 1:199748-199770 CGGAGGGGCTGGAGGGAGGCGGG - Intergenic
900100752 1:961033-961055 TCGTGGGGGCGCCGGGAAGCGGG + Intronic
900186827 1:1336707-1336729 TGGTGGGGGCAGTGGGAGGCAGG + Intronic
900232229 1:1565606-1565628 TCGTGGGGGTGTTGGGAAACTGG - Intronic
900361095 1:2289493-2289515 TCGTGGGGGTGGGGGGGTGCAGG + Intronic
900361124 1:2289574-2289596 TCGTGGGGGTGGGGGGGTGCAGG + Intronic
900550619 1:3252609-3252631 GGGTGGGGCTGGTGGGCAGCAGG + Intronic
900561834 1:3311028-3311050 TGGTGGTGGTGGCAGGATGCAGG + Intronic
900622842 1:3595294-3595316 GGGTGGAGGTGGAGGGAGGGCGG + Intronic
900632802 1:3646095-3646117 TGGCGGGGTTGGAGGGAGCCGGG - Intronic
900667942 1:3828140-3828162 TGGTGAGGGAGGCGGGAGGCAGG + Intronic
900702904 1:4059008-4059030 TGGTGGGGCTGAGGGGAGGCTGG + Intergenic
900760026 1:4464120-4464142 CAGTGGGGTTGGAGGGAAGGAGG - Intergenic
901006940 1:6176494-6176516 AGGTAGGGGTGGCAGGAAGCAGG - Intronic
901056543 1:6451081-6451103 TGGTGGGGAGGGAGGGGACCAGG + Intronic
901059293 1:6464721-6464743 TGGTGGGGGTGCAGGGAGATGGG + Intronic
901253163 1:7797162-7797184 TCGTGGATGTGGAGGGAAGCTGG + Intronic
901433320 1:9231652-9231674 AGGTGGGGAGGGAGGGAAACAGG - Intergenic
901453811 1:9352076-9352098 GTGAGGGGGTGGAGGGAAGGTGG + Intronic
901466445 1:9424554-9424576 GGGTGGGGGTGGGGTGAAGGTGG + Intergenic
901656126 1:10770705-10770727 GGGTGGGGCTGGGAGGAAGCTGG - Intronic
901804822 1:11731877-11731899 TGGTGGGGTTGGGGGGATGCGGG - Intergenic
901843259 1:11966520-11966542 GGATGGGGGTGGGGGGAGGCAGG + Intronic
901849516 1:12006718-12006740 AGGTGGGGGCGGAGGGCAGGTGG + Intronic
901897557 1:12327462-12327484 TGGTGGGGGTGGGGGGTGGGAGG - Intronic
901933078 1:12609412-12609434 TGGAGGGGGTGGGAGGCAGCTGG - Intronic
902378113 1:16039744-16039766 TGGTGGTGCTGGAGGGATGTCGG - Intergenic
902383202 1:16062240-16062262 TGGTGGTGCTGGAGGGATGTCGG - Intronic
902403584 1:16171452-16171474 TGGGTGGGGTGGAGTGAAGGGGG + Intergenic
902410534 1:16209017-16209039 AGGTGGGGCTGGAGGGTAGCAGG + Exonic
902431526 1:16367227-16367249 GGGTGGGGGAGGAGGGAAAGCGG + Exonic
902477818 1:16697425-16697447 TGGTGGCGAGGGAGGGGAGCAGG - Intergenic
902531557 1:17093944-17093966 TGGTGTGGGTGGAGGCAGGGAGG + Intronic
902560542 1:17274592-17274614 AGGCGGGGGTGGAGGGTACCAGG - Intronic
902676622 1:18013185-18013207 GAGTGGGGGAGGAGGAAAGCTGG - Intergenic
902761789 1:18585894-18585916 GAGTGGGGGTGGGGGGAAGCTGG + Intergenic
902791416 1:18770823-18770845 TGGTGGAGTTGAGGGGAAGCAGG + Intergenic
902792975 1:18781625-18781647 TGGTGGGGGTGGTGACAAGGAGG + Intergenic
902822186 1:18950208-18950230 TGTTGGGGGTGGAGGGAGAACGG - Intronic
902995736 1:20223408-20223430 TGGTGGGGATGGGGAGAGGCAGG - Intergenic
903154657 1:21435733-21435755 GGGAGGGGGTGAGGGGAAGCTGG - Intergenic
903304650 1:22404233-22404255 TGAAGGGGATGGAGGGAGGCAGG + Intergenic
903515740 1:23909658-23909680 TGGGGTGGGAGGAGAGAAGCCGG + Intronic
903529965 1:24022640-24022662 GGGAGTGGGTGGAGGCAAGCAGG - Intergenic
903536636 1:24071303-24071325 AGGTGGGGCTGGAAGGGAGCGGG - Intronic
903609239 1:24597966-24597988 TGGTGGGGGTGGGGGGAACTTGG + Intronic
903740832 1:25557435-25557457 TGGTGGGGCTGCAGGCAGGCAGG + Intronic
903950640 1:26994115-26994137 TGCTGGAGGTGGAGGGCCGCCGG + Exonic
903976610 1:27154484-27154506 TTCTGGGGGTGGAGGGAGGCTGG + Exonic
904232029 1:29082585-29082607 GGGTAGGGGTGGAGGGATGAAGG - Intronic
904333708 1:29784029-29784051 TGGTGAGGGAGGAGGGAGGATGG - Intergenic
904343830 1:29855363-29855385 TGGTGGGGGTGGACTGAAAGGGG + Intergenic
904410283 1:30320850-30320872 TGGAGTGGGTGGGGGGAGGCAGG + Intergenic
904676352 1:32201334-32201356 GGGTGGAAGTGGAGGGATGCCGG + Intronic
904719893 1:32500153-32500175 TGGTGGAGGCTGAGGGAAGGAGG + Intronic
904831229 1:33307729-33307751 GGGTGGGGGTGGGGGGGAGGTGG - Intronic
904886659 1:33743358-33743380 TTGTGATGGAGGAGGGAAGCTGG + Exonic
904896301 1:33820831-33820853 TGGTGTGGGACGAGGGAAGCAGG - Intronic
905347713 1:37322489-37322511 TGCTCTGGGTGGAAGGAAGCAGG + Intergenic
905409584 1:37759263-37759285 TGATGGGGTTGGAGAGGAGCAGG - Intronic
905468065 1:38170820-38170842 TGGAGGGGGTGGGGAGAAGTGGG - Intergenic
905516326 1:38564642-38564664 TGGCAGAGGTGGAGGGAAGAAGG + Intergenic
905739330 1:40355965-40355987 TAGTGGGGGTGGGGGAAAGTGGG - Intronic
905751422 1:40467968-40467990 TGCTGGGGTTGGACGGAAGATGG - Intergenic
905878228 1:41447118-41447140 TGTGGGGGGTAGAGGGATGCAGG + Intergenic
905961918 1:42050143-42050165 GGATGGGAGTAGAGGGAAGCTGG + Intergenic
906080506 1:43085202-43085224 TGGTGGGGGTGGGGAGAGGGGGG - Intergenic
906130609 1:43453359-43453381 GGGTGGGGGTGGGGTGGAGCGGG + Intronic
906143648 1:43547712-43547734 TGAGGGGAGTGGAGGGAAGCGGG + Intronic
906208016 1:43997311-43997333 GGGTGGGAGTGGAGGGTTGCTGG - Intronic
906468703 1:46108743-46108765 TGGTGGGTGTGGAGGCAAGAAGG - Intronic
906521922 1:46472337-46472359 TGGGGGCGGTGGAGGGGAGGGGG - Intergenic
906606314 1:47174820-47174842 TGGTAGGGGTTCAGGGAAGGGGG + Intergenic
906653644 1:47532705-47532727 TGGTGGGGGTGTGGGGAGGGTGG + Intergenic
906791275 1:48660469-48660491 TGATGGGGGCTGAGGGAAGATGG + Intronic
907038200 1:51235423-51235445 GGTTGGGAGTGGAGGGAAGTGGG + Intergenic
907273369 1:53303742-53303764 TGGTGGGGGTTGGGGGAAAGGGG - Intronic
907273758 1:53305734-53305756 GGGTGGAGGTGCAGGGAAGCTGG - Intronic
907401391 1:54226998-54227020 GGGAGGGGGTTGAGGGGAGCAGG + Exonic
907455922 1:54575406-54575428 CCTTGGGGGTGGAGGGAGGCAGG + Intronic
907506538 1:54923163-54923185 GGGTGGGGAGGGAGGGAGGCAGG - Intergenic
907642339 1:56203658-56203680 TGGTAGGGGCTGATGGAAGCAGG - Intergenic
908250104 1:62258978-62259000 TGGCTGGAGTGGAGGGAAGGAGG + Intronic
909624438 1:77700037-77700059 TGGTGGGGGTTGAGGGATGAGGG + Intronic
909780514 1:79540958-79540980 TGTTGGGGGTGGGGGGAGGGGGG - Intergenic
909942533 1:81626919-81626941 GGGTGTGGGTGGAGGGTAGGTGG + Intronic
909962965 1:81871080-81871102 TGTTGGGGGTGGGGGGAGGGGGG - Intronic
910450049 1:87335223-87335245 AGGTGGGGGTGGAGGAAAGACGG - Intronic
910762239 1:90745187-90745209 GGTTGGTGGTGGAGGGTAGCGGG - Intergenic
910981379 1:92962048-92962070 TGGTGGCGGTCGGGGGAAGGGGG + Intergenic
911175903 1:94818315-94818337 TGCTGGGGGTGAAGGGAATCTGG - Intergenic
911625527 1:100119721-100119743 TGGTGAGGGTGGGAGGAAGGAGG - Intronic
911997751 1:104788349-104788371 TGATGCTGGTGGAGGGAAGGAGG + Intergenic
912139946 1:106712267-106712289 TGGGGGAGGTGGAGGGAATGAGG + Intergenic
912227824 1:107755384-107755406 ATGTGGGGGTGAGGGGAAGCTGG + Intronic
912260762 1:108109921-108109943 TGGTGGGGGAGGAGGGGAGTTGG - Intergenic
912383061 1:109257954-109257976 TGGCGGGGGTGGGGGGGAGTGGG - Intronic
912466291 1:109877230-109877252 TGGTGGAGCTGGAAGGAAGCTGG - Intergenic
912560731 1:110549560-110549582 TGGTGGGGCTGGGAGGAAGGAGG + Intergenic
912681958 1:111734484-111734506 AGGTGGAGGTGGAGGGAGGGAGG - Intronic
912723443 1:112039191-112039213 TGGTGGTTCAGGAGGGAAGCAGG - Intergenic
912778348 1:112521422-112521444 TGGTGGGAGAGCAGGTAAGCAGG + Exonic
912951656 1:114124477-114124499 TGATGGGAGTGGTGGGGAGCTGG + Intronic
913059540 1:115192495-115192517 TGGTCAGGGTAGAGGGATGCCGG - Intergenic
913191854 1:116419762-116419784 TGGTGGGGGGGGGGGGGAGTGGG - Intergenic
913528681 1:119716870-119716892 TGGTGAGCATGGAGGGAAACAGG - Intronic
914024888 1:143903918-143903940 TGGGAGGGATGGAGGGAAGGAGG - Intergenic
914459645 1:147871497-147871519 AGGTGGGGGTGGATGGAATTAGG + Intergenic
914663317 1:149811638-149811660 TGGGAGGGATGGAGGGAAGGAGG - Intronic
914829563 1:151160765-151160787 TGGCTGGAGTGGAGGGAGGCAGG + Exonic
914986715 1:152464319-152464341 TGGTGGGGGGGGAGGGGAGAGGG - Intergenic
915026865 1:152839047-152839069 TGGTGGGGGGGGAGGGGGGAGGG - Intergenic
915042636 1:152981698-152981720 AGGTGGGTGGGGAGGGCAGCAGG + Intergenic
915083364 1:153367194-153367216 GGGAGGGGGTAGAGGGGAGCCGG + Intergenic
915213199 1:154324984-154325006 TGGTGGGGGCGGAGGGAAGGAGG + Exonic
915243609 1:154541300-154541322 TGGTGGGGGTTGGGAGAAGAGGG + Intronic
915446555 1:155977850-155977872 TGGTGGTGGTGGGAGGAAGCCGG + Intronic
915873198 1:159584226-159584248 TGGAGGAGGTGGAGGGTAGGTGG - Intergenic
916412422 1:164559325-164559347 GAGTGGGGGTGGGGGGCAGCGGG + Intronic
916415498 1:164588820-164588842 TGGTGGGGGCGGAGGGATAAAGG - Intronic
916602243 1:166304385-166304407 TTGTGGGTGGGGCGGGAAGCGGG + Intergenic
917002606 1:170375951-170375973 TGGGGGGGGTGGGGGGATGGGGG + Intergenic
917049320 1:170901034-170901056 GGGTGGGGGTGCAGGGGAGTGGG + Intergenic
917172260 1:172190155-172190177 CGGTGGGGGTGCAGGGAAAAGGG - Intronic
917620709 1:176793066-176793088 TGGTGGTGGTGGTGGGTGGCGGG - Intronic
917659644 1:177164712-177164734 TGGTGGGGGAGGAAGCGAGCGGG + Intronic
917720287 1:177780405-177780427 TGGTGGGAGTGGGGGATAGCGGG + Intergenic
917730019 1:177865905-177865927 TGCTGGGGGTGGGGTGGAGCGGG - Intergenic
917740151 1:177953841-177953863 GGGTGGGGGTGTGGGGTAGCAGG - Intronic
918003971 1:180524645-180524667 TGTTTGAGGTGGAGGAAAGCTGG + Intergenic
918142976 1:181733765-181733787 AGTTGGGGGTGGAGGGGAACAGG - Intronic
919082077 1:192878840-192878862 TGCTGGGAGTTGATGGAAGCTGG - Intergenic
919138597 1:193541980-193542002 TGGTGGTGGTGGAGAGAGGGTGG + Intergenic
919207670 1:194437786-194437808 GGGTGGAGGTGGGGGGAAGGGGG - Intergenic
919451256 1:197775331-197775353 TGGTGGGTGGGGTGGGAGGCGGG - Intronic
919535432 1:198781254-198781276 TGGTGAGGGTGGGGAGAAGGAGG + Intergenic
919802541 1:201362261-201362283 TGGCTGGGGAGGGGGGAAGCTGG - Intronic
920120276 1:203650833-203650855 TGGTGGTGGTAGAGGGAGGAAGG - Intronic
920433008 1:205930684-205930706 TGGTGTGGCTGGAGGGTAGAGGG - Intronic
920526687 1:206672210-206672232 AGATAGGAGTGGAGGGAAGCGGG - Intronic
920528229 1:206684509-206684531 TCGTGGGGGTGGGGGGGAGCTGG - Intergenic
920703295 1:208233856-208233878 TGCTGTGGATGGAGGAAAGCTGG + Intronic
920733539 1:208510991-208511013 GGGTTGGGGTGGAGGGTGGCGGG + Intergenic
920958987 1:210647555-210647577 GGCTGGGGGCGGTGGGAAGCAGG - Intronic
921101468 1:211932677-211932699 TGGTGGGGGTGGAGTGGGGGTGG - Intergenic
921315190 1:213883770-213883792 TGGTGGGGGTTGGGGAAAGGAGG + Intergenic
921628171 1:217401798-217401820 TTGGGGGGGTAGAGGGAAGGGGG - Intergenic
922074540 1:222230434-222230456 TGGAAGGGGTGGGGGGAAGAAGG - Intergenic
922202586 1:223418709-223418731 TGATGGGGGTTGGGGGAAGCAGG - Intergenic
922215375 1:223516035-223516057 AGGTGGCGGGGGAGGGAAGCTGG - Intergenic
922317412 1:224454923-224454945 TGGAGGGGGTGGTGGCAAGCAGG + Intronic
922318035 1:224459610-224459632 GGGTGGGGGTGGAGTGAAGCTGG + Intronic
922657959 1:227402256-227402278 TGGTGGAGGTGGAGGGTGCCAGG - Intergenic
923039017 1:230306394-230306416 TGGTGGGGGTGGAGGAGGGAAGG + Intergenic
923162203 1:231324177-231324199 CTGTGGTGGTGGGGGGAAGCGGG + Intergenic
923284499 1:232479638-232479660 TGTTGGGCATGTAGGGAAGCAGG + Exonic
923447887 1:234089452-234089474 TGGTGGGTGTTGAGTGCAGCTGG + Intronic
923556626 1:235005959-235005981 TGGTGGAGGTGGGAGGAAGGTGG - Intergenic
923608171 1:235464417-235464439 AGGGAGGGGTGGAGGGAAGAAGG - Intronic
924048322 1:240054908-240054930 GGGAGGGGGTGCAGGGAAGGAGG + Intronic
924063197 1:240197410-240197432 CGGAGGGGGTGGAGGGATCCTGG + Intronic
924243067 1:242058182-242058204 TGTGGGGGGTGGGGGGAAGGGGG - Intergenic
924664620 1:246058325-246058347 AGGTGGGGGAGGAGGGCAGGAGG + Intronic
924802284 1:247336256-247336278 TGGAGTGGGGGGAGGGAAGGGGG - Intergenic
1062860792 10:807650-807672 TGGTGGAGCTGGAGGGCCGCAGG - Exonic
1063123298 10:3119849-3119871 TTGTGGGGCGAGAGGGAAGCTGG - Intronic
1063362475 10:5469563-5469585 TGGCGGGGGTTGAGGGGAGCTGG - Intergenic
1063503820 10:6579280-6579302 TGGAGAAGGTGGAGGGAAGAGGG - Intronic
1063859908 10:10295787-10295809 TCGGGGTGGTGGAGGGGAGCGGG - Intergenic
1064137571 10:12764028-12764050 TCCTGGGGGAGGAGGGAAGACGG - Intronic
1064138948 10:12774060-12774082 TGGTGCGGGGGGAGGGGGGCGGG + Intronic
1064283420 10:13971046-13971068 TGTTGGGGGTGGTGACAAGCTGG - Intronic
1064336184 10:14444558-14444580 TGGTGAGGGTGAAGAGAAACTGG + Intronic
1064449183 10:15426189-15426211 TGGTGGGGGCGGGGGGAAGAGGG + Intergenic
1064479676 10:15726695-15726717 TGATGGGGCTGGAGGTAAGACGG + Intergenic
1064503889 10:16008687-16008709 TGGAGTGGGTGGGGGGAGGCTGG + Intergenic
1064627150 10:17273168-17273190 TGGTGAGGGTGGTGGGGAGGTGG - Intergenic
1064653912 10:17537543-17537565 TCCTGGGGGTGAAGGGAAACAGG + Intergenic
1064978442 10:21142864-21142886 TGTTGGGGGTGGGGGGCAGGAGG - Intronic
1065684532 10:28270535-28270557 GGGGGGGGGAGGAGGGGAGCTGG + Intronic
1065801777 10:29358943-29358965 TGGTGGCGGTGGACGCGAGCAGG + Intergenic
1065997622 10:31074102-31074124 TTGTGGATGTGGAGGGAAGACGG - Intergenic
1066239943 10:33523718-33523740 TGGTGGGAGTGGATAGAATCAGG + Intergenic
1066293241 10:34033012-34033034 TGGGGTTGGTGGAGGGAGGCAGG + Intergenic
1066293266 10:34033112-34033134 TGGTGGGGGTGGGGGGTTGCAGG + Intergenic
1066565140 10:36714209-36714231 TGGTGAGGGTGCAGAGAAGAAGG + Intergenic
1067263307 10:44713757-44713779 TGCTGGGGCAGGAAGGAAGCAGG + Intergenic
1067297086 10:44980745-44980767 GGGTGGGGCTGGAGGGCAGTGGG + Intronic
1067477464 10:46576388-46576410 AGGTGGGGGTGCATGGCAGCTGG + Intergenic
1067479302 10:46584915-46584937 AGGTGGAGGTGGAGGCAGGCAGG - Intronic
1067615437 10:47756886-47756908 AGGTGGAGGTGGAGGCAGGCAGG + Intergenic
1067617276 10:47765396-47765418 AGGTGGGGGTGCATGGCAGCTGG - Intergenic
1067665092 10:48270861-48270883 TGGTGGGGTTGGAGAGAAACAGG - Intronic
1067758844 10:49027600-49027622 GGGTCGGGCTGGAGGGAAGGTGG - Intronic
1067761379 10:49049812-49049834 TGGTAGGGGTGCAGGGAATCTGG + Intronic
1067781655 10:49211968-49211990 TGGAGGGAGTGGAGGAAAGGAGG + Intergenic
1068152882 10:53156691-53156713 TGGTGAGGCTGTAGGGAAGTAGG + Intergenic
1068540839 10:58293511-58293533 TGGTGGGGGTGGGGGAAAGGGGG + Intergenic
1068574987 10:58675138-58675160 TGGTGGGGGTTGAGGACAGTTGG + Intronic
1068709773 10:60121339-60121361 TGCAGGGGGTGGAGGGTAGTGGG + Intronic
1068936226 10:62638084-62638106 TGGGGGAAGTGAAGGGAAGCGGG + Intronic
1068955113 10:62814713-62814735 GGCTGGGGGTGGAGGGGAGTTGG - Intronic
1069184074 10:65400468-65400490 TGGTGGGGGAAGGGGGAAGGAGG - Intergenic
1069256410 10:66336361-66336383 TGCTGGGGGTGGAGCTAAGATGG - Intronic
1069664277 10:70144670-70144692 TGGGGGGAGTGGAAGGAATCTGG + Intronic
1069938317 10:71935056-71935078 TGGTGGGGAAGGATGGAAGTGGG - Intergenic
1070310187 10:75267316-75267338 TGGGGGTGGTGGGGGAAAGCAGG + Intergenic
1070311076 10:75274384-75274406 TGCTGGGGCTGGGGGGAAGGAGG - Intergenic
1070354373 10:75625493-75625515 GGGTGGGGTTGGAGGGAGTCAGG + Intronic
1070500762 10:77070672-77070694 TGTTGGGGGTGGGGGGTAGGTGG - Intronic
1070541869 10:77421304-77421326 TGGTGGTGGTGGAGTGGAGGTGG - Intronic
1070722964 10:78769447-78769469 TGGTGGGGCTGAAGGAAAGAAGG - Intergenic
1070794348 10:79208084-79208106 TGGTGGGGGTGGAGTGGAGGTGG + Intronic
1070957044 10:80471056-80471078 AGGTGGTGGTGGTGGCAAGCTGG - Intronic
1071122563 10:82296449-82296471 TGGTGGTGGTGGAGGAAAGCAGG + Intronic
1071252716 10:83837345-83837367 TATTTGGGGTGGAGGGGAGCAGG + Intergenic
1071275351 10:84049103-84049125 CAGTGGGGGTGGAGGGTAGAAGG + Intergenic
1071603498 10:86970266-86970288 TGGTGGGGCTGGAGGGAGGCGGG + Intronic
1071665432 10:87551191-87551213 TGTTGGGGGCAGAGGGAATCAGG + Intronic
1071697287 10:87890011-87890033 TGGTGGGAGGTGGGGGAAGCGGG - Intronic
1072343059 10:94474486-94474508 TTTTGGAGGTGGAGGGGAGCTGG - Intronic
1072528409 10:96295487-96295509 TGATGGGGGTAGGGGGAAGTAGG - Intergenic
1072636989 10:97184880-97184902 GGCTGGGTGTGGAGGGAGGCGGG + Intronic
1072811619 10:98466974-98466996 AGGTGGGGGTGGAAGGGAGCTGG - Intronic
1072895706 10:99364866-99364888 TGCTGGGGGTGGATAGAAGAGGG + Intronic
1072899278 10:99393193-99393215 TGGAGGAAGGGGAGGGAAGCTGG - Exonic
1072975523 10:100054205-100054227 TGGGGGGGATGGAGGAAAGAAGG - Intronic
1072976220 10:100061091-100061113 TGGTGGGGGTGGGGAGAATGGGG + Intronic
1073048009 10:100651686-100651708 TGGTGGGGGTGGTGGGAGTGGGG - Intergenic
1073048026 10:100651731-100651753 TGGTGGGGGTGGTGGGAGTGGGG - Intergenic
1073048043 10:100651776-100651798 TGGTGGGGGTGGTGGGAGTGGGG - Intergenic
1073048060 10:100651821-100651843 TGGTGGGGGTGGTGGGAGTGGGG - Intergenic
1073048077 10:100651866-100651888 TGGTGGGGGTGGTGGGAGTGGGG - Intergenic
1073048094 10:100651911-100651933 TGGTGGGGGTGGTGGGAGTGGGG - Intergenic
1073048111 10:100651956-100651978 TGGTGGGGGTGGTGGGAGTGGGG - Intergenic
1073049278 10:100656976-100656998 TGTTGGGGGTGGAAAGAAGATGG + Intergenic
1073119138 10:101111009-101111031 GGGTGGGGGTGGAGAAAAGTAGG + Intronic
1073214727 10:101829864-101829886 CTGTGGGGGCGGAGGGAGGCTGG + Exonic
1073359856 10:102889664-102889686 CGGGGGGGGTGGAGGGAGGAAGG - Intronic
1073432389 10:103494609-103494631 GGCTGGGGGTGGAGGGCAGCCGG + Intronic
1073645319 10:105295717-105295739 TGTTGGGGGTGGAGGGAAGGGGG - Intergenic
1073904909 10:108267354-108267376 TGGTGGGGGTGGGGTGAGGTGGG - Intergenic
1073943895 10:108729720-108729742 AGGTGGAGGTGGAGGGAGGGAGG + Intergenic
1073943903 10:108729740-108729762 AGGTGGAGGTGGAGGGAGGGAGG + Intergenic
1074111916 10:110428837-110428859 GGATGGGGTTGGAGGGAGGCAGG + Intergenic
1074286626 10:112103922-112103944 TGGTGGGGGAGGAGCCAAGATGG + Intergenic
1074370555 10:112897759-112897781 GGGTGGGAGTGGATGGATGCTGG + Intergenic
1074572091 10:114633300-114633322 TGGTGGGTCTGGGGAGAAGCGGG + Intronic
1074610507 10:115016829-115016851 TGGAGGGGGTGGTGGGAAGCTGG + Intergenic
1074831795 10:117254671-117254693 AGCTGGGGGTGGAGGGGATCAGG + Intronic
1075292783 10:121244562-121244584 TGGTGGTGGTGGTGGGAAATGGG - Intergenic
1075662459 10:124207519-124207541 TCCTGGGGGAGGAGGGGAGCCGG + Intergenic
1075804333 10:125174628-125174650 TGGTGGGGATGGTGGGAGGAGGG - Intergenic
1076062247 10:127422115-127422137 TGTTGGGGGTGCAGAGAAGTTGG - Intronic
1076314628 10:129531776-129531798 TGGTGGGGGTGGGGGGGGGTGGG + Intronic
1076369349 10:129941610-129941632 TGGCGGCGGTGGAGGTGAGCAGG + Intronic
1076637535 10:131892041-131892063 GGCTGGGCTTGGAGGGAAGCTGG + Intergenic
1076726496 10:132416497-132416519 AGGTGGGGGGCGATGGAAGCAGG + Intronic
1077010985 11:379233-379255 TGGAGGGGGTGGCTGGAAGGTGG + Intronic
1077207836 11:1352802-1352824 TGGTGGGGGTGGGGGGTGGGGGG - Intergenic
1077211027 11:1371004-1371026 TGGTGGGGCTGGAGGGAGCGGGG + Intergenic
1077214959 11:1391346-1391368 GGGCAGGGGTGGAGGGAAGGAGG + Intronic
1077251924 11:1564555-1564577 GGGTGGGGGAGGAGGGCAGGAGG - Intronic
1077253305 11:1570206-1570228 TGGTGGGAAGGGAGGGAACCTGG - Intronic
1077256600 11:1586907-1586929 TGGTGGGGGTGCCAGGAAACAGG - Intergenic
1077283168 11:1754521-1754543 TGGAGGGGATGGAGGGATGGAGG + Intronic
1077283178 11:1754546-1754568 TGGAGGGGATGGAGGGATGGAGG + Intronic
1077350909 11:2092807-2092829 TGGTTGGGGTGTAGGAAAGAGGG - Intergenic
1077546098 11:3170700-3170722 TGGTGGTGCTGGAGGCAAGGAGG + Intergenic
1077556792 11:3229911-3229933 GGGAGGGGATGGAGGGAGGCTGG - Intronic
1077591918 11:3499033-3499055 TAGTGGGGGTGGAGCCAAGATGG - Intergenic
1077598747 11:3557607-3557629 TGGTGGTCGTGGTGGGAAACTGG - Intergenic
1077861223 11:6181798-6181820 TTGTGGGGTTGGGGGGAAGGGGG + Intergenic
1077981711 11:7307876-7307898 TGGAGGGAGTGGGAGGAAGCAGG + Intronic
1078091984 11:8269555-8269577 GGGTGGTGGTGGTGGGAACCTGG - Intergenic
1078097616 11:8310353-8310375 TGGTGTGGGTCCAGGAAAGCTGG - Intergenic
1078360770 11:10665953-10665975 TGGCAGGGGTGGGTGGAAGCCGG + Intronic
1078595086 11:12679131-12679153 TGGTGGTGGTGGTGGGGAGTAGG + Intronic
1079039054 11:17045185-17045207 TGGTGAGACTGGAGGGAAGTAGG + Intergenic
1079070310 11:17339496-17339518 TTGTGGGGGTGGGGGGAGGGGGG - Intronic
1079136546 11:17778875-17778897 GGGTGGGGGTGGTGTGAACCAGG + Intronic
1079190354 11:18272018-18272040 AGGTGGCGGAGGTGGGAAGCGGG - Intergenic
1079565763 11:21880040-21880062 TTGTGGGGTTGGGGGGAAGCGGG + Intergenic
1079885308 11:25981071-25981093 GGGTGGAGGTGGGGGGAAGCAGG + Intergenic
1080383401 11:31796591-31796613 CGGTGGGGGTGGAAGCAAGGGGG + Intronic
1080448625 11:32360120-32360142 TGGTGGAGGTGATGGGATGCAGG - Intergenic
1080460822 11:32453370-32453392 TGCTGTGGGTCGATGGAAGCAGG - Intergenic
1081103027 11:39028764-39028786 TGGTGGTGGTGGCGGGGTGCTGG + Intergenic
1081123500 11:39294487-39294509 TTGTGGGGTTGGAGGGGAACGGG - Intergenic
1081282868 11:41231615-41231637 TGGGGTGGGGGGAGGGAAGAGGG + Intronic
1081512019 11:43784453-43784475 AGGTGGGGGTGGGGGGCAGCAGG + Intronic
1081689983 11:45071303-45071325 TGATGGGGGAGAATGGAAGCGGG - Intergenic
1082030884 11:47602592-47602614 TGCTGGAGGAGGAGGGAAGGGGG + Intergenic
1082195698 11:49302232-49302254 TGGTGAGGGATGAGGGAAGGAGG - Intergenic
1082315991 11:50723233-50723255 TGGTGGGGGTGGAGGGGGGAGGG - Intergenic
1082557595 11:54581457-54581479 GGGTGGGGGTGGGGGGAGGGGGG - Intergenic
1082783532 11:57304111-57304133 GGGTGGGGGTGTGGGGATGCGGG - Intronic
1082820901 11:57543964-57543986 TGGTGGACGCTGAGGGAAGCAGG - Intronic
1083041053 11:59687901-59687923 ACGTGGGGTTGGAGGGAAGGTGG + Intergenic
1083148520 11:60775765-60775787 AGGTGGGGGTGGGGAGAGGCTGG - Exonic
1083175989 11:60950939-60950961 CGGCGGGTGTGGAGGGAAGGAGG - Intronic
1083195250 11:61082170-61082192 TGTGGGGGGCGGAAGGAAGCTGG - Intergenic
1083196265 11:61090358-61090380 TGGTGGGGGGTGCGGGGAGCAGG + Intergenic
1083269643 11:61565346-61565368 TTGAGGGGAGGGAGGGAAGCAGG - Intronic
1083285533 11:61656448-61656470 TGGTGAGGGTGCAGGGGTGCGGG + Intergenic
1083285556 11:61656522-61656544 TGGTGAGGGTGCAGGGGCGCGGG + Intergenic
1083311021 11:61783791-61783813 TGGTGGGGGTGGGGGGTGGCAGG + Intronic
1083338855 11:61945731-61945753 GGGTGGGGGTGGGTGGAAGGTGG + Intergenic
1083474316 11:62906162-62906184 CGGTGGGAGTGGAAGGAAGGTGG + Intergenic
1083487423 11:62992340-62992362 TGCTGTGGCTGGAGGGAACCGGG + Intronic
1083676769 11:64330361-64330383 TGGAGGAGGTGGCGGGGAGCAGG + Intergenic
1083691109 11:64409525-64409547 TGGTGGGGGCGGGGGGACGGAGG - Intergenic
1083936748 11:65873361-65873383 TCCTGGGGGTGGAGGGCAGGAGG - Intronic
1084247757 11:67871769-67871791 TAGTGGGGGTGGAGCCAAGATGG - Intergenic
1084254819 11:67933479-67933501 TGGTGGTGGTGGTGGGAAACTGG - Intergenic
1084289850 11:68155615-68155637 TGGAGGTGCTGGAGGGCAGCGGG - Exonic
1084374773 11:68768901-68768923 TGGTGAGGGTGGACTGAGGCAGG - Intronic
1084460592 11:69294641-69294663 TGGAGGGGCAGGAGGGCAGCAGG + Intronic
1084570820 11:69958808-69958830 TGGTGGGGGTGGGGGGTTTCTGG + Intergenic
1084673362 11:70620515-70620537 TGGTGGGGGTGGGGGAGACCAGG - Intronic
1084682297 11:70673510-70673532 TGGTGGGGGTGGGGAGTAGATGG + Intronic
1084818055 11:71662408-71662430 TGGTGGTGGTGGTGGGAAACTGG + Intergenic
1084957166 11:72697597-72697619 TGGTGCTGGTGGAGCGAAGGAGG - Exonic
1085013600 11:73158069-73158091 TGGGGGGGGTGGTGGGAAGATGG + Intergenic
1085024404 11:73228183-73228205 GGGTGGGGGTGGGGGGGAGCGGG + Intronic
1085026431 11:73239276-73239298 GGGTGTGGGAGGAGGGAAGCAGG + Intergenic
1085027554 11:73245428-73245450 GGGTGGGGGTGGAGGAGAGGAGG + Intergenic
1085038993 11:73315924-73315946 TGGGAGGGTGGGAGGGAAGCAGG - Intronic
1085134683 11:74075367-74075389 GGGGGGGGGTGGGGGGAAGTAGG + Intronic
1085238188 11:75031380-75031402 TGGAGGGGGTAGATGGAGGCTGG - Intergenic
1085261258 11:75205925-75205947 TGCTGGGGGTGGGGGGAAGCTGG + Exonic
1085348628 11:75784059-75784081 TGTTGGGGGTGGGGGCAAGAGGG + Intronic
1085498916 11:76999604-76999626 AGGTGGGGCAGGAGGGAAGTAGG - Intronic
1085738870 11:79062857-79062879 TGGTCGGGGTGGGGAGAAGCAGG + Intronic
1085932213 11:81097315-81097337 TGTTGGGTGTAGCGGGAAGCAGG + Intergenic
1086908578 11:92445740-92445762 TTGGGGGGGTGCAGGGGAGCAGG + Intronic
1087857470 11:103109549-103109571 TGGAAGGGGTGGAGGGAAGTTGG - Intronic
1087983703 11:104650638-104650660 AGCTGGGGTTTGAGGGAAGCTGG - Intergenic
1088469546 11:110178030-110178052 TGGTGGGTGGGGAGGGCAGATGG - Intronic
1088530515 11:110803489-110803511 TGGTGGGGGGGGAGGGGGGAGGG - Intergenic
1088811564 11:113396009-113396031 AGGTAGGGCTGGAGGGGAGCTGG - Intronic
1088880638 11:113970927-113970949 TGGAGGGGGTGGAAGCCAGCAGG - Intergenic
1088906681 11:114160273-114160295 TGGTTGGGGTGGGGTGAAGGAGG + Intronic
1088907832 11:114168255-114168277 TCCTGGGGCTGGAGGGAAGCAGG - Intronic
1089127855 11:116190029-116190051 AGCTGGGGGTGGAGGGGAGAGGG + Intergenic
1089170244 11:116506609-116506631 GGGTGGGGGTGGATGGCATCTGG + Intergenic
1089194285 11:116684053-116684075 GGGTGGGGGTGGAGGGGAGCGGG - Intergenic
1089240495 11:117074331-117074353 TTGTGGGGCTGTAGGGAAGTGGG - Intronic
1089268124 11:117281673-117281695 TGATGGGGGTGGAGGTAAAGTGG - Exonic
1089371219 11:117959750-117959772 GGGTGGGGGTGGAGGTCAGTGGG + Intergenic
1089442161 11:118526861-118526883 TGGAGAGGGTGGAGAAAAGCGGG + Intergenic
1089531201 11:119130973-119130995 TAATTGGGGTGGAAGGAAGCTGG + Intronic
1089692291 11:120194352-120194374 TGGCGGTGGAGGAGGGGAGCAGG - Intergenic
1090068727 11:123525758-123525780 AGGTGAGGGTGGGGGGCAGCCGG + Exonic
1090171963 11:124613192-124613214 TGGTGGGGATAGAGGCAAGAGGG - Intronic
1090255993 11:125284813-125284835 AGCTGGGGGTGGAGGACAGCAGG - Intronic
1090366620 11:126211829-126211851 CGGTGAGTGTGTAGGGAAGCCGG + Exonic
1090570758 11:128042483-128042505 TGGTGGGGGTGTGGGGTTGCTGG - Intergenic
1090608710 11:128451370-128451392 TGGGTGGGGTGGATGGAAGGAGG + Intergenic
1090806993 11:130209006-130209028 GGGTGGGTATGAAGGGAAGCAGG + Intronic
1091376944 12:31286-31308 CGGAGGGGCTGGAGGGAGGCGGG - Intergenic
1091402366 12:188862-188884 GGGTGGGGATGGAGGGAACGGGG - Intergenic
1091675601 12:2486809-2486831 AGGTGGGGGAGGAGGGCAGGTGG + Intronic
1091722089 12:2820898-2820920 GTGTGGGGGTGCATGGAAGCAGG + Intronic
1091844746 12:3647185-3647207 AGGTGGGGGTGGGGGACAGCGGG - Intronic
1091889968 12:4045496-4045518 TGGTGGGGGTGGGGGCAAGGCGG - Intergenic
1092125842 12:6074552-6074574 TGGTGGGGGTGTGAGGAAGGAGG - Intronic
1092163241 12:6327659-6327681 GGGTTGGGGAGGAGGGAAGCTGG - Exonic
1092230511 12:6773253-6773275 TTGTGGGGCTGCAGGGGAGCTGG - Exonic
1092317653 12:7436099-7436121 TGGTGGGGTTGGAAGGTAGGTGG + Intronic
1092361372 12:7839397-7839419 TGGCAGGAGTGGAGTGAAGCGGG + Intronic
1092375815 12:7954661-7954683 TGGCAGGAGTGGAGTGAAGCGGG + Intergenic
1092396203 12:8128967-8128989 TCTTGGGGGTGGGGGGATGCAGG - Intronic
1092424882 12:8366948-8366970 TGGTGGTGGTGGTGGGAAGCTGG - Intergenic
1092747452 12:11687252-11687274 TGGTGGGGGGCGTGGGGAGCGGG - Intronic
1093077359 12:14771673-14771695 AGGTGGGGGTGGAGTGTAGGTGG - Intergenic
1093124111 12:15307503-15307525 TGGTGGGGGTGTGGGGAGGTGGG - Intronic
1093189103 12:16054821-16054843 TGGTGGAGGTGGAGGGTAGGAGG + Intergenic
1093278509 12:17159899-17159921 TGGGGTGGGTGGGGGGAAGCAGG - Intergenic
1093782809 12:23156254-23156276 TTGTGGGGGTGGGGGGAAGGGGG - Intergenic
1094497570 12:30998068-30998090 TAGTGATGGTGGAGGGGAGCAGG - Intergenic
1094628699 12:32151065-32151087 TGGTGGGGTTGTTGGGAAGATGG + Intronic
1095310568 12:40692754-40692776 TGGCTGGGGTGCGGGGAAGCAGG + Intronic
1095424435 12:42060453-42060475 TGGTGGGGGTGGGATGAAGGGGG - Intergenic
1095551727 12:43449479-43449501 TGCTGAGGGTGGAGGGTAGGAGG + Intronic
1095818867 12:46455101-46455123 TGGAGGCAGTGGAGGGAAGATGG - Intergenic
1095917600 12:47495959-47495981 GGGTGGGGGTGCAGGGGGGCGGG - Intergenic
1095949760 12:47775487-47775509 TGGTGGTGGTGGATGGTGGCAGG + Intronic
1096048180 12:48582764-48582786 TGAAAGGGGTGGAGGGAATCTGG - Intergenic
1096072382 12:48782534-48782556 AGGTAGGGATGGAGGGCAGCAGG - Intronic
1096095489 12:48932772-48932794 AGGTGGAAGTGGGGGGAAGCAGG + Intronic
1096331646 12:50718418-50718440 GGATTGGGGTGGAGGGAAGGAGG - Intronic
1096553502 12:52389582-52389604 TGATCAGGGTTGAGGGAAGCTGG - Intergenic
1096576946 12:52558752-52558774 TGGTGGGGGTGGAGAGAGGCTGG + Intergenic
1096604922 12:52757835-52757857 AGGTGGGTGTGGAGGCAGGCAGG - Intergenic
1096740319 12:53688765-53688787 AGGTAAGGGTGGAGGGCAGCAGG - Intergenic
1096792493 12:54053705-54053727 TGGTGGTGGTGCTGGGAGGCGGG - Intronic
1096816893 12:54207469-54207491 CAGTGGAGGTGGGGGGAAGCAGG + Intergenic
1096836108 12:54352330-54352352 TGGAGGAGGGGGAGGGGAGCAGG - Intergenic
1096996649 12:55842442-55842464 TGATGGGAGTGGAGGTAAGCAGG + Intronic
1097053373 12:56236754-56236776 GGGTGGGAACGGAGGGAAGCAGG + Intronic
1097221297 12:57452752-57452774 TGGTGGGGGTGGAGTGGGGTGGG - Intronic
1097226164 12:57477901-57477923 GGGTGGGGGAGGCGGGAAGTTGG - Intronic
1097266270 12:57746859-57746881 AGGTGGGGGTGGATAGAGGCTGG + Intronic
1097932760 12:65207943-65207965 TGGTGGGGGTAGAGGAAGGGAGG + Intronic
1098177280 12:67805954-67805976 TGGTGGGGAAGGAGGGAGGGAGG - Intergenic
1098416836 12:70243687-70243709 TGGCGGCGGTGGAGGGAGGGAGG + Intronic
1098603351 12:72360588-72360610 TGGTGAGGATGTGGGGAAGCAGG + Intronic
1098953767 12:76667987-76668009 TGGTGGGAGGGGAAGGAAGAGGG - Intergenic
1099431445 12:82591157-82591179 TGTTGGGGGTGGAGGGCTACAGG + Intergenic
1099503475 12:83444878-83444900 TGGTGAGGGTTGGGGAAAGCAGG - Intergenic
1099814314 12:87625551-87625573 TGGTGGGGGGGGTGGTTAGCGGG - Intergenic
1099915757 12:88891296-88891318 TGGTGTGGGGGGAGGGCAGTGGG - Intergenic
1100245197 12:92750728-92750750 GGCTGGGAGTGGAGGGGAGCAGG - Intronic
1100351851 12:93791520-93791542 GGGTTGGGGTGGAGGGCAGGTGG + Intronic
1101045537 12:100801749-100801771 GGGGTGGGGTGGAGGGAAGGTGG + Intronic
1101315526 12:103625505-103625527 TGTTGTGGGTGGGGGGAAGGAGG - Intronic
1101357567 12:103994908-103994930 TGGGGCAGGTGCAGGGAAGCAGG - Intronic
1101548066 12:105735502-105735524 TGGTGGGGGTGGGGGGGTGGGGG + Intergenic
1101664112 12:106793930-106793952 TGGGGGTGGGGGAGGGAAGCAGG + Intronic
1101706612 12:107226376-107226398 TGGTGGGGGTGGGGGGCAAAGGG - Intergenic
1101761324 12:107661193-107661215 AGGTGGGGGTGGAGGGAGGTGGG - Intergenic
1101811718 12:108113258-108113280 TGGTGGGTGTGGAGGTAGCCTGG + Intergenic
1101886081 12:108663673-108663695 TGGGGAGAGTGGAGGGAGGCAGG + Intronic
1101930956 12:109013832-109013854 TGGTGGGGGGAGAGGGAATGGGG - Intronic
1102197834 12:111036888-111036910 GGGTGGGGGTGGGGGGCTGCGGG - Intronic
1102239133 12:111312935-111312957 TGGTGGGGGTGGAGGGAAGCGGG - Intronic
1102368702 12:112362626-112362648 TGGTGGTGGTGGAGGCAGGTGGG + Intronic
1102419712 12:112794088-112794110 TGATGGGGGAGGAGGGAGGGCGG - Intronic
1102531310 12:113548337-113548359 TGGTGGGGATGGGGGCAAACTGG + Intergenic
1102536740 12:113587259-113587281 GGGAGGGGTTGGAGGCAAGCAGG + Intergenic
1102566794 12:113802360-113802382 TGGGGGAGGTGGAGGGAAGGAGG + Intergenic
1102567064 12:113803652-113803674 GGCTGGGGTTGGAGGGCAGCTGG + Intergenic
1102846965 12:116195261-116195283 TGGTGGGGGTGGGGGCAACAGGG + Intronic
1102901997 12:116646167-116646189 TGGTGGGGGAGGAGAGAAGAAGG + Intergenic
1102961187 12:117094316-117094338 TGGTGGGGCTGGGGAGATGCTGG + Intronic
1102964842 12:117118144-117118166 GGGTGGGGGGTGAGGGAAGAAGG - Intergenic
1102985690 12:117276609-117276631 TGGAGGGGGTGAGGGGAAGATGG - Intronic
1103271654 12:119678511-119678533 TGGTGGGGGTAGGGAGATGCTGG - Intronic
1103393731 12:120592074-120592096 TGGTGGGGATAGAGAGAAACGGG + Intergenic
1103499227 12:121388045-121388067 AGGTGAGGGTGGTGGGAAGTAGG + Intronic
1103563024 12:121802039-121802061 TGTTGGGGGTTGGGGGGAGCTGG - Intronic
1103564771 12:121810159-121810181 TTCCGGGGGTGGAGGGAAGTGGG - Exonic
1103661855 12:122526648-122526670 TGGTGGGGGTGGGGAGCCGCAGG - Intronic
1103879806 12:124157389-124157411 AGGTGGGAGTGGAGGGAACGAGG + Intronic
1104207638 12:126655471-126655493 TGGGAGGGGTGAAGGGAGGCTGG + Intergenic
1104278717 12:127354140-127354162 TGGTGGAGGTGGAGGGAAGTGGG + Intergenic
1104379599 12:128295540-128295562 GGGAGGGGGTGGAAGGTAGCAGG - Intronic
1104474946 12:129063592-129063614 TGGTGGGTCTGCAGAGAAGCTGG - Intergenic
1104811491 12:131622607-131622629 TGGCGGGGGTGGGGGGTAGAGGG - Intergenic
1104843216 12:131834428-131834450 GGGTGGGCGTGGAGGGGGGCAGG + Intronic
1104845024 12:131842332-131842354 TGGGCGGTGTGGAGGGCAGCTGG - Intronic
1105262841 13:18792484-18792506 TGGTTGGGGTGGAAGGAAAAGGG - Intergenic
1105546616 13:21355452-21355474 GGGAGGGGGAGGAGGGAAGGTGG + Intergenic
1105606588 13:21931012-21931034 GGATGGGGGAGGAAGGAAGCGGG + Intergenic
1106140383 13:27006515-27006537 GGGTGGGGGTGGGGGGAAAGAGG - Intergenic
1106157465 13:27171681-27171703 GGGCGGGGGAGGAGGGGAGCCGG + Exonic
1106191773 13:27459724-27459746 TGGTGGGTTGGGGGGGAAGCCGG + Intergenic
1106473969 13:30081533-30081555 GGGTGGGGTTGGGGGGAAGGTGG - Intergenic
1106665557 13:31847084-31847106 GGGTGGGGACCGAGGGAAGCGGG + Intergenic
1107122614 13:36812001-36812023 TGCTAGGGGTGGAGGCAGGCTGG - Intergenic
1107358603 13:39594967-39594989 TGGGGTGGGTGGAGGGAGGAGGG + Intronic
1107549031 13:41457940-41457962 AGCTGGTGGTGGAGGGAAGGTGG - Intronic
1107574059 13:41697815-41697837 TGAAGGGGGTGGTGAGAAGCAGG - Intronic
1107793673 13:44028532-44028554 TGGCTGGGGTAGAGAGAAGCAGG + Intergenic
1107839071 13:44436972-44436994 AGGTGGGGGTGGGGGGAGGCGGG - Intronic
1108275721 13:48807596-48807618 TGGTGTGGCTGGAGAGAAGCGGG - Intergenic
1108442107 13:50465213-50465235 TGGTGGGAGTGGGGTGAACCGGG + Intronic
1108484585 13:50910597-50910619 TGGCGAGGCAGGAGGGAAGCGGG + Intronic
1108496851 13:51033917-51033939 TGTTGGGGGAGGCGGGGAGCTGG + Intergenic
1108519479 13:51233551-51233573 TGGGGCGGGTAGGGGGAAGCGGG + Intronic
1108529448 13:51315300-51315322 TGTAGGGGGTTGAGGGAAGCAGG - Intergenic
1108586532 13:51874844-51874866 TTGTGGAGGAGGAGGGAGGCAGG - Intergenic
1108676340 13:52740154-52740176 GGGTGGGGGTGGGGGGAAGATGG + Intergenic
1108703932 13:52968127-52968149 TGGTGGAGGTGGAGGAAAGTCGG - Intergenic
1108990848 13:56656156-56656178 TGGTGGGGGTGTGGAGAAGCAGG - Intergenic
1109993846 13:70095816-70095838 TGGGGGGGGTGGAGGGAGAAGGG - Intronic
1109998821 13:70167510-70167532 TGGTGTGGGGGGAGGGAGGAAGG + Intergenic
1110033351 13:70646854-70646876 TGTTGGGGGTGGGGGGAGGGAGG - Intergenic
1110321368 13:74163582-74163604 TGTGGGGGTTGGAGGGAAGGTGG + Intergenic
1110568197 13:76977337-76977359 TGGTGGGGCTGGAGGCATGGAGG - Intergenic
1111271352 13:85891607-85891629 TGGTGGGGGTGAGAGAAAGCAGG - Intergenic
1111331450 13:86764656-86764678 TTGTTGGGGAGGAGGAAAGCGGG + Intergenic
1111835835 13:93387320-93387342 TGTTGGGGGTGGAGGGGAAGGGG - Intronic
1111897855 13:94163323-94163345 AGGTGGAGGTGGAAGGAAGTAGG - Intronic
1112503116 13:99957220-99957242 TGGCGGGGGTGGAGTGAGGAGGG - Intergenic
1112508748 13:99990748-99990770 TCGTGGGGCAGGAGGGATGCTGG - Intergenic
1112551789 13:100428327-100428349 GGGTGGGGGTGGGGGGTAGGGGG - Intronic
1112630027 13:101150242-101150264 GGGTGGGGGTGGCGGGGAGCGGG + Intronic
1113507313 13:110826184-110826206 TGGTGGGAGTGAAGGGCAGGCGG - Intergenic
1113567105 13:111325692-111325714 CGGTGGGTGTGGAGGGAAAATGG + Intronic
1113865277 13:113517862-113517884 GAGTGTGGGTGGAGGGAAGAGGG + Intronic
1113914413 13:113862276-113862298 TGATGGGAGTTGAGGGCAGCAGG - Intronic
1113966082 13:114154901-114154923 TGGTGGGGGATGGGGGATGCAGG + Intergenic
1114037606 14:18644910-18644932 GGGAGGGGGTTGAGGGGAGCAGG + Intergenic
1114121029 14:19670113-19670135 GGGAGGGGGTTGAGGGGAGCAGG - Intergenic
1114307416 14:21436869-21436891 GGGTGGGGGTGGGGGGGACCCGG + Intronic
1114459681 14:22878480-22878502 TGGTGGGTGTGGAGGGTGGAGGG - Exonic
1114462767 14:22898483-22898505 TGGTTAGAGTGGAGAGAAGCGGG - Intergenic
1114502509 14:23181443-23181465 TGGTGGGGGTGGGGGGGGGATGG + Intronic
1114554745 14:23555673-23555695 TGGGGTGGGGGGAGGGAAGGGGG - Intronic
1114645564 14:24254210-24254232 TGGTGAGGGTGACGGGAAGGGGG + Exonic
1115282236 14:31677318-31677340 TGGTGGGGGTGGAGGGAATGGGG - Intronic
1115437797 14:33396004-33396026 GGGTGGGGCTGGAGGGAATGGGG - Intronic
1115671547 14:35617637-35617659 TGGGGGGGGGGGGGGGAAGGGGG + Intronic
1115819193 14:37195963-37195985 TGGTGGTGGTGGAGGGGAGTAGG + Intergenic
1116466482 14:45239252-45239274 GGTTGGGGGTGGAGGCAAGCAGG + Intronic
1117212863 14:53519475-53519497 TGGTGGAAGGGGAGGGAAGCTGG + Intergenic
1117349820 14:54870361-54870383 GGGTGGGGGTGGAGCCAAGATGG + Intronic
1117399346 14:55344708-55344730 TGGTGGGGGTGGAGGACAAGGGG - Intronic
1117954240 14:61110555-61110577 TGGTGGGGCTGAAGCGAAGTTGG - Intergenic
1118130410 14:62956622-62956644 TGGTGGGGGCGGGGGGGGGCAGG + Intronic
1118793313 14:69116010-69116032 TGGGGTGGGTGGAGGGGAGGAGG - Intronic
1118906705 14:70028697-70028719 TGGAGGGAGTGGAGGAAAGGTGG + Intronic
1118994329 14:70822678-70822700 AAGTGGGGGTGAAGGGAAGGAGG - Intergenic
1119140862 14:72265938-72265960 TGGGGGGGGGGGCGGGAGGCAGG + Intronic
1119218940 14:72891449-72891471 TGGTGGTGGTGCAGGGAGGAGGG - Intronic
1119383972 14:74245775-74245797 TGGATGGAGTGGTGGGAAGCAGG - Intronic
1119402218 14:74370661-74370683 TGGTGGAAGTGGAGAGAAGTAGG - Intergenic
1119479170 14:74949167-74949189 TGGTGGGGGTGGAGATGAGTGGG + Intronic
1119484115 14:74977314-74977336 TGGTGGAGGTGGTCGGAGGCAGG + Intergenic
1119505273 14:75167421-75167443 TGGTGGGGGTGGGGGCGAGGAGG - Intronic
1119531655 14:75365702-75365724 TGGGGGAGGTGGTGGGAAGGAGG + Intergenic
1119700775 14:76753095-76753117 TGGTGGGGGTGGGGTGAAGGGGG - Intergenic
1119740006 14:77008103-77008125 AGGTGTGGGTGAAGGGCAGCAGG + Intergenic
1120039197 14:79733134-79733156 AGGTGGGGGTGAAGGGAAGATGG + Intronic
1120846879 14:89133998-89134020 TGGTGTGGGAGGAGGTAAGTAGG - Intronic
1121145112 14:91576181-91576203 TGGTGGTGGTGGTGGGGGGCAGG + Intergenic
1121316558 14:92964403-92964425 GGGTGGGGAGGGAGGGGAGCTGG + Intronic
1121505377 14:94473126-94473148 TGGTGGGGGAAGGGGGAAGGAGG - Intronic
1121612306 14:95289886-95289908 TGGTGGGGGAGGTGACAAGCTGG - Intronic
1121714751 14:96065645-96065667 TGCTGGGGGTGGAGGGGGTCAGG - Intronic
1121791738 14:96704312-96704334 TGGTGGTGGTGGTGGGATGCAGG + Intergenic
1121843621 14:97154867-97154889 AGGTGGGGCTGGAAGGAAGTGGG + Intergenic
1121923071 14:97901226-97901248 TGGGGGTGGTGGCGGGAGGCAGG + Intergenic
1122160747 14:99782147-99782169 TGGTGGGGGTGGAGGGGTTGGGG - Intronic
1122340298 14:101023754-101023776 TGGTGGTGGTGGCTGGAAGAAGG - Intergenic
1122369370 14:101220827-101220849 TGGTGGGGCAGGTGGGAAGGAGG - Intergenic
1122599823 14:102915683-102915705 GGGTTGGGGGGTAGGGAAGCAGG - Intergenic
1122606064 14:102948256-102948278 GGGTGGGGGTGGAGGTGAGGGGG + Intronic
1122606166 14:102948499-102948521 TGGTGGGTGTGGAGGTGAGAGGG + Intronic
1122609208 14:102969707-102969729 TGGTGGGGCTGGAGGGTAGCAGG - Intronic
1122721880 14:103726859-103726881 GAGTGGGGGTGGTGGGAAGAGGG + Intronic
1122788415 14:104174385-104174407 TGGTTGGGGTGGGGGTCAGCAGG + Intronic
1122855759 14:104559420-104559442 AGATGGGGATGGAGGGAGGCCGG - Intronic
1123037564 14:105477709-105477731 GGGTGTGTGTGGGGGGAAGCGGG + Intronic
1123102060 14:105811026-105811048 AGGTGAAGGTGAAGGGAAGCAGG + Intergenic
1123457028 15:20435633-20435655 TGGTGGGTGGGGAGGGAAAAAGG - Intergenic
1123661034 15:22564726-22564748 TGGTGGGTGGGGAGGGAAAAAGG + Intergenic
1123786634 15:23681337-23681359 TGTTGGGGGTGGGGGGAGGGGGG + Intergenic
1123987447 15:25658090-25658112 TGGCAGGGGTGAATGGAAGCAGG + Intergenic
1124263182 15:28210786-28210808 TGGTGGGTGGGGAGGGAAAAAGG - Intronic
1124314835 15:28658960-28658982 TGGTGGGTGGGGAGGGAAAAAGG + Intergenic
1124635629 15:31363155-31363177 TGGTGAGGCTGCAGGTAAGCAGG - Intronic
1124637594 15:31374855-31374877 GGGGGGTGGGGGAGGGAAGCGGG + Exonic
1124856132 15:33391129-33391151 TGGTGGGGCTGGAGGGATGAGGG - Intronic
1124957052 15:34366732-34366754 AGGTGGGGATGGAGGGCTGCAGG - Intronic
1124961175 15:34396791-34396813 TGGTGGGGTTGGCGGGGAGAGGG - Intronic
1124977805 15:34543012-34543034 TGGTGGGGTTGGCGGGGAGAGGG - Intronic
1125013359 15:34905096-34905118 TGGGGGGGGTGGGGGGAAGGGGG + Intronic
1125312887 15:38399876-38399898 GGGTGGGGGTGGCGGGAAATGGG - Intergenic
1125328694 15:38562717-38562739 TGCTAGGGGTGGAGGGGAGGTGG + Intronic
1125363889 15:38893012-38893034 TGTTGGGGGTGGGGGGCAGGGGG + Intergenic
1125542917 15:40481533-40481555 TGGTGGGGAGGGAGGGGAGATGG - Intergenic
1125792910 15:42383201-42383223 TGATGGGGGTTGGGGGAAGGTGG + Intronic
1126832002 15:52617230-52617252 TGGGGGAGGTGGGGGAAAGCAGG - Intronic
1126835939 15:52664941-52664963 TGTTGGGGGTGGGGGGGTGCAGG + Intronic
1126882093 15:53110262-53110284 TGGTGGAGGGGATGGGAAGCAGG - Intergenic
1127038089 15:54941932-54941954 TGGTAGAGGTGGAGAGAAGAGGG - Intergenic
1127251853 15:57247142-57247164 TGGTGGTGGTGGAGTGACGGTGG - Intronic
1127320000 15:57834690-57834712 GAGTGGGGGCGGGGGGAAGCTGG + Intergenic
1127377884 15:58401765-58401787 GGGTGGGGGAGGCGGGAAACAGG + Intronic
1127377974 15:58402440-58402462 GGGTGGGGGAGGCAGGAAGCAGG - Intronic
1127478242 15:59354848-59354870 GGGTAGCTGTGGAGGGAAGCTGG - Intronic
1127568082 15:60213167-60213189 GGGTGGGGGTGGAGGGCAAGGGG + Intergenic
1127873331 15:63091144-63091166 GGGTGGGGTGAGAGGGAAGCCGG - Intergenic
1128207133 15:65862840-65862862 TGGTGGGGGTGTGGGGAAAGGGG + Intronic
1128253432 15:66179808-66179830 TGGTGGGGGTGGGGGGGTGGTGG - Intronic
1128427381 15:67555623-67555645 TGATGGGGTTGGAGGGAAATGGG - Intronic
1128496290 15:68200428-68200450 TGGTGGAGGTGGAAGGCAGCCGG + Intronic
1128510756 15:68312752-68312774 GGGTGAGGCTGGAGGGGAGCCGG - Exonic
1128561671 15:68672815-68672837 TGGTGGGGGTGGGGAGGGGCAGG - Intronic
1128739638 15:70074600-70074622 TGCTGGTGCTGGAGGGAAGAGGG + Exonic
1128982587 15:72197933-72197955 AGGTGGGGAAGGAGAGAAGCTGG - Intergenic
1129234269 15:74214349-74214371 TGGGGTGAGTGGAGGGAGGCAGG - Intergenic
1129257033 15:74339476-74339498 TGGTGGAGGAGGTTGGAAGCAGG - Intronic
1129444492 15:75607358-75607380 AGGTTGTGGTGGAGGGAACCTGG - Intronic
1129521302 15:76187956-76187978 TCCTGGGGGTGGAGGGTGGCAGG + Intronic
1129521737 15:76190542-76190564 CAGTGGAGGTGGAGGGAGGCGGG + Intronic
1129568356 15:76649428-76649450 TGGGGGTGGTGGTGGGGAGCAGG - Intronic
1129705248 15:77790619-77790641 AGGCAGGGGTGGAGGGAGGCAGG + Intronic
1129888037 15:79052418-79052440 GGATGGGGGCAGAGGGAAGCAGG - Intronic
1129917425 15:79286216-79286238 TGGTGGGGGTGGAGTGGGGGTGG + Intergenic
1129935856 15:79449803-79449825 TGGTAGGGATGGAGAGAAGGAGG - Intronic
1130415253 15:83687814-83687836 TGGCGGGGATGGAGGAAAACTGG + Intronic
1130575611 15:85090683-85090705 GGGTGGGGGTGGGGGGATGATGG - Intronic
1130670726 15:85910115-85910137 TGGTGGGGGTTGGGGGGAGGTGG + Intergenic
1130709050 15:86261312-86261334 TGGAGGGGGTGAAGGCAAGCAGG + Intronic
1131097138 15:89663329-89663351 TGGGGGGTGGGGAGGGAAGATGG - Intergenic
1131340859 15:91599267-91599289 GGCAGGGGGTGGAGGGGAGCAGG + Intergenic
1131357292 15:91757101-91757123 GGTTGGGGGAGGAGGGAAGAGGG - Intergenic
1131360686 15:91788194-91788216 TTCGGGGGGTGGAGGGAAGTGGG - Intergenic
1131399111 15:92110466-92110488 AGGTGGGCGTGGAGGGAACAGGG - Intronic
1132105298 15:99058963-99058985 GGGTGGGGGCGGAGGGAGGGCGG - Intergenic
1132279698 15:100602487-100602509 GGGTGGGGGTGGAGGGAGTAGGG - Intronic
1132338721 15:101064874-101064896 TGGTGGGGGGGGTGGCAGGCAGG + Intronic
1132449976 15:101961708-101961730 CGGAGGGGCTGGAGGGAGGCGGG + Intergenic
1132880883 16:2161214-2161236 GGGAGGGGGCAGAGGGAAGCAGG - Intronic
1132889032 16:2195359-2195381 CTGTGGGGGTGGAGGGAGGAGGG + Intronic
1132943095 16:2518181-2518203 TGGTGGCCCTGGAGGGCAGCTGG + Intronic
1133058413 16:3158813-3158835 GGGTAGGGGTGGAGTGAAGGCGG + Intergenic
1133292912 16:4734510-4734532 TGGGCGGGGTGGGGGGAAGGCGG + Exonic
1133408536 16:5548221-5548243 TGGTGGGGGAGAAAGGAAGAAGG + Intergenic
1133497553 16:6333987-6334009 TGGTGGGGGTAGGGGGGAGCAGG + Intronic
1133791602 16:9013362-9013384 TGCAGGGGTGGGAGGGAAGCAGG + Intergenic
1133845472 16:9449306-9449328 GGTTGGGGGTGGAGGAAAGATGG + Intergenic
1133870697 16:9683024-9683046 TGGTTGGGGTGCAGGGGAGAAGG + Intergenic
1134256743 16:12618698-12618720 TGGTGGTGGTGGGGGGATGGGGG - Intergenic
1134529363 16:14970942-14970964 TGGTTTGGGTGGAGGGAACAAGG + Intergenic
1134614820 16:15643058-15643080 TGGGGGGGGCGGGGGGAAGGCGG - Exonic
1134792011 16:16997596-16997618 TGGGAGGCGTGGAGGGAAGAGGG - Intergenic
1135040244 16:19112775-19112797 TTGTGGGGGAGGGGGGAAGGGGG + Intergenic
1135254441 16:20929762-20929784 AGGTGGGGATGTAGGGAAGGTGG - Intergenic
1135262948 16:20997237-20997259 TGCTGGGGATGGAGGGAAAGAGG + Intronic
1135475059 16:22766702-22766724 TGGTGGGGGAGGAGAGAATACGG + Intergenic
1135774913 16:25249127-25249149 TGGGGGAGGAGGAGGGAAGATGG + Intronic
1135870304 16:26143607-26143629 TTGTGGGGGTGGGGGGAAAGGGG + Intergenic
1136223506 16:28843966-28843988 TGGTGGGGCTTGATGGAACCTGG + Exonic
1136411992 16:30083003-30083025 TGATGGGGGTTGAGGCCAGCGGG + Intronic
1136428479 16:30184152-30184174 TGGTGGGGGAGGAGGCAGGGTGG + Intronic
1136520870 16:30795000-30795022 GGGTGGGGGGTGAGGGCAGCAGG - Intergenic
1136778353 16:32883162-32883184 TGGTGGTGGTGGTGGGGAGGGGG + Intergenic
1136813602 16:33199227-33199249 GGGTGGGGGGGGAGGGGAGTGGG + Intronic
1136820078 16:33309307-33309329 GGGTGGGGGGGGAGGGGAGTGGG + Intergenic
1136892267 16:33978352-33978374 TGGTGGTGGTGGTGGGGAGGGGG - Intergenic
1137235083 16:46609919-46609941 TGGTGGGGGAGGAGAGCAGAGGG - Intronic
1137463993 16:48691435-48691457 GGGTGGTGGTGGGGGGAAGCAGG + Intergenic
1137731343 16:50693012-50693034 TGTTTGTGGTGGGGGGAAGCAGG + Intergenic
1137785268 16:51133247-51133269 GGGTGGGGGGGGAGGGAGGGAGG + Intergenic
1137798239 16:51239730-51239752 TGGTGGAGGTGGTGGGATGGTGG + Intergenic
1137798255 16:51239789-51239811 TGGTGGAGGTGGTGGGATGGTGG + Intergenic
1137966139 16:52935699-52935721 GGGTGGGGGCGGAAGGAAGGCGG - Intergenic
1138175974 16:54898587-54898609 TTGTGGGGGTGGAGGGCAAGGGG - Intergenic
1138251715 16:55506848-55506870 TGGGGGTGGTGGAGGGTAGCAGG - Intergenic
1138328431 16:56193362-56193384 GGGTGGGGGAGGAGAGGAGCTGG - Intronic
1138419358 16:56889267-56889289 TGTTGGAGCTGGAGGGAGGCTGG - Intronic
1139165757 16:64563339-64563361 AGGTGGAGGAGGAGGGAAGAAGG + Intergenic
1139364429 16:66425300-66425322 TGGTGGGGGTGGGGGGACCAGGG - Intergenic
1139613950 16:68077891-68077913 TGGTGGGGGTGGGGGGGAGTGGG - Intronic
1139711502 16:68779844-68779866 TGGGGGTGTTGGAGGGAGGCTGG + Intronic
1139758645 16:69166254-69166276 AGGTGGGGGTGGAAGGAACATGG + Intronic
1139879741 16:70173563-70173585 TGGTGAGGGTGGTGGGCACCGGG + Intronic
1139965190 16:70741387-70741409 AGGTGGGGGGGCGGGGAAGCAGG + Intronic
1140227304 16:73088906-73088928 TGGTGGGGGTCCAGGGCAGGTGG + Intergenic
1140275975 16:73509336-73509358 TGGAGGGGGAGAAGGGAAGTTGG - Intergenic
1140337035 16:74117459-74117481 TGTTGGGGGGTGGGGGAAGCAGG + Intergenic
1140474107 16:75230022-75230044 AGCTGGGGCAGGAGGGAAGCAGG + Exonic
1141193660 16:81842991-81843013 TGGTGGGGGTGGGGTGGACCTGG + Intronic
1141430503 16:83968439-83968461 GGGTGGGGGCGGCGGGGAGCGGG + Intergenic
1141501473 16:84447416-84447438 TGGTGGGGAGGGAGGGAAGAAGG - Intronic
1141632268 16:85294674-85294696 GGGTGGGGAGGGAGGGAAGGGGG - Intergenic
1141682940 16:85554772-85554794 TCGTGGGGGGGGAGGGAGGGAGG + Intergenic
1141809152 16:86362893-86362915 TGGTGGGGGTGGGGTGAGGTCGG + Intergenic
1141980843 16:87549338-87549360 TGGAGGGCGGGAAGGGAAGCGGG + Intergenic
1142007289 16:87695529-87695551 TGGTGGGGGTGGGGAGAGGCAGG + Intronic
1142035906 16:87862042-87862064 GGTTGGGGGTGGAGGGGTGCAGG + Intronic
1142406361 16:89892372-89892394 TGCTGGGGGTGGAGGGCGGCGGG + Intronic
1203080775 16_KI270728v1_random:1145271-1145293 TGGTGGTGGTGGTGGGGAGGGGG + Intergenic
1142597118 17:1035336-1035358 TGGAAGGGGTGGGGGGGAGCAGG - Intronic
1142613895 17:1124153-1124175 TGTGGGGGGTGGAGGGTGGCCGG + Intronic
1142615215 17:1130373-1130395 TGGTGAGGGTGGGGAGGAGCGGG - Intronic
1143128970 17:4664122-4664144 AGGTGGGGGGTGGGGGAAGCAGG + Intergenic
1143316009 17:6033963-6033985 TGGTGGTAGTGGAGGGAATTGGG + Intronic
1143386586 17:6534600-6534622 TGGTGGTGGTGGGGGGCAGGGGG + Intronic
1143636089 17:8164365-8164387 GGGTGGGGGAGGGAGGAAGCTGG - Intergenic
1143718253 17:8791414-8791436 TGGTGAGGGTGTAGAGAAGCTGG + Intergenic
1143815051 17:9506402-9506424 GGGTGGGGGGGGGGGGGAGCGGG - Intronic
1144131552 17:12251411-12251433 GGGTGGGGGTGGAGGGGTTCTGG + Intergenic
1144190183 17:12838556-12838578 CGGTGGCAGTGGAGGGAATCAGG + Intronic
1144290446 17:13821300-13821322 TGGTGGTGGTGTAGGGAAATAGG + Intergenic
1144465674 17:15495040-15495062 TGGGGGGGGTGGAGGAGAGGAGG + Intronic
1144763096 17:17718337-17718359 TGATGGGGGTGGAGAGCATCGGG - Intronic
1144848122 17:18230583-18230605 GGGTGGGGGTGGGGGCAGGCCGG + Intronic
1144877698 17:18411047-18411069 TGGGGAGGGAGGAGGGAAGAGGG - Intergenic
1144922120 17:18772740-18772762 TGGTGGGGGTGGTGGGAGACGGG + Intronic
1145014338 17:19386966-19386988 GGGTGGGGGGGCAGGGAAGAGGG - Intronic
1145043907 17:19597120-19597142 TGGTGGGGGAGGAGAGAAGGGGG + Intergenic
1145154531 17:20533356-20533378 TGGGGAGGGAGGAGGGAAGAGGG + Intergenic
1145722106 17:27083000-27083022 TGGTGGGGCTTGATGGAACCCGG + Intergenic
1145733276 17:27209912-27209934 GGGAGGGGAGGGAGGGAAGCAGG - Intergenic
1145800031 17:27676884-27676906 TGGTGGGGGTGGTGTGTGGCTGG + Intergenic
1146095907 17:29930093-29930115 GGGTGGGGGTGAAGGGAACGGGG + Exonic
1146240705 17:31221088-31221110 GGTTGGGGGTGGAGGGATGGTGG + Intronic
1146320870 17:31845312-31845334 TGTTGGGGGTGGGGGGATCCTGG + Intergenic
1146453231 17:32991091-32991113 TGGTGGGTGTGCAGGGATGTTGG - Intronic
1147160146 17:38564754-38564776 TGGGGGTGGGGGCGGGAAGCAGG + Intronic
1147188775 17:38726810-38726832 TGGTGGGGGTGGGGTGCAGGAGG - Exonic
1147190180 17:38733862-38733884 TCTTTGGGGTGGAGGGAAGAAGG - Exonic
1147250833 17:39151666-39151688 CGGTGGGGGTGGGGGGGAGCTGG + Intronic
1147258732 17:39196815-39196837 GGGTGTGGGGGGAGGGGAGCAGG + Intronic
1147414501 17:40278800-40278822 TGGTGGGGTGGGGGGGCAGCAGG - Exonic
1147460320 17:40564105-40564127 TGGAGGGGGTGCAGGGGAGTGGG + Intronic
1147512876 17:41086900-41086922 TTGTGGGGGTGGGGGGAGGGGGG + Intronic
1147571399 17:41573327-41573349 TCTTGAGGGTGGAGGGAAACTGG - Intergenic
1147726579 17:42569323-42569345 TGGAGGGGATGGAGCCAAGCGGG + Intronic
1147811570 17:43173822-43173844 GGGTGGGGGTGGGGGGCAGAGGG - Intronic
1148092665 17:45031993-45032015 TGGTTGGGGAGGCGGGAGGCTGG + Intronic
1148157569 17:45432504-45432526 TCTGGGGGCTGGAGGGAAGCAGG - Intronic
1148242078 17:46006428-46006450 TGAGGAGGGTGGAGGGGAGCAGG + Intronic
1148393424 17:47289966-47289988 TTGTGGTGGTGGAGGGGAGGTGG + Intronic
1148441760 17:47715150-47715172 TGTTTGGGGTTGAGGGAAGTGGG - Intergenic
1148456739 17:47815194-47815216 AGGTGAGGGAGGAGAGAAGCTGG - Exonic
1148458990 17:47826987-47827009 TGGTGGGGGTGGGGGGAAGATGG + Intronic
1148491021 17:48024095-48024117 CGCTGGGGGTGGAGGGCCGCCGG - Intergenic
1148737824 17:49874663-49874685 AGGTGGGCGTGGAGGGGAGGGGG - Intergenic
1148781671 17:50125678-50125700 TGATGGGGGTGTAGGGAAGGGGG - Intronic
1148786781 17:50149593-50149615 CGGTGGAGGTGGAGGAGAGCGGG - Exonic
1148856854 17:50583656-50583678 TGGTGGGGGTGGGGGGAGGTGGG + Intronic
1149582911 17:57763619-57763641 TGGTGAGGATGTAGGGAAACAGG + Intergenic
1150152035 17:62817866-62817888 GGGAGGGGGTGGAAGGAAGGAGG + Intergenic
1150172662 17:63015977-63015999 TGGTGGGGGTGGGGAGATACTGG + Intronic
1150410474 17:64937253-64937275 TGGTGGGGGTGGGGAGAAGGAGG + Intergenic
1150563743 17:66319119-66319141 GGGTGGGGGTGGAGGGGACAGGG - Intronic
1150639928 17:66942651-66942673 GGGAGGAGGTGGAGGGCAGCAGG - Intergenic
1150667333 17:67153674-67153696 TGCTGTGGGTGAAGGGAAGTGGG - Intronic
1150712581 17:67544408-67544430 GGGTGGGGGTGGAGGGGCACTGG + Intronic
1150775122 17:68075125-68075147 AGGGAGGGATGGAGGGAAGCAGG - Intergenic
1150790216 17:68196846-68196868 TGGTGGGGGGGGCGGGGTGCCGG - Intergenic
1150840537 17:68601603-68601625 GGGGGGGGGTGGGGGGAGGCGGG + Intergenic
1150868202 17:68876817-68876839 TGGTCGGGGGGCAGGGAAGGAGG + Intronic
1150947795 17:69765907-69765929 TGGAGGGGCAGGAGGGGAGCAGG - Intergenic
1151077245 17:71287713-71287735 TGGTGGGGGAGGGGGTGAGCAGG + Intergenic
1151182026 17:72336215-72336237 AGGGGAGGGTGGAGGGAAGGAGG - Intergenic
1151306229 17:73264234-73264256 TGGTGGAGGAGCAGAGAAGCTGG - Intergenic
1151358174 17:73572422-73572444 ATGTGGGGGTGGATGGGAGCTGG - Intronic
1151549540 17:74814216-74814238 TGCTGGTGATGGCGGGAAGCCGG + Intronic
1151579962 17:74972237-74972259 GGGTGGGGGCGGCGGGAGGCTGG + Intronic
1151606806 17:75142642-75142664 AGGGGGGGATGGAGGGAAGGGGG + Intronic
1151654332 17:75488802-75488824 GGGTGAGGGTGGAGGGGAGAAGG - Exonic
1151708810 17:75787946-75787968 TTATGGGGGTGGAGGGAAGCAGG - Intronic
1151797041 17:76353444-76353466 TGGGGCGGGTGGAGGGGAGCGGG + Intronic
1151829115 17:76539118-76539140 TGGAGGGGCTGGAGGGGAGCGGG + Intronic
1151936443 17:77264858-77264880 TGGTGGGGGTGTTGCGAAACGGG - Intergenic
1151966004 17:77432036-77432058 AGCTGGGGGTGGGGGGCAGCAGG + Intronic
1151975011 17:77479755-77479777 TGGGGAGGGTTGAGGGATGCTGG + Intronic
1151999923 17:77638784-77638806 GGGTGGGGTGGGGGGGAAGCGGG + Intergenic
1152118785 17:78405469-78405491 TGGTGGGGGTGGTAGGAAGAGGG + Intronic
1152204546 17:78967556-78967578 CCGTGTGGATGGAGGGAAGCCGG + Intergenic
1152224540 17:79086509-79086531 TGGTGGGGGGCGATGGAAACAGG + Exonic
1152231778 17:79117522-79117544 GTGTGGGTGTGGAGGGAAGCGGG - Intronic
1152315493 17:79578110-79578132 GGGTAGTGGTGGAGGGAAGGGGG + Intergenic
1152542248 17:80982227-80982249 TAGTGGGGAGGGAGGGAAGGTGG - Intergenic
1152550516 17:81027741-81027763 TGGAGGGGGAGGAGGGACACGGG - Intergenic
1152561204 17:81079653-81079675 TGTTGGGGGTGATGGAAAGCAGG - Intronic
1152610742 17:81314057-81314079 TGGGATGGGTGGAGGGAAGCTGG - Intronic
1152652709 17:81503049-81503071 TGGTCTGGGTAGAGGGATGCCGG + Intergenic
1152675941 17:81641285-81641307 TTGGGGAGGTGAAGGGAAGCTGG + Intronic
1152703068 17:81829048-81829070 TGGTGGATGTGGAGGGACCCAGG + Intronic
1152739099 17:82011301-82011323 GGGTGGGGCTGGGGGGCAGCGGG + Intronic
1152773779 17:82187528-82187550 TGGTGGGGCTCGGGGGGAGCTGG + Intronic
1152773847 17:82187696-82187718 TGGCGGGGGTCGGGGGGAGCCGG + Intronic
1152784567 17:82241120-82241142 GGGTGGGGGTGGGGGGCAGAGGG + Intronic
1152811329 17:82384143-82384165 GGGTGTGGGTGGAGGGTAGCAGG - Intergenic
1153493181 18:5670841-5670863 TGGAGTGGGTGGAGTGAAGAGGG + Intergenic
1153592393 18:6687207-6687229 TGGTGGGGGAGGGGGGAAAGAGG + Intergenic
1153688572 18:7568522-7568544 TGGCGGCCGCGGAGGGAAGCGGG + Intronic
1153841343 18:9010877-9010899 TGGTGGGGAGGGAGGGAGGGGGG + Intergenic
1153862245 18:9224577-9224599 TGGTGAGCTTGGAGTGAAGCTGG + Intronic
1153939745 18:9967890-9967912 TGGTGGGGGTGAGGGGACGCTGG - Intergenic
1154215721 18:12414732-12414754 TGGTGGGGGTGGAGGGGTGGGGG - Intronic
1154336704 18:13471642-13471664 TGGGGAGGGTGGAGGGATGACGG + Intronic
1154355298 18:13619942-13619964 GGGTGGGAGTGGAGGGCAGTGGG - Intronic
1154433176 18:14324008-14324030 GGGTGGGGTTAGAGGGAAGGGGG + Intergenic
1155090857 18:22509481-22509503 TGCTGGGGGTGGGGGGGAGGCGG - Intergenic
1155102929 18:22630981-22631003 TCTTGGGGGTGGAGGGATGAGGG + Intergenic
1155170085 18:23260607-23260629 TGGGTGGGGTGGGGGGAGGCTGG + Intronic
1155979276 18:32163859-32163881 GGGTGGGGGAGGAGAGAAGGGGG + Intronic
1156003900 18:32417729-32417751 TAGTGGGGGTGGGAGGAAGGTGG + Intronic
1156178278 18:34573341-34573363 TGGCAGGAGAGGAGGGAAGCAGG - Intronic
1156442774 18:37208180-37208202 TGTAGGGGGAGGAGGGAAGGTGG - Intronic
1156481925 18:37441738-37441760 TGGTGAGTGGGGAGGCAAGCTGG - Intronic
1156504749 18:37582717-37582739 TGATGGGGATGGAGGGAAAATGG - Intergenic
1156516688 18:37686146-37686168 TGGTGGGGGTGGGGGCAAATGGG + Intergenic
1156561129 18:38127017-38127039 TGGTGGGGGTGGAGGGGGGCAGG - Intergenic
1156850984 18:41725958-41725980 TGGTGGGGAGGGAGGGAGGGAGG + Intergenic
1157106796 18:44781495-44781517 AGGTGGGGGTGGGGGGGAGAGGG - Intronic
1157332170 18:46712025-46712047 GGGTGGGGGTTGGGGGTAGCAGG + Intronic
1157574832 18:48736598-48736620 TGATGGGGGTTGGGGGAAGAAGG + Intronic
1157590932 18:48836124-48836146 TGCTGGGGGAGGAGGGAGGTGGG - Intronic
1157610469 18:48952082-48952104 TGGGGGCGGGGGAGGGAAGGGGG - Intergenic
1157615137 18:48982417-48982439 CGGTGGGGAGGAAGGGAAGCAGG - Intergenic
1157890995 18:51417887-51417909 TGGGTGGGGTGGAGAGAAGAAGG - Intergenic
1157989669 18:52479567-52479589 GGGGGGGGGTGGAGGGAGGTAGG - Intronic
1157994063 18:52533876-52533898 TGGTGAGGGTGAAGAGAAACTGG - Intronic
1158243691 18:55406733-55406755 TTGTGGGGATGGGGGGAGGCGGG - Intronic
1158319646 18:56248881-56248903 GGGTGGGGGTGGAGGGGGGCAGG + Intergenic
1158551810 18:58442560-58442582 CAGTGGGGCTGGAAGGAAGCTGG - Intergenic
1158961178 18:62588724-62588746 TGGTAGGGGTGAAGGGAGGGAGG + Intergenic
1159245255 18:65797409-65797431 TGGTTGGTGTGCAGGAAAGCAGG + Intronic
1159460710 18:68719594-68719616 TGTTGGGGGTGGGGGGAGGTGGG - Intronic
1159983397 18:74813462-74813484 TGGTGGGTGTGGGGTGAAGGGGG - Intronic
1160002830 18:75043503-75043525 TGGGAGGGATGGAGGGAGGCAGG - Intronic
1160136969 18:76280567-76280589 GGGTGGGTGTGGAGGGACGTGGG - Intergenic
1160204383 18:76821682-76821704 GGGAGGGGGAGGAGGGAAGGAGG + Intronic
1160324475 18:77930718-77930740 TGGAGGGAGTGGAGGGATGGAGG - Intergenic
1160535574 18:79589761-79589783 TGGAGGGCGGGGAGGGCAGCAGG - Intergenic
1160579055 18:79873416-79873438 TGGGGGGGGGGGAGGGGGGCCGG - Intronic
1160635278 19:70840-70862 CGGAGGGGCTGGAGGGAGGCGGG - Intergenic
1160762389 19:792007-792029 GGGTGGGGGTGGGGAGAGGCTGG + Intergenic
1160773891 19:846065-846087 TGGTGGGTGTGGTGGGAGGGCGG + Intronic
1160782545 19:884290-884312 TCCTGGGGCTGGAGCGAAGCAGG - Intronic
1161104189 19:2435112-2435134 TGGTGGAGGTGGACAGCAGCCGG - Exonic
1161168691 19:2802314-2802336 AGGTGGGGGTGTCGGGAAGTGGG - Intronic
1161265463 19:3361481-3361503 GGGTGGGGGTGGAGAGCGGCGGG - Intronic
1161392492 19:4028638-4028660 TGGGGGGCGTGGAGGGAGGGTGG + Intronic
1161572154 19:5036514-5036536 TGGTGGGGGTGGAGGGGCACTGG - Intronic
1161660973 19:5546049-5546071 AGGTGGGGGTGGCAGGAAGTGGG - Intergenic
1161707657 19:5829602-5829624 TGCGGGGGGTGGGGGGATGCGGG - Intergenic
1161708689 19:5834859-5834881 TGGAGGAGGTGGCGGGAAACCGG + Intronic
1161756141 19:6135710-6135732 TGATGGTGGTGGTGGGAGGCAGG - Exonic
1161851792 19:6740974-6740996 TGGTGGGGGAGGAGGGGAGAGGG - Intronic
1161913912 19:7214848-7214870 AGGTGGGGACGGAGGGAAGAAGG - Intronic
1161952951 19:7477734-7477756 TGGGAGGTGTGGAGGGAAGGGGG + Intronic
1161964297 19:7539894-7539916 TGGTGGGAGGGGAGGGGTGCCGG - Intronic
1161978166 19:7617503-7617525 GGGAGGGGGTGGGGGGCAGCAGG - Intronic
1162078822 19:8206807-8206829 TGGTGGGGGTGGGGTAAAGCAGG + Intronic
1162122199 19:8477954-8477976 TAGTGGTGGTGGAGGGTAACAGG + Intronic
1162317012 19:9945657-9945679 TGGGGGAGGAGGAGGGAAGGGGG + Intergenic
1162322249 19:9977308-9977330 GGATGGGGGTGAATGGAAGCTGG - Intronic
1162396676 19:10421194-10421216 TGGCGGGGGCGGAGGGAATTCGG + Intronic
1162524156 19:11197666-11197688 GGGTGGGGATGGAGAGACGCTGG + Intronic
1162793311 19:13074050-13074072 TGGGGGGAGTGGAGAGAAGATGG - Intronic
1162927753 19:13938559-13938581 GGGTGGGGATGGAGGGATGGGGG + Intronic
1162939180 19:13997756-13997778 TGGTAGGAGTGGAGGCAGGCAGG + Intronic
1163099045 19:15082423-15082445 GGGTGGGGGTGGAGGGTTGTGGG + Intergenic
1163134446 19:15299468-15299490 TGGTGGTGGTGGTGGGTAGGGGG + Intronic
1163229424 19:15990135-15990157 TGGTGGGGTTGGGGGGAGGATGG + Intergenic
1163241348 19:16065767-16065789 GGGAGGGGGCAGAGGGAAGCTGG + Intergenic
1163241567 19:16067042-16067064 CGGTGGGGGAGGGGGGAAACGGG + Intronic
1163366054 19:16876733-16876755 TGGTGGGGGAGCAGGGAGGGAGG - Intronic
1163480551 19:17553583-17553605 AGGTGGGGTTGGAGGGAAATAGG - Exonic
1163484143 19:17576522-17576544 GGTTGGGGGCGGAGTGAAGCTGG + Intronic
1163551467 19:17968091-17968113 TGGGGGTGGTGGCGGGAAGGGGG + Intronic
1163635734 19:18436512-18436534 TGGAGAGGGTGTAGGGAAGTTGG + Intronic
1163720819 19:18897384-18897406 TGGTGGTGGTGGCGGGGAGCGGG - Intergenic
1163755522 19:19104330-19104352 TGGTGAGGGGTGAGGGAGGCGGG + Intronic
1163775367 19:19214167-19214189 AGGTGGGGGTGAAGTGAAGGAGG + Intronic
1163886290 19:19967457-19967479 TGGTGGGGGTGGGGCCAAGATGG - Intergenic
1164394432 19:27850966-27850988 TGCTGAGGGTGGAGGGTAGTGGG - Intergenic
1164458259 19:28426914-28426936 TGGGAGGGGTGGAGGGTAGAAGG + Intergenic
1164552803 19:29225776-29225798 TGGTGGGGGAGGAGCCAAGATGG + Intergenic
1164738264 19:30558395-30558417 TGGTGGGGGTGGAGGGTACTTGG + Intronic
1164968224 19:32506030-32506052 GGTTGAGGGTGGAGGGAAACAGG + Intergenic
1165104487 19:33460883-33460905 GGATGGGGGTGGAGGGAAGGTGG + Intronic
1165116620 19:33532887-33532909 TGGTGGGGTTGGAGTGAGGCAGG - Intergenic
1165264227 19:34646982-34647004 TGCTGGGGGTAGAGAGAAGGAGG - Intronic
1165724997 19:38106607-38106629 TGTTGGGGGTGTAAGGGAGCAGG - Exonic
1165732627 19:38156106-38156128 TGGTTGGGCTTCAGGGAAGCAGG + Intronic
1165811640 19:38615232-38615254 TGGAGGGGGAGGAGGAAAGTGGG + Intronic
1165912346 19:39237078-39237100 AGGTGGGAGTAGAGGGAAGGGGG + Intergenic
1165979354 19:39706694-39706716 TGGAGGGGGTGGAGGAGAGAAGG + Intronic
1166100059 19:40566379-40566401 TGGTGGGGGTGGGGGTAATGGGG - Intronic
1166108772 19:40610447-40610469 AGGCAGGGGTAGAGGGAAGCGGG - Intronic
1166111716 19:40626920-40626942 TGGTGGGTGTGGGGGCCAGCAGG + Intronic
1166532854 19:43552937-43552959 GGGTGGAGGAGGAGAGAAGCTGG - Intronic
1166542883 19:43617249-43617271 TGGTGGGGTTGGTGGGGGGCGGG - Intronic
1166734309 19:45075522-45075544 TGGTGGCGGTGGAGGGGGGGCGG - Intronic
1166852039 19:45765765-45765787 TGGTGGGGGCGCCGGGAAGTTGG + Exonic
1167087749 19:47321877-47321899 GTGTGGGGGTGGAGGGAAGTGGG - Exonic
1167219134 19:48186241-48186263 TGCTGGGGGTGGGGGGTGGCGGG - Intronic
1167311560 19:48740332-48740354 GGGATGGGGTGGAGGGAACCTGG + Intronic
1167364948 19:49049778-49049800 GGATGGGGGTGGAGAGAAACTGG - Intergenic
1167414113 19:49361532-49361554 TGATGGGGGTTGTGGGAAGCTGG - Intronic
1167587542 19:50383491-50383513 TGGTGGGGCTAGAGGAAATCAGG + Intergenic
1167618985 19:50551068-50551090 TGATGGGGGTGGGGGGATGCGGG - Intronic
1168456251 19:56511018-56511040 TGGTGGGGATTGAGTGAAGAAGG + Intronic
1168561027 19:57383500-57383522 TGGTGGGGGGAGGGGGGAGCGGG - Intronic
1202711836 1_KI270714v1_random:23251-23273 TGGTGGCGAGGGAGGGGAGCAGG - Intergenic
924989531 2:300523-300545 TGTCGGGGGTGGTGGGAGGCTGG + Intergenic
925173721 2:1767940-1767962 GGGTGGGGGTAGAGGGAGGTGGG + Intergenic
925420658 2:3708131-3708153 CGGTGGGGGTGCAGAGGAGCTGG + Intronic
925440024 2:3877771-3877793 TGGTTGGGGTGGGGGGAGGGGGG - Intergenic
925445539 2:3923862-3923884 TGGTGGGGGTGGAGGGATCTGGG + Intergenic
925948307 2:8887253-8887275 AGGGGGTGGTGGAGGGAAGGAGG - Intronic
925994436 2:9280345-9280367 TGGGGGCGGTGGGGGGGAGCAGG - Intronic
926104377 2:10141313-10141335 GGGAGGGGATGGAGGGAAGATGG - Intergenic
926685350 2:15693732-15693754 TGCTAGGGGTTGAGGGAAGGAGG + Intronic
926732970 2:16051087-16051109 GGGTGGGGGCGGAGGGAGGCAGG - Intergenic
926754321 2:16223392-16223414 TGGTGTTGGGGGAGGGAGGCTGG - Intergenic
927107351 2:19839624-19839646 TGGTGTGGGTGGAGAGAAGGGGG - Intergenic
927278213 2:21279648-21279670 TGCTGGGGCTGGAGGGAGGGCGG + Intergenic
927515956 2:23671808-23671830 GGCTGGGGATGGAGGGCAGCGGG + Intronic
927870139 2:26618139-26618161 AGGTCGGGGTGGAGGGAGGCAGG - Intronic
927921833 2:26978424-26978446 GGGTGGGGGTGGAGGGTGGCTGG - Intronic
927961077 2:27241082-27241104 TACTGGTGGTGGAGGGTAGCAGG - Exonic
928078112 2:28283673-28283695 AGGTAGGTGTGGAGGGAACCAGG + Intronic
928100955 2:28437106-28437128 GGGTGGGGGTGGGGGGAGGCGGG + Intergenic
928461123 2:31473630-31473652 TGGTCGTGGTGGCTGGAAGCGGG + Intergenic
928756705 2:34535004-34535026 TGGTGGGGATTAAGGAAAGCTGG + Intergenic
928758691 2:34556549-34556571 TTGTGGGGTTGGGGGGAAGGGGG - Intergenic
929126598 2:38528214-38528236 CGGCGGGGGAGGAGGGGAGCCGG - Intergenic
929281611 2:40086793-40086815 GGGTGGGGGTGGCGGGGAGTTGG + Intergenic
929434648 2:41919232-41919254 TTTGGGGGGTGGAGGGAAGATGG - Intergenic
929460296 2:42098432-42098454 TGGTGGGGGTGGGGGGAGTTAGG - Intergenic
929558057 2:42937686-42937708 TGGTGGGGGAGGAGGGCGGGAGG - Intergenic
929643499 2:43604903-43604925 TGGTGTGTGTGGAAGGAAGAGGG - Intergenic
929875159 2:45790869-45790891 TGGTGCTGGTGGTGGTAAGCGGG + Intronic
929892468 2:45929712-45929734 TCCTGGGGGTGGGGGGAAGATGG - Intronic
929983093 2:46699183-46699205 TGGTGGGGGTTGGGGGGAGGGGG + Intronic
930198173 2:48529655-48529677 GGGTGGGGGTGGGGTGAGGCGGG + Intronic
930218353 2:48720342-48720364 TGATGGGAGTGGAGTGAAGTAGG - Intronic
930222745 2:48761724-48761746 TTGTGGGGGTGGAGGGCATGGGG - Intronic
930365617 2:50435798-50435820 TCTTGAGGGTGGAGGGAAGGAGG + Intronic
930430949 2:51275313-51275335 TGGATGGGGTAGAGGGAAACAGG + Intergenic
931029444 2:58155735-58155757 TGGTGGGGGCGGTGGGGAGGTGG - Intronic
931193113 2:60024579-60024601 TGATGGGGGTGGAGGTGAGGAGG + Intergenic
931223141 2:60306306-60306328 GGGTGGGAGTGGAGGGAGGAAGG - Intergenic
931225368 2:60324781-60324803 TGGGGAGGGTGCAGGGAGGCAGG - Intergenic
931389961 2:61833054-61833076 TGGTGGGGAATGAGGGAAGGTGG + Intronic
931569929 2:63657630-63657652 TGGTGCAGGTGGTGGTAAGCGGG + Intronic
931643823 2:64404188-64404210 TGGGGAGGGAGGAGGGAAGAGGG - Intergenic
931807361 2:65820172-65820194 TAGTAGAGGTGGAGAGAAGCAGG - Intergenic
932022724 2:68104053-68104075 AGGTGGGAGTGGAAGGAAGAAGG + Intronic
932083034 2:68732572-68732594 TGGGGAGGCTGGAGGGTAGCTGG + Intronic
932299649 2:70657354-70657376 TGGCTGGGGTGCAGGCAAGCAGG - Exonic
932318210 2:70800612-70800634 TGGTGGGGGTTATGGGAGGCAGG - Intergenic
932333749 2:70917496-70917518 TGGTGAGGATGCAGGGAAGCTGG - Intronic
932340529 2:70960387-70960409 TGTTGGTGGTTGAGAGAAGCAGG - Intronic
932492688 2:72132009-72132031 GGGAGTGGCTGGAGGGAAGCTGG + Exonic
932605580 2:73163307-73163329 TGGTGGGGGTGAGGGGAGGTGGG - Intergenic
933206497 2:79513240-79513262 AGGTGGGGAGGGAGGGAGGCAGG - Intronic
933286102 2:80386214-80386236 TGGTGGTGGGGAAGGGAAGGAGG - Intronic
933372940 2:81440397-81440419 TGGGGGGAGTAGTGGGAAGCAGG + Intergenic
933996365 2:87672865-87672887 TGGTGGGGGAGGATGGGAGGAGG - Intergenic
934502199 2:94870228-94870250 TGGTGGGGCTGGAGAGACCCTGG + Intergenic
934699056 2:96423912-96423934 TGGTGGGGGTGGACAGAGGCAGG - Intergenic
934954455 2:98605934-98605956 CAGTGGGGCTGGAGGAAAGCAGG - Intronic
935218619 2:100993451-100993473 TGGTTGGGAGGCAGGGAAGCTGG - Exonic
935373962 2:102376682-102376704 TGGTGGGAGGGGAGGGATGATGG + Intronic
935563648 2:104584312-104584334 TGGTGGGGGTGGGGGGGGGGCGG + Intergenic
935711323 2:105901802-105901824 TGTTGGGGGAGGAAGCAAGCAGG + Intergenic
935794181 2:106624914-106624936 TGGTGGGGGCAGAGGGTGGCAGG - Intergenic
936566202 2:113584203-113584225 CGGAGGGGCTGGAGGGAGGCGGG + Intergenic
936911902 2:117602240-117602262 TGGGGGAGATGGAGAGAAGCAGG - Intergenic
936919717 2:117675495-117675517 TGGCGGGGGAGGTGGAAAGCAGG - Intergenic
936951210 2:117979346-117979368 TGGAGGGTGAGTAGGGAAGCAGG - Intronic
937201990 2:120209772-120209794 TGGCGGGAGTGGCGGGCAGCTGG + Intergenic
937282323 2:120727839-120727861 TGGTGAGGCTGTAGGGAAACAGG - Intergenic
937496707 2:122428190-122428212 TGCTGGGGGTTGAGGGTGGCCGG - Intergenic
937631112 2:124102104-124102126 AGGGGGTGGTGGAGGGAATCTGG - Intronic
937777000 2:125789770-125789792 TGGGGTGGGGTGAGGGAAGCTGG - Intergenic
937795176 2:126009010-126009032 TGGAGGGGGTAGGGGGAAGCTGG + Intergenic
937907887 2:127061202-127061224 TGGTTGGGGGGGTGGGTAGCGGG - Intronic
937982098 2:127621958-127621980 TGGTGGGTGAGGAGGGGAGAAGG - Intronic
938092860 2:128444637-128444659 TGGTGAGAGAGGAGGGGAGCAGG - Intergenic
938176992 2:129142812-129142834 CGGTGGGAGTGGAGTGGAGCAGG - Intergenic
938370451 2:130764759-130764781 TGTTGGGGGTGGGGGGTGGCAGG + Exonic
938391886 2:130913197-130913219 TTGTGGAGTTGGAGGGAAGCAGG + Intronic
938405092 2:131028051-131028073 TGGAGGGGGTGGGGAGCAGCTGG + Exonic
938442843 2:131351951-131351973 GGGAGGGGGTTGAGGGGAGCAGG + Intronic
938571249 2:132563889-132563911 TGGTTGGGGTGGGGGGACCCAGG - Intronic
938720130 2:134060264-134060286 TGGGGGGGGTGGAGCCAAGATGG + Intergenic
938765727 2:134459635-134459657 GGCTGGGGGAGGAGGGAACCCGG - Intronic
938939901 2:136161054-136161076 TGATTGGCGTGGAGGGAAGATGG + Intergenic
939110360 2:137999403-137999425 TGGTGTGTGTGGAGGGAAGGAGG - Intronic
939411739 2:141835494-141835516 TGGGGGGAGGGGAGGGAAGGTGG + Intronic
939705092 2:145442599-145442621 TTGTGGGGGTGGGGGGAGGGGGG + Intergenic
940116940 2:150219562-150219584 TGGGGGAGGTGGCGGGCAGCAGG + Intergenic
940239014 2:151542912-151542934 TGGAGGGTGTGGAAGGATGCTGG - Intronic
940324428 2:152410652-152410674 GGGTGGGGGTGAAGGGATGGTGG - Intronic
940396500 2:153197075-153197097 TGGTGGTGGTGGTGGCAGGCAGG + Intergenic
941114323 2:161454277-161454299 TGGGAGGGATGGAGGGAAGAAGG - Intronic
941415817 2:165219788-165219810 TGGTGGGGATGACAGGAAGCAGG + Intergenic
942307316 2:174621492-174621514 CGATGGGGGTGGAGGGGAGGGGG - Intronic
942425977 2:175861284-175861306 TTGTGGGGGTTGAGGGGAGTTGG + Intergenic
942546308 2:177067643-177067665 GGGTGGGGGTGGAGGGATGGGGG + Intergenic
942597907 2:177609561-177609583 GGGTGGGGGCAGAGTGAAGCTGG + Intergenic
942875929 2:180797530-180797552 AGGTAGGGGTGGAGAGAGGCAGG + Intergenic
943046659 2:182868135-182868157 GGGCGGGGGTGGGGGGAAGAGGG - Intergenic
943581340 2:189687102-189687124 TGGTGGGGCAGGAGGGAAGTGGG - Intronic
943662608 2:190575189-190575211 TGTTGGGGATGGTGGGAAACTGG - Intergenic
943702738 2:191004139-191004161 GGGGCAGGGTGGAGGGAAGCAGG - Intronic
943703804 2:191014203-191014225 TGGTGGGGGCGGAAGGGGGCCGG - Exonic
943729045 2:191282378-191282400 TGGTGGTGGTGGTGGAGAGCAGG + Intronic
944087574 2:195867251-195867273 TGTTGGGGAGGGAGGAAAGCAGG - Intronic
944214505 2:197240814-197240836 TGTTGGGGGTGTGGGGAAGTGGG - Intronic
944414650 2:199469537-199469559 TGGTGGGGGTGGGGGTGGGCAGG + Intronic
944592592 2:201231800-201231822 TGGTGAGGGTGTGGGGAAGTGGG + Intergenic
944604951 2:201344404-201344426 GGGTGGGGGTGGAGGGATAGGGG + Intronic
944762491 2:202831423-202831445 AGTTGGGAGTGGAGGGAAGGAGG - Intronic
945008968 2:205441511-205441533 TGGTGGGGAAGAAGGGTAGCAGG + Intronic
945205675 2:207329346-207329368 TGGTAGGGGTGGAAGTAAGATGG + Intergenic
945429927 2:209752190-209752212 TGGTGGGGGAGGAGCCAAGATGG - Intergenic
945993177 2:216413143-216413165 TGGTGGGGGAGGGGGGAGGGGGG + Intronic
946104982 2:217361090-217361112 TGGGAAGGGTGGAGGGAAGAGGG + Intronic
946205343 2:218102746-218102768 TGGGGTGGGGGGAGGGAAGAGGG - Intergenic
946396887 2:219447829-219447851 GGGTGGGGGTGGGGGGCAGGAGG + Intronic
946493426 2:220171906-220171928 TGGTGGGGATGGTGGTAAACTGG + Intergenic
946884780 2:224211988-224212010 GGGTGGGAGTGGAGGGAGGAGGG - Intergenic
947305484 2:228741560-228741582 TGGTGGGGTTGGGGGGAGGGGGG - Intergenic
947544083 2:230998734-230998756 TGGTGAGGATGTAGAGAAGCTGG + Intronic
947544706 2:231002645-231002667 AAGTGGGGGTGGTGGGAAGCTGG - Intronic
947545777 2:231009264-231009286 TGGTGGTGGTGGAGGAAAACGGG - Intronic
947589901 2:231379575-231379597 TGGGGGAGGGGGAGGGAGGCAGG + Intergenic
947723620 2:232383278-232383300 TGGGGGTGGTAGAGGGTAGCAGG + Intergenic
947740250 2:232481672-232481694 TGGTGGGTGGGGAGGGGAGGGGG - Intronic
947742400 2:232490679-232490701 GGGAGGGGGTGGAGGAAGGCCGG + Intergenic
947774509 2:232697233-232697255 TGGAGAGTGGGGAGGGAAGCGGG + Intergenic
947778344 2:232733333-232733355 TGGTGGGGGAGCAGGGAGTCAGG + Intronic
947885839 2:233570305-233570327 GGGTGGGGGTAGGGGGAAGTTGG - Intergenic
947908958 2:233789400-233789422 TGGTTTGGGTGTAGGGAAGGAGG + Intronic
947909661 2:233792701-233792723 GGTTGGAGGTGGAGGGCAGCAGG + Intronic
948553535 2:238791881-238791903 TGGTGGTGGTGGGGGGGGGCGGG + Intergenic
948615950 2:239199104-239199126 GGGTGGGGGTGGTGGGGGGCAGG - Intronic
948733158 2:239979966-239979988 ATGTGGGGGTGTAGGGGAGCAGG - Intronic
948733172 2:239980008-239980030 ATGTGGGGGTGTAGGGGAGCAGG - Intronic
948760847 2:240190058-240190080 GGTTGGGGGTGGAGGCAGGCTGG + Intergenic
948762198 2:240199178-240199200 CGGTGGGGGAGGGGGGAAGCAGG - Intergenic
948798530 2:240419528-240419550 TCGTGGGTGTGGAGAGGAGCTGG - Intergenic
948856288 2:240732056-240732078 GGATGGGGGAGGAGGGAAGGAGG + Intronic
948862695 2:240760644-240760666 AGGTGGGGCTGGAGGGCCGCTGG - Exonic
948899800 2:240950515-240950537 TGGTGAGGCTGGGGGGCAGCGGG + Intronic
948984426 2:241511511-241511533 AGGTAGGAGTGGAGAGAAGCTGG + Intergenic
949033731 2:241807368-241807390 GCGTGAGGGGGGAGGGAAGCTGG - Intergenic
1168782229 20:502890-502912 TGGAAGTGGTGAAGGGAAGCAGG - Intronic
1168793496 20:595928-595950 GGGTGGGGGTGGGGAGGAGCGGG + Intergenic
1168827160 20:821740-821762 GGCTGGGGTAGGAGGGAAGCTGG - Intergenic
1168842198 20:916766-916788 GGATGGGGGTGGAGGGAAAGAGG - Intergenic
1168947219 20:1771224-1771246 TGTTGGAAGTGGACGGAAGCTGG + Intergenic
1169000055 20:2162151-2162173 GGGTGGGGGTGTGGGGAGGCTGG - Intronic
1169133148 20:3178019-3178041 TGGTGAGGCTGTAGGGAAACAGG - Intergenic
1169140872 20:3226949-3226971 TGGTGGCGATGGAGGGAGGTGGG - Intergenic
1169216258 20:3796412-3796434 GGGTGGGGGGGGGGGGAAGGAGG - Exonic
1169252884 20:4073606-4073628 TCTTGGGGATGGAGGGAAGCAGG + Intronic
1169307726 20:4507542-4507564 TTGAGGGGGTGGAGGGAGGGCGG + Intergenic
1169698864 20:8424144-8424166 TGGTGGGGGAGGAGGGGTGTGGG - Intronic
1170394906 20:15915674-15915696 GTGTGGGGGTGTAGGGAGGCAGG + Intronic
1170461754 20:16583839-16583861 TGGGGTGGGTGCAGGGAAGGAGG - Intergenic
1170726208 20:18929378-18929400 TGTTGGGGGTGGGAGGAAGGGGG - Intergenic
1170808548 20:19655237-19655259 TGGCTGGGGTGGAGAGAAGCGGG - Intronic
1170871762 20:20212656-20212678 AGGTGGGGGTGGAGGATAGCAGG - Intronic
1171433951 20:25104762-25104784 TGGAGGGGAAGGAGGGCAGCAGG - Intergenic
1171458024 20:25282832-25282854 AGGTGCTGGTGGAGGGCAGCGGG + Intronic
1171567597 20:26209086-26209108 TGGGGGGGGGGGTGGGAGGCGGG - Intergenic
1172118282 20:32584085-32584107 TGGGGGGGGGGGAGGGAGGCAGG - Intronic
1172230501 20:33332867-33332889 TGGAGAGGGAGGAAGGAAGCAGG + Intergenic
1172281705 20:33712403-33712425 TGGTGTGGGGGGAGGGGAGCAGG - Intronic
1172586098 20:36085985-36086007 TGGTGGGTGGGGAGGGGAGGTGG + Intergenic
1172661388 20:36571756-36571778 GGGTAGTGGTGGAGGGAGGCTGG - Intergenic
1172775765 20:37405880-37405902 TGGTGGGGAAGGAGGGAGGAGGG - Exonic
1172789529 20:37493209-37493231 TGGTGAGGGTGTAGAGAAGAGGG + Intronic
1173265471 20:41475667-41475689 TGTTGGTGGTGGAGGGTAGAGGG - Intronic
1173454453 20:43191247-43191269 TGGTGGTGGTGGTGGGAGTCGGG - Intergenic
1173733248 20:45342653-45342675 AGGTGGGGGTTGGGGGAAGCAGG + Intronic
1173766139 20:45611278-45611300 GAGTGGGGGTGGTGGGAGGCGGG + Intronic
1173809037 20:45945203-45945225 TGGTGGTGGTGAAGATAAGCTGG + Intronic
1173825949 20:46047660-46047682 TGGTGGGGGTGAGATGAAGCAGG + Intronic
1174138208 20:48394952-48394974 TGGTGGGGGTGCAGCACAGCTGG + Intergenic
1174183382 20:48688918-48688940 TGGTGGTGGTGGAGGGCAGGTGG - Intronic
1174188221 20:48721962-48721984 TGGAGGGGGTGGTGGGGAGGTGG + Intronic
1174204545 20:48828808-48828830 TGGGGTGGGTGGATGGAAGGGGG - Intergenic
1174287587 20:49483630-49483652 GGGTGGGGGAGGTGGGAGGCGGG + Intergenic
1174689155 20:52486017-52486039 TGGTGGGGGTTGAGTGGAACAGG + Intergenic
1174894355 20:54433166-54433188 TGTTGGGGGAGGAGGGAAGAAGG - Intergenic
1175147055 20:56904849-56904871 TGGTGGGGGTGGAGGGGGTGGGG + Intergenic
1175517815 20:59579890-59579912 TGGTCGGGGAGGAGGGAGACTGG + Intronic
1175521113 20:59603620-59603642 TGGAAGGGGTGGGGGCAAGCGGG - Intronic
1175729759 20:61346310-61346332 TGGTGTGGTCGGAGGGAGGCAGG + Intronic
1175753362 20:61514312-61514334 GGGTGGGGGTGGGGGGGGGCGGG - Intronic
1175775736 20:61652660-61652682 TGGTGGGGATGTATGGAATCGGG - Intronic
1175802787 20:61810604-61810626 TGGTAGTGGTGGATGGGAGCAGG - Intronic
1175813340 20:61870536-61870558 TGGTGGGGGTGGCAGGATGATGG - Intronic
1175915918 20:62425716-62425738 TGGCTGGGGTGGAGAGCAGCCGG - Intronic
1175926081 20:62472284-62472306 TGGAGCAGGTGGTGGGAAGCAGG - Intronic
1176030830 20:63010416-63010438 GGGTGGGGGAGGAGGGGAGCCGG - Intergenic
1176039154 20:63055238-63055260 TGGGGGGTGTGGAGTGAGGCTGG + Intergenic
1176247855 20:64105715-64105737 TGGTGGGGGTGGGGGGGGGTGGG + Intergenic
1176414742 21:6467856-6467878 GGGTGGGGGTGGCTGGAACCCGG - Intergenic
1176548883 21:8213188-8213210 TGGTGGGGGAGGAGGAAGGCGGG + Intergenic
1176556778 21:8257401-8257423 TGGTGGGGGAGGAGGAAGGCGGG + Intergenic
1176567814 21:8396223-8396245 TGGTGGGGGAGGAGGAAGGCGGG + Intergenic
1176575717 21:8440442-8440464 TGGTGGGGGAGGAGGAAGGCGGG + Intergenic
1176691476 21:9916307-9916329 TGTTGGGGGTGGAGGGCAAGGGG - Intergenic
1176968030 21:15233600-15233622 TCATGGGGGTGGAGGGGAGGGGG + Intergenic
1176970302 21:15257401-15257423 TGCTGATGGTTGAGGGAAGCAGG + Intergenic
1177123664 21:17168865-17168887 TGTTTGGGGTGGGGGGAGGCTGG + Intergenic
1178293356 21:31387773-31387795 AGGTGGGCCTGGAGGGAAGCCGG + Intronic
1178404206 21:32311395-32311417 GGTGGGGGGTGGAGGGGAGCAGG - Exonic
1178587946 21:33885573-33885595 AGGTGGGGGTGTGGGGAACCCGG - Intronic
1178673683 21:34614076-34614098 TTGCGGGGGTGGGGGGAGGCGGG + Intronic
1179038431 21:37780575-37780597 TGGTGGGGGTGGGGGAGTGCAGG + Intronic
1179156980 21:38859292-38859314 AGGTGGGGTTGCAGGGAAGGGGG + Intergenic
1179411503 21:41167206-41167228 GGGCGGGGGTGGGGGGAAGGTGG + Intergenic
1179690242 21:43076178-43076200 GGGTGGGGGTGGCTGGAACCCGG - Intronic
1179711905 21:43268316-43268338 GGCTGGTGGGGGAGGGAAGCAGG + Intergenic
1179714324 21:43279931-43279953 AGGTGGAGGTGGAGGGGAGGTGG + Intergenic
1179714381 21:43280084-43280106 AGGTGGAGGTGGAGGGGAGGTGG + Intergenic
1179714404 21:43280129-43280151 AGGTGGAGGTGGAGGGGAGGTGG + Intergenic
1179714452 21:43280232-43280254 AGGTGGAGGTGGAGGGGAGGTGG + Intergenic
1180020908 21:45126404-45126426 TGGAGGGAGTGGAGAGGAGCAGG - Intronic
1180137346 21:45870493-45870515 GGGCTGGGGAGGAGGGAAGCAGG - Intronic
1180160704 21:45997637-45997659 TGGTGACCTTGGAGGGAAGCAGG - Intronic
1180210954 21:46295377-46295399 GGGTTTGGGTGGAGGGAAGAGGG - Intronic
1180385177 22:12172715-12172737 TGGCGTGGCTGGAGGGTAGCTGG + Intergenic
1180461734 22:15571952-15571974 GGGAGGGGGTTGAGGGGAGCAGG + Intergenic
1180589881 22:16928363-16928385 TGGTGGGTGAGGGGAGAAGCTGG + Intergenic
1180735025 22:18010028-18010050 GGGAGGGGAGGGAGGGAAGCAGG + Intronic
1180874633 22:19169445-19169467 TGGTTGGGGTGGAGGAAGCCCGG + Intergenic
1181013158 22:20053995-20054017 TGGAGGGGGAGGAGGGCAGGAGG - Intronic
1181151688 22:20888458-20888480 ATGGGGGGCTGGAGGGAAGCGGG - Exonic
1181451280 22:23023552-23023574 TGGTGGGGGTCGGGGAAAGGTGG + Intergenic
1181522502 22:23457704-23457726 GGGTGGGGGTGGACGGAGACAGG - Intergenic
1181528160 22:23501889-23501911 TGGTGGAGGTGGCGGGTGGCGGG - Intergenic
1181601273 22:23953221-23953243 TGGTGGTGGTGCAGGGTTGCGGG + Intergenic
1181618012 22:24068205-24068227 AGAAGGGGGTGGAGGGAAGGAGG + Intronic
1181861534 22:25823060-25823082 GGTTGGGGGAGGAGGGCAGCAGG + Intronic
1182048774 22:27297619-27297641 TGTTGGGGGTGGGGGGTGGCAGG - Intergenic
1182201351 22:28573832-28573854 TAGTGGGGGTGGGGGGAAGTGGG - Intronic
1182282044 22:29223535-29223557 TGGTGGAGGTGGGGGGCACCTGG - Intronic
1182351055 22:29700205-29700227 TGGTGGGGGTGGGGGGGCGTCGG - Intergenic
1182361326 22:29748113-29748135 TGGAGGGTGTGAAGAGAAGCAGG - Intronic
1182442677 22:30373420-30373442 GGGTAGGGGTCGGGGGAAGCTGG - Intronic
1182994274 22:34798555-34798577 TGGAGGGGAGCGAGGGAAGCAGG + Intergenic
1183002839 22:34875921-34875943 TGATGAGGATGGAGGGAAGGGGG + Intergenic
1183312172 22:37116238-37116260 TGTGGGAGGTGGAAGGAAGCAGG - Intergenic
1183320909 22:37164483-37164505 TGGTGGGGGTGGTGGGCAGGGGG + Intronic
1183409199 22:37645116-37645138 TGTGGAGGGTGGAGTGAAGCGGG + Intronic
1183861461 22:40673394-40673416 TGGTGGGGGCTGAGCGCAGCAGG + Intergenic
1183927944 22:41219208-41219230 AGGTGGAGGTGGTGGGATGCAGG - Intronic
1183948296 22:41339032-41339054 TCGTGGGCGTGGAGGGGAGAAGG - Exonic
1183958936 22:41399260-41399282 TGATGTGGTGGGAGGGAAGCCGG + Exonic
1184096712 22:42320016-42320038 TGGTGGGAATGGAGGGAAGATGG - Intronic
1184240972 22:43211107-43211129 TGGTGGGTGTGGAGGGGTGCAGG + Intronic
1184248911 22:43249300-43249322 CGGGCGGGGTGGAGGGGAGCTGG + Intronic
1184339661 22:43879303-43879325 GGGTGGGGGTCGGGGGGAGCAGG - Intergenic
1184561901 22:45268522-45268544 GGGTGAGGGGTGAGGGAAGCGGG - Intergenic
1184600241 22:45539130-45539152 AGGAGGGGGAGGAGGGAAGTGGG - Intronic
1184604459 22:45564193-45564215 TGGAGGAGATGGAGGGAGGCAGG - Intronic
1184654260 22:45933236-45933258 TGCTGGGGAGGGAGGGATGCTGG - Intronic
1184669366 22:46004705-46004727 TGGTGGGGGAGGATGGAGTCTGG + Intergenic
1184852312 22:47127986-47128008 TGGGTGGGGTGGAGGGAGGATGG - Intronic
1184852326 22:47128014-47128036 TGGGTGGGGTGGAGGGAGGATGG - Intronic
1184852365 22:47128108-47128130 TGGGTGGGGTGGAGGGAGGATGG - Intronic
1184852378 22:47128135-47128157 TGGGTGGGGTGGAGGGAGGATGG - Intronic
1184852391 22:47128162-47128184 TGGGTGGGGTGGAGGGAGGATGG - Intronic
1185062410 22:48613938-48613960 AGCCGGGGGTGGTGGGAAGCGGG - Intronic
1185119618 22:48958139-48958161 TGGTGGGAGTGGAGAGCAGTGGG - Intergenic
1185295030 22:50048994-50049016 CAGTGTGGGTGGAGGGGAGCTGG + Intronic
1185295377 22:50050548-50050570 AGGTGGGGGAGGAGGGCAGCAGG - Intronic
1185415098 22:50705394-50705416 TGCTGGCGGTGTAGGGAAGGAGG - Intergenic
1203253768 22_KI270733v1_random:129496-129518 TGGTGGGGGAGGAGGAAGGCGGG + Intergenic
1203255435 22_KI270733v1_random:135399-135421 TGGTGGGGGTGGGGGGGGGAGGG + Intergenic
1203261824 22_KI270733v1_random:174575-174597 TGGTGGGGGAGGAGGAAGGCGGG + Intergenic
949392898 3:3582520-3582542 TGGTGAGGGTGTAGGGCACCAGG - Intergenic
949478904 3:4474562-4474584 GGGTGGGGGTGGAGGGCATGGGG + Intergenic
949646762 3:6104692-6104714 TGGTGGTGGTGGTGGAAAGTGGG + Intergenic
949649924 3:6145502-6145524 GGGTGGGGCAGGAGGGAAGTAGG - Intergenic
949811139 3:8007445-8007467 AGGTGGGGGTGGTGGGAGGCGGG + Intergenic
949863837 3:8530910-8530932 TGTGGAGTGTGGAGGGAAGCAGG - Intronic
949940935 3:9153959-9153981 TGGGAGTGGTGGGGGGAAGCTGG - Intronic
950017709 3:9765931-9765953 AGGAGAGGCTGGAGGGAAGCTGG - Exonic
950053226 3:10007632-10007654 TGGAGGGGGTGGTGGGAATGGGG + Intronic
950112276 3:10426869-10426891 GGGTGGGGGTGGGGGGAAGATGG + Intronic
950116950 3:10457053-10457075 TGGTGAGTGTGGATGTAAGCAGG + Intronic
950304878 3:11909947-11909969 TGGAGGGGGTGGTGGGAATGAGG + Intergenic
950404692 3:12797166-12797188 TGGTGGGGGCGGGGGGGAGGGGG - Intronic
950445895 3:13037846-13037868 TGCTGGGGGTGAAGGGAGGGGGG + Intronic
950546121 3:13639070-13639092 CACTGTGGGTGGAGGGAAGCAGG + Intergenic
950547248 3:13645860-13645882 TGGAGGGGGTGGGGTGAGGCAGG + Intergenic
950564900 3:13763079-13763101 TGGAGGATGTGGAGGGAAGCAGG - Intergenic
950616819 3:14166501-14166523 GGGTGGGGGTGAAGGGAGGGTGG - Intronic
950721739 3:14887797-14887819 AGGTGGGGGTGCAGTGAAGAAGG + Intronic
950751711 3:15134243-15134265 TGGTGGTGGTGGTGGGAAACTGG + Intergenic
950786864 3:15444256-15444278 TGGTGGAGGTGGCTGGAAGCAGG + Intronic
950875106 3:16264613-16264635 TAGTTGGGGTGGGGGGACGCGGG + Intronic
950905705 3:16536089-16536111 TGCTGAGGCTGCAGGGAAGCTGG - Intergenic
950958507 3:17080054-17080076 AGGTCAGGGTGGAGGGAAGGCGG + Intronic
951413970 3:22400472-22400494 TGTGGGAGGTGGAGAGAAGCCGG - Intergenic
951456940 3:22903484-22903506 TGCTGGGGGAGGAGAGAAACAGG + Intergenic
951708263 3:25565812-25565834 TGGTGGGCTTGGTGGGAAGGAGG - Intronic
951937614 3:28038910-28038932 GGGTGGGGGTGGTGGGGGGCGGG + Intergenic
952337943 3:32421054-32421076 GGGTGGGAGAGGAGGGCAGCAGG - Intronic
952346039 3:32486752-32486774 TGTTGGGGGTGGAGCCTAGCTGG + Intronic
952382437 3:32816096-32816118 TAATGGGGCTGGGGGGAAGCAGG - Intergenic
952388781 3:32862068-32862090 TTTTGGGGGAGGAGGGGAGCAGG + Intronic
952635894 3:35530282-35530304 TGGTGAGGGTGGAGGGTGGTGGG + Intergenic
952788337 3:37176925-37176947 TGGGGGGGGGGGCGGGGAGCGGG + Intronic
952835363 3:37597445-37597467 TGGTGGAGGTGAAGAGAAGAGGG + Intronic
953013104 3:39047039-39047061 GGGTGGGGGTGGGGGGATGGGGG - Intergenic
953018768 3:39100719-39100741 TCGTGGGGTTGGAGGGCTGCAGG - Intronic
953279206 3:41536435-41536457 TGGGGGGTGTGGAGGGCAGTTGG - Intronic
953389966 3:42528220-42528242 GGGTGGGGTGGGAGGGAAGAGGG - Intronic
953431777 3:42845996-42846018 GGGTGGGGGTGGAGGTAGTCTGG + Intronic
953631909 3:44625167-44625189 GGGTGGGCGTGCAGGGAAGGCGG + Intronic
953668763 3:44945105-44945127 TGGCGGGGATGGAGGGAGGCAGG + Intronic
953699341 3:45183903-45183925 GGGTTGGGGTGGAGGGCAGTGGG + Intergenic
953905425 3:46866104-46866126 AGTTGGGGGTGGAGGGAGGGAGG + Intronic
953930952 3:47005409-47005431 TGCTGTGGCTGGAGGGAAGAAGG - Intronic
953974382 3:47371376-47371398 GGGTGGGGGTGGGGGGGAGGGGG - Intergenic
953980409 3:47410521-47410543 CGGTGGGGGCACAGGGAAGCAGG - Exonic
954407689 3:50354611-50354633 TGGTGGCGGTGGTGGGGAGCTGG + Intronic
954469841 3:50683826-50683848 TGGGGGGGGGGGAGGAGAGCGGG - Intronic
954795040 3:53157044-53157066 TGGGGGCGGTGGAGGAGAGCTGG + Intronic
954800021 3:53181628-53181650 TGGTGGTGGTGCAGGGTAGTGGG + Intronic
954840784 3:53509574-53509596 AGGTGAGGCTGGAGGGAATCAGG + Intronic
954947679 3:54440632-54440654 TGTTGTGGGCGGAGGGGAGCAGG - Intronic
955650678 3:61190931-61190953 TGGGGTGGGGGGAGGGAAGAGGG + Intronic
955893402 3:63674184-63674206 TGGTGGTGGAGGAGGGAAAGGGG + Intronic
956260153 3:67330282-67330304 CTGTGAGGGTCGAGGGAAGCAGG - Intergenic
956517103 3:70061584-70061606 TGGTGGGGATTGAGGCAAACTGG - Intergenic
956750342 3:72339946-72339968 GGGTGAGGGGGGAGGGGAGCTGG + Intergenic
956778713 3:72587711-72587733 TGGAGGGAGCAGAGGGAAGCAGG + Intergenic
956831858 3:73058785-73058807 AGGTGGGGGGGGAGGGAGGGGGG - Intronic
957068897 3:75550062-75550084 TGGTGGTGGTGGTGGGAAAATGG - Intergenic
957084466 3:75667730-75667752 AGGTGGGGGGGGAGGGAGGAAGG + Intergenic
958112822 3:89172032-89172054 TGGTGGGGGAGTAGAGAAGAAGG - Intronic
959055327 3:101562036-101562058 TGTTGGGGGTGGGAGGACGCCGG + Intronic
959160019 3:102711906-102711928 TGGTGGTGGTGGTGGGCAGAAGG + Intergenic
959424259 3:106166773-106166795 TGGTGGGGGTGCAGTGAAAATGG + Intergenic
959539644 3:107524138-107524160 GGGTGGTGGTGGAGGGGAGGAGG + Intronic
959781119 3:110234295-110234317 GGGGGTGGGTGGAGGGAAGGGGG + Intergenic
959886377 3:111506472-111506494 TGGTGGTGGAAGTGGGAAGCAGG - Intronic
959900622 3:111657500-111657522 GGGTGGGGGTGGTGGGAACAAGG + Intronic
959903455 3:111685015-111685037 TAGAGGTGGTGGAAGGAAGCAGG + Intronic
960384619 3:117007163-117007185 TTGTGGGGGTGGAGGGAGGGAGG - Intronic
960573273 3:119206016-119206038 AGGGGGGGGGGGAGGGAGGCGGG - Intergenic
960715032 3:120566709-120566731 AGGAGCGGGAGGAGGGAAGCAGG - Intergenic
960846223 3:122006640-122006662 TGGTGGGGGTGAGGGGAGGCGGG + Intronic
961007915 3:123417219-123417241 TGGTGGGGTAGGGGGGAACCTGG - Intronic
961284512 3:125790265-125790287 CGGTGGTGGTGGTGGGAAACTGG + Intergenic
961291437 3:125849807-125849829 TAGTGGGGGTGGAGCCAAGATGG + Intergenic
961316172 3:126037221-126037243 TGGTGGAGGCGAAGGGGAGCAGG - Intronic
961384651 3:126516676-126516698 GTGTGGGGGTGGAGGGGAGTTGG - Intronic
961498652 3:127314984-127315006 TGGTGGAAGAGGAGGGGAGCTGG + Intergenic
961631916 3:128307354-128307376 TGTTGGGGGTGGAGATTAGCAGG + Intronic
961640309 3:128360728-128360750 GGGTGGGAGTGGAGGGAGGAGGG + Intronic
961747639 3:129075474-129075496 TGTTGGAGGTGAAGGGGAGCTGG + Intergenic
961851652 3:129825529-129825551 TGGTGGGGGTGGGTGGTAGGGGG + Intronic
962077368 3:132096844-132096866 AGGTGGAGGTGGAGGGAGGGTGG + Intronic
962255970 3:133870486-133870508 TGGTGGGGCTGGAGAGAATGGGG + Intronic
962630356 3:137269560-137269582 TGATGGGGGTGGAGGGAGGCAGG + Intergenic
962707659 3:138061172-138061194 TGGTGGTGGAGTAGGGTAGCTGG - Intergenic
962758104 3:138483725-138483747 GGGTGAGGGTGGAGGGGAGGTGG - Intergenic
964025253 3:152065652-152065674 TGGCGAGGCTGCAGGGAAGCAGG - Intergenic
964147996 3:153489354-153489376 TTGTAGAGGTGGAGGGAAGAAGG - Intronic
964463632 3:156966139-156966161 TGATGGGGGTGGAGCCAAGATGG + Intronic
964485964 3:157185667-157185689 TGGTGGGGGTGGAAGGAGGGAGG - Intergenic
964643238 3:158931812-158931834 GGGTGGGGGTGGGGGCATGCAGG + Intergenic
964720531 3:159764376-159764398 TGGGGCGGGTGGCGGGAGGCTGG + Intronic
965179537 3:165384191-165384213 TGGTGGGAGTGGTGGGAGGTTGG + Intergenic
965519099 3:169655197-169655219 TGGCGGGGATGGTGGGAAACTGG - Intronic
965528595 3:169747818-169747840 TAGGGGTGGTGGAGGGAAGGGGG - Intergenic
966026294 3:175286973-175286995 TGGTGGGGGTGGAGGGGTGTGGG + Intronic
966906988 3:184533450-184533472 TGGTGGTGATGGTGGGAACCTGG + Intronic
966948161 3:184792266-184792288 TGGTGGGGGTTGAGGCCAGCTGG - Intergenic
967171979 3:186828767-186828789 GGGTGGGGGTGGGGGGCAGGGGG + Intergenic
967253971 3:187571039-187571061 TGCTGGGGGTGAAGGGCAGTAGG - Intergenic
967590313 3:191266073-191266095 AGGTGGCGGTGGAGGGGATCAGG - Intergenic
967651076 3:191987994-191988016 AGGTGGGGGTGGAGGGAGTAGGG - Intergenic
967773470 3:193359827-193359849 TGGTGGTGGTGCAGGGGGGCTGG + Intronic
967857705 3:194130868-194130890 AGGTGGGGGTGCTGGGAAGGGGG - Intergenic
967906727 3:194507699-194507721 TGGTGGGCGAGGAGTGAACCTGG - Intergenic
967911824 3:194548762-194548784 TGGGGAGGGAGGAGGGAGGCAGG + Intergenic
967966255 3:194962307-194962329 AGCTGGGGGTGCAGGGAGGCGGG - Intergenic
968087074 3:195878650-195878672 TGGATGGGCTGGAGGGAAGGCGG - Intronic
968292671 3:197550740-197550762 GGGTGGAGGTGGAGGGAGGGAGG + Intronic
968443803 4:638090-638112 TGGTGAGGGTGCAGAGCAGCAGG - Intronic
968545048 4:1194172-1194194 GGCTGGGGGTGGAGGGAGGCCGG - Intronic
968642443 4:1721375-1721397 GGGTGGGGGGGGAGGGAGGGCGG + Intergenic
968807948 4:2787373-2787395 TGGTGGGGGTGGGGGGTGACAGG + Intergenic
968887335 4:3341625-3341647 TGGTGTGGGGGGAGGGAGGGTGG + Intronic
968887394 4:3341770-3341792 TGGTGTGGGGGGAGGGAGGGTGG + Intronic
969005858 4:4019685-4019707 TAGTGGGGGTGGAGCCAAGATGG - Intergenic
969013231 4:4084599-4084621 TGGTGGTGGTGGTGGTAAACTGG - Intergenic
969194958 4:5553540-5553562 TGGCTGGGGTGGAGGTAGGCAGG + Intronic
969278048 4:6150278-6150300 AGGTTGGGTGGGAGGGAAGCTGG - Intronic
969370405 4:6727826-6727848 GGGTGGGGGAGGAGGGGAGGGGG - Intergenic
969370417 4:6727846-6727868 GGGTGGGGGAGGAGGGGAGGGGG - Intergenic
969436982 4:7194008-7194030 TTGTGGGGGTGGGGGGAAGTGGG - Intronic
969449089 4:7262845-7262867 TGGTGAAGGTGGAGGGACTCAGG + Intronic
969522166 4:7684810-7684832 TGGTGGTGGTGGTGGGGAGGGGG - Intronic
969747034 4:9080575-9080597 TAGTGGGGGTGGAGCCAAGATGG + Intergenic
969799958 4:9556029-9556051 TGGTGGTGGTGGTGGGAAACTGG + Intergenic
969807091 4:9617605-9617627 TAGTGGGGGTGGAGCCAAGATGG + Intergenic
970411174 4:15809252-15809274 GGGAGGTGGTGGAGGGAATCAGG + Intronic
970558451 4:17259269-17259291 TTGTGGGGGTGGGGGGAGGGGGG - Intergenic
970612508 4:17738922-17738944 TGGTGGAGGCTGAGGGGAGCTGG - Intronic
970776452 4:19680036-19680058 TGTTGGGGGTGGGGGGAAGGGGG - Intergenic
971268406 4:25114663-25114685 AGGTGGGGGTGGTGGCAAGCAGG - Intergenic
971429267 4:26547079-26547101 TGGTGGAGGTAGAGAGAAGGAGG - Intergenic
971438731 4:26656002-26656024 TGGAGGGGGTGGAGCCAAGATGG - Intronic
971932807 4:33106989-33107011 TGGAGGGGCTGTAGGGAAGGTGG - Intergenic
972351685 4:38242155-38242177 GGCTGGGGGTGGAGTGAAGTAGG - Intergenic
972557218 4:40193522-40193544 GGGTGGGGGAGGAGGGGAGTGGG + Intronic
973317796 4:48779922-48779944 TGGTGGGCGCCGAGGGAAGGCGG - Intronic
973818848 4:54644646-54644668 TAGTGGGGGAGGTGGGAGGCTGG + Intergenic
973869592 4:55152284-55152306 TGGTGGGATGGGAGGGAAGAGGG - Intergenic
973892530 4:55381741-55381763 TGGTGATGGTGGCGGGCAGCAGG + Intergenic
974142762 4:57908701-57908723 AAGTGGGGATGGAGAGAAGCAGG + Intergenic
975139080 4:70902248-70902270 AGGTGGGGGCGGCGGGGAGCTGG + Intergenic
975160738 4:71121206-71121228 AGGGGAGGGGGGAGGGAAGCGGG - Intergenic
975656133 4:76642800-76642822 GGGTGGGGGAGGAGGGTAGTGGG + Intronic
975841585 4:78480206-78480228 TGGTGGTGGAGGGGGGAAGTGGG - Intronic
975985402 4:80197560-80197582 TTGGGGGGGTGGAGGGAGGGAGG - Intronic
975999105 4:80350778-80350800 TGTTGGGGGTGGAGGGAAAGGGG + Intronic
976009607 4:80471574-80471596 GGGTGGGGGTGGGGGGGAGCAGG + Intronic
976142233 4:82004252-82004274 TGGTGTTCGTCGAGGGAAGCAGG + Intronic
976410313 4:84705921-84705943 GGGCGGGGGTGGAGGGAGGGAGG - Intronic
976433769 4:84993228-84993250 TGGTGTGGGGGGAGGGGAGAGGG + Intergenic
977209644 4:94204817-94204839 TGGTGGGGGTGGGGGGAGGCGGG - Intergenic
977526415 4:98151615-98151637 TGGTGGATGTGGAGGGGAGGGGG + Intergenic
977555910 4:98487151-98487173 AGGGGGGGATGGAGGGAAGGAGG + Intronic
977592623 4:98843111-98843133 TGGTGGGGGCGGGGGGAAAAAGG - Intergenic
978285573 4:107073405-107073427 TGGTAGGGGTGGGGGGGAGGGGG - Intronic
978285587 4:107073430-107073452 TGGTGGGGGTGGGGGGGAGGGGG - Intronic
978413107 4:108446761-108446783 TGGTAGGTGGGGAGGGGAGCAGG - Intergenic
978459913 4:108940406-108940428 TGGAGTGGGTTGAGGGAAGTGGG - Intronic
979171620 4:117607687-117607709 TGGGGTGGGTGGAGGGGAGAGGG - Intergenic
979181956 4:117740985-117741007 TGGTGGGGTGGGAGGGCATCAGG + Intergenic
979289586 4:118965275-118965297 TGGTTGGGGTGGGGGGGTGCTGG - Intronic
979473715 4:121130291-121130313 TGGTGTGGGTAGAGGGACACAGG + Intergenic
979518479 4:121638834-121638856 TGGTGGGGGTGGGGGAAAACTGG - Intergenic
979701573 4:123674091-123674113 TGGTGTGAGTGGAGGGGAGGAGG - Intergenic
980094848 4:128478972-128478994 TGGAGTGGGTGGAGGGAAGTAGG - Intergenic
980280574 4:130714289-130714311 TGGAGGGGGTGGGGGGAGGTAGG - Intergenic
980281208 4:130722651-130722673 TAGTGCAGGTGGAGGGAAGAGGG - Intergenic
980364057 4:131776501-131776523 TGTTGGGGGTGGAGGGCAAGGGG - Intergenic
981342496 4:143637906-143637928 TGGTGGGTGGGGAGAGAAGAAGG + Intronic
981351238 4:143732098-143732120 TGGTGGAGGTGGAGGGGAGCAGG - Intergenic
981490077 4:145330176-145330198 TGGTGAGGTTGTAGGGAAGCTGG + Intergenic
981546870 4:145902765-145902787 TGCTGGGCGTGGTGGGAAGGCGG + Exonic
981616122 4:146646804-146646826 TGGTGGGAGTGGAGGGAGAGAGG - Intergenic
982199148 4:152943224-152943246 TGGTGGGGGTGGAGGAGGGGAGG - Exonic
982435915 4:155383440-155383462 GGGTGGAGGTGGTGGGAGGCGGG - Intergenic
982852199 4:160332722-160332744 AGGTGGGGGTGAAGAGAAGTTGG - Intergenic
983058618 4:163129056-163129078 TGGTGGGGGTGGAGGGCGGAGGG + Exonic
983409184 4:167375299-167375321 GGGTGGGGGTGTGTGGAAGCGGG - Intergenic
983444930 4:167837917-167837939 TGGTGAGGATGCAGGGAAACTGG - Intergenic
983471391 4:168160210-168160232 TGTTGGGGGCGGGGGCAAGCAGG - Intronic
984401583 4:179272303-179272325 TGGTGGGGAGGCAGGGAGGCAGG + Intergenic
984567004 4:181343132-181343154 TGGTGGGGGTGGGGGGGTGCGGG - Intergenic
984615583 4:181893489-181893511 TGGTGGGGGTGGGGGGGGGGTGG - Intergenic
984701294 4:182820321-182820343 TGGTGGTGGTGGATGGACCCTGG - Intergenic
985043381 4:185915696-185915718 TGCTGGGGGTGGGGGGCAGAAGG - Intronic
985374955 4:189325273-189325295 TGGTGGGGGTGTAGAGAAAAGGG - Intergenic
985675669 5:1230154-1230176 TGGTCGTGGGGGAGGGAAGAGGG + Intronic
985746878 5:1652867-1652889 TGGTGGGGGCCCAAGGAAGCAGG - Intergenic
985747372 5:1654932-1654954 TGGTGGGGGTGGGGCCAAGCTGG - Intergenic
985850304 5:2383755-2383777 TGGTGGGTGTGGGGAGGAGCAGG - Intergenic
985913490 5:2900681-2900703 AGGTTGGGGTGGGGAGAAGCTGG - Intergenic
985997880 5:3606716-3606738 TGGCGGGGGTGGAGGGAGACCGG + Intergenic
986009049 5:3695443-3695465 TGGGGGAGGTGGAGGGAAGAAGG - Intergenic
986016204 5:3759464-3759486 GGGTTGGGGTGAAGGGGAGCTGG + Intergenic
986028222 5:3871025-3871047 GGGTGAGGGTGGTGGGAAGCTGG + Intergenic
986170007 5:5307473-5307495 AGATGGAGGTGGAAGGAAGCAGG + Intronic
986449228 5:7849946-7849968 TGGAGGGGGTCGCGGGAAGCCGG - Intronic
987269841 5:16295476-16295498 TGGTAGGGGTAGAGAGAAGGTGG + Intergenic
987373909 5:17217452-17217474 TGGAGGGGGTGGAGGGGAGACGG + Intronic
988081986 5:26426462-26426484 TTGTGGGGGTGGGGGGGAGGGGG + Intergenic
988548174 5:32176658-32176680 GGCTGGGGGTGGAGGGCAGCTGG - Intergenic
988548192 5:32176689-32176711 GGGTGGGGGTGGAGGGCAGCTGG + Intergenic
988740346 5:34063518-34063540 TGGGGGGGCTGGGGGGAAGCTGG + Intronic
989658866 5:43776696-43776718 TAGCTGGGGTGGAGGGAAACTGG - Intergenic
990000183 5:50883365-50883387 AGGTTGGGGTGGAGGGTAGGGGG + Intergenic
990208048 5:53451286-53451308 GGGTGGGGGGAGAGGGCAGCTGG - Intergenic
990501587 5:56401751-56401773 TGATGGGGGCGGCGGGAAGCAGG + Intergenic
990512509 5:56501433-56501455 TGGTGTGATTGGAGGGAATCTGG - Intergenic
990691406 5:58368244-58368266 GGGTGGGGGTGGGGCAAAGCTGG + Intergenic
990940212 5:61195036-61195058 TGGTGGGGGTGGAGAGCATCAGG - Intergenic
991474412 5:67004260-67004282 TGGTGGGGGGTGGGGGATGCAGG + Intronic
991596324 5:68310333-68310355 TGCTGGGGGTGGGGGGATGGGGG + Intergenic
992081025 5:73234312-73234334 TGATGGGGGAGGAGGGATGAAGG - Intergenic
992187676 5:74259874-74259896 TGGAGGTGGAGGAGGGCAGCAGG - Intergenic
992215426 5:74520202-74520224 GGGTGGGGGTGGGGGGCAGGAGG + Intergenic
992280873 5:75175744-75175766 TGGTTGGGGTGGAGCCAAGATGG + Intronic
992590088 5:78285847-78285869 TGGTGGTAGTGGAGAGAAGTGGG - Intronic
992691053 5:79240308-79240330 TGGAGGGGGCGGGGGGAGGCTGG - Intronic
992848100 5:80774821-80774843 TAGTGGGGGTGGAGGGGATGAGG + Intronic
992882890 5:81128128-81128150 TGGTGGGGAGGAAGGGAAGCGGG + Intronic
992970290 5:82049395-82049417 TTGTGGGGGTGGGGGGAGGGGGG + Intronic
993398033 5:87414920-87414942 AGGTGTGGGTGGAGGGTAGAAGG - Intergenic
993492645 5:88570563-88570585 AGATGGGTGTGGAGAGAAGCTGG + Intergenic
994660918 5:102653427-102653449 TGGTGGGGATTGGGGTAAGCCGG - Intergenic
996408926 5:123135586-123135608 TGCAGGGGGTGGAGGGAGGGTGG - Intronic
996923353 5:128794781-128794803 GGTTGGGGGTGGAGGGAGGGGGG - Intronic
997013275 5:129904177-129904199 AGCTGGGGGAGGAGGGAAGAGGG + Intergenic
997202158 5:132017302-132017324 TGGTGAGGGGGGTGGGAATCAGG + Intergenic
997368135 5:133338873-133338895 TGGTAGGAGTGGTGGGAAACTGG - Intronic
998043385 5:138967787-138967809 TGTTGGGGGCGGGGGAAAGCAGG - Intronic
998077221 5:139246584-139246606 TGGCGGGGGTGGGGGGAGGAAGG - Intronic
998143450 5:139712269-139712291 TGGCGGGGGTCGGGGGAGGCGGG + Intergenic
998350657 5:141498489-141498511 TGGTGGGGAGGGAGTGAGGCAGG - Intronic
998395712 5:141816619-141816641 GGGAAGGGGTGGATGGAAGCTGG - Intergenic
998531738 5:142891218-142891240 GGGTGGTGGTGGTGAGAAGCAGG + Intronic
998570193 5:143250217-143250239 TGGTTGGGGTGGAGGCCAGCAGG - Intergenic
998636260 5:143958268-143958290 TGATGGGGTTGGAGAGAAGGGGG + Intergenic
998735569 5:145136089-145136111 TGGAGAGGGTAGAGGGAAGGAGG - Intergenic
999053169 5:148545742-148545764 GGAAGGGGGTGAAGGGAAGCTGG + Intronic
999233795 5:150078526-150078548 TGGGGGGCTTGGAGGGAGGCAGG - Intronic
999242896 5:150137743-150137765 GGGTGGGGGTGGGGGGAGCCTGG - Intronic
999282347 5:150374048-150374070 TGGGGAGTGGGGAGGGAAGCAGG + Intronic
999306130 5:150520936-150520958 TTCTGGGGGTGCAGGGCAGCAGG - Exonic
999514858 5:152290882-152290904 TGGTGGGGGTGGGGGGCAAGAGG - Intergenic
999575969 5:152977591-152977613 TGGTTGGGGTTGAGGGGAGCAGG + Intergenic
1000304423 5:159982769-159982791 TGTTGCGGAGGGAGGGAAGCAGG - Intergenic
1000305665 5:159992139-159992161 GGTTGGGGGTGGAGGGATGATGG + Intergenic
1000349369 5:160341191-160341213 GGGTAGGGGTGGAAGGTAGCAGG - Intronic
1000383204 5:160647480-160647502 TGCTGGGGGCTGAGTGAAGCTGG + Intronic
1000455179 5:161439820-161439842 TGGTGGGGGTAGGGGGAGGGAGG + Intronic
1000585088 5:163087398-163087420 TGGGGTGGGGGGAGGGAAGAGGG + Intergenic
1000821969 5:165996011-165996033 TGATGGGGTTGGGGGGAAGGAGG + Intergenic
1000951462 5:167488651-167488673 TGGTGGGGGTAGAAGGGGGCGGG - Intronic
1000990151 5:167903529-167903551 GGGTGGGGGTGGAGGGTGGAAGG + Intronic
1001085844 5:168699510-168699532 TGCTGGGGAAGGTGGGAAGCAGG + Intronic
1001157235 5:169283320-169283342 TGGCGGGGTGGGAGGGAAGCAGG + Intronic
1001584374 5:172823443-172823465 TGTTGGGGATGGTGGGAATCAGG - Intergenic
1001682490 5:173569267-173569289 GGGAGGGGGTAGAGGGAAGAAGG + Intergenic
1001944651 5:175768740-175768762 TGGTGAGGGTGCAGTGAAACTGG + Intergenic
1002064755 5:176646515-176646537 AAGTGGAGGTGGAGGGATGCTGG + Exonic
1002169118 5:177365718-177365740 GGCTGGGGGAGGAGGGAACCAGG + Intronic
1002183432 5:177442982-177443004 AGGTGGGCCTGGAGGGAAGCAGG + Intergenic
1002190749 5:177476201-177476223 AGGTGGGGGTGGAGGGAGGAGGG - Intergenic
1002278131 5:178116143-178116165 TGGTGGGGGAGGAGGGAGGGAGG - Intronic
1002323752 5:178391587-178391609 TGGTGAGGATGGGGGGAAACTGG + Intronic
1002466857 5:179412461-179412483 CGGTGGGGGGGGAGGGAGGAAGG - Intergenic
1002466948 5:179412670-179412692 TGGTGGGGGGGGAGGGTGGAAGG - Intergenic
1002613699 5:180437315-180437337 TGATGGGGGTGGGGACAAGCTGG - Intergenic
1002846369 6:948689-948711 TGGTGGTGCTGGAGGGAATTAGG + Intergenic
1002897786 6:1389498-1389520 GGGTGGGGGGGGAGGGAGGGAGG + Intergenic
1002971759 6:2030056-2030078 GGTTGGAGGAGGAGGGAAGCGGG + Intronic
1003098527 6:3159742-3159764 GGGTGGGGGTGGGGAGAAGGTGG - Intergenic
1003286051 6:4734681-4734703 GGATGGGGATGGAGGGAAGATGG + Intronic
1003577593 6:7312627-7312649 GGCTGGGGGTGGAGCGGAGCCGG + Intronic
1003778363 6:9394936-9394958 TGTAGGGGGTGGAGGTCAGCAGG + Intergenic
1004061717 6:12204400-12204422 AGATGAGGGTTGAGGGAAGCGGG - Intergenic
1004194167 6:13488576-13488598 TGGTGGAGGTGGGGGCAAGCTGG - Intergenic
1004351359 6:14893071-14893093 GGTTGGGGATGGAGGGAAGGAGG + Intergenic
1004516745 6:16327490-16327512 TGGTGGGGGTGGAGGTGGACGGG + Exonic
1004911244 6:20287181-20287203 TGGTGGGGATGGATAGAAACTGG + Intergenic
1004924299 6:20403200-20403222 TGGGGGAGGTGGAGGGGAGTCGG + Intronic
1004964177 6:20828853-20828875 TGGTGGGGCTGCAGGGAATGGGG - Intronic
1005005717 6:21285555-21285577 GGCTGGGGATGGAAGGAAGCAGG - Intergenic
1005379417 6:25218242-25218264 GGGTGGGGGTGGTGGGGAGCAGG - Intergenic
1005602687 6:27443778-27443800 AAGTGGGGGTGGAGGGAGGTGGG - Intergenic
1005635991 6:27753526-27753548 AGGTGGGGGTGGAGGGAAAGGGG - Intergenic
1005852493 6:29832011-29832033 TGGTGTGGGAGGAGGGAGGGAGG + Intergenic
1005865091 6:29931369-29931391 TGGTGTGGGGGGAGGGAGGGAGG + Intergenic
1006021667 6:31121164-31121186 TGGCGGGGGTGGGGGGGTGCTGG + Intronic
1006051452 6:31348058-31348080 TGGAGGTGGTGGAGGGCAGAGGG - Intronic
1006293232 6:33157005-33157027 TGGTGGAGGTGGAGGGGTGTTGG - Intergenic
1006301122 6:33193883-33193905 TAGGGGGGGCGGCGGGAAGCTGG + Exonic
1006318282 6:33304027-33304049 TGGTAGAGGTGGAGGGCAGAGGG + Intronic
1006332645 6:33403426-33403448 TGATGGAGGTGGAGGGACACTGG + Intronic
1006367067 6:33621949-33621971 TGGAGGGGGCGGAGGGACGGAGG + Intronic
1006370641 6:33641685-33641707 TGGTGTGGTTGCAGGGAAGTGGG - Intronic
1006373587 6:33659672-33659694 CTGTGGAGGTGGAGGGAGGCTGG - Intronic
1006405545 6:33842763-33842785 AGCTGGGGGTGGAGAGAGGCGGG + Intergenic
1006412852 6:33885388-33885410 TGGTGGAGTAGGAGGGAAGAGGG - Intergenic
1006448171 6:34091431-34091453 GGGTGAGGGTGGAGGGCCGCGGG - Intronic
1006739611 6:36297970-36297992 TGGCGGGGGGTGAGGGAAGGTGG - Intronic
1006804169 6:36777746-36777768 TGGTGGGGGGGGGGGTAGGCAGG - Intronic
1006829556 6:36960646-36960668 GGGTGGGGGTAGAGGGAGGGGGG - Intronic
1006848910 6:37083312-37083334 TGGAGAGGGTGAAGGGAACCAGG - Intergenic
1006898719 6:37486566-37486588 TGGTGGGGCTGCAGGGCAGGGGG - Intronic
1006908084 6:37546278-37546300 TGGTGAGGGGGAAGGGAAGAGGG - Intergenic
1006945051 6:37779320-37779342 GGGTGGAGGGGGAGGGAAGAAGG + Intergenic
1007022588 6:38536825-38536847 TGCTGGGGGTGGAGGAAAGTGGG + Intronic
1007155215 6:39736402-39736424 TAGTGGGGGTGGAGCCAAGATGG + Intergenic
1007247368 6:40472192-40472214 TGAAGGGGCTGGAGGGAAGGTGG - Intronic
1007350106 6:41266278-41266300 TGGTGAGAGTGGAGGAAAGGGGG + Intergenic
1007449446 6:41931838-41931860 TGCTGGGGGTGGAAGGGGGCTGG + Intronic
1007511874 6:42380225-42380247 GGGTGGGGGTGGTGGGAGCCAGG + Intronic
1007742552 6:44021749-44021771 TGGTGCTGGGGGAGGGAAGGGGG - Intergenic
1007743123 6:44024968-44024990 TGGTGCTGGGGGAGGGAAGGGGG - Intergenic
1007745689 6:44041714-44041736 CGCTGGGGGTGGAGGGAGGTGGG - Intergenic
1008583433 6:52927178-52927200 GGTTGGGGGAGGAGGGCAGCAGG - Intergenic
1008957640 6:57233584-57233606 GGGAGGGGGAGGAGGGAAGGAGG - Intergenic
1009498021 6:64374416-64374438 TGGGGTGGGTGCAGGGGAGCTGG + Intronic
1009602627 6:65821854-65821876 TAGTGGGAGTGGGGGGAAGTGGG + Intergenic
1009928800 6:70151663-70151685 GGGCAGGGGTGGAGGGCAGCTGG + Intronic
1010434183 6:75811102-75811124 TGGTGGGGGTGGTGGGGATTGGG + Intronic
1010599396 6:77804584-77804606 TGGGGAGGGTGGAGGCAAGATGG - Intronic
1010726410 6:79338857-79338879 TTGTGGGGGTGGGGGGGGGCGGG - Intergenic
1010941649 6:81926136-81926158 TGGTGGAGGTGGAGGGTTCCAGG + Intergenic
1011007277 6:82660266-82660288 TGATAGTGGTAGAGGGAAGCAGG + Intergenic
1011223089 6:85078385-85078407 TGGTGGTGGTGTAGGAAATCTGG - Intergenic
1011226171 6:85109826-85109848 TGATTTGGGTGGATGGAAGCTGG - Intergenic
1011276798 6:85639811-85639833 TGATGGAAGTGGAGGGCAGCAGG + Intronic
1011640289 6:89411730-89411752 TGGAGGGGGTCCAGGGGAGCGGG - Intronic
1011704349 6:89985952-89985974 GTGTGGGGCTGGAGGGATGCGGG + Intronic
1011785783 6:90843112-90843134 GGGTGGGGGTGGAGTGGAGATGG + Intergenic
1012016094 6:93853925-93853947 AGGTGGGGGCGGGGGGAGGCAGG - Intergenic
1012198389 6:96374246-96374268 TGGTGAGGATGGAGAGAATCTGG + Intergenic
1012398948 6:98828830-98828852 GGGTGGGCGGGGAGGGGAGCAGG - Intergenic
1012943928 6:105446542-105446564 TGATGGGGGAGGAGGGAGGAAGG - Intergenic
1012992635 6:105941519-105941541 TGGTTGGGGTGGATGGATGAAGG - Intergenic
1013299351 6:108789199-108789221 TGGTTGGGTTGGAGGGAAATTGG - Intergenic
1014330367 6:120056201-120056223 TGATGGGGGTTGAGGGATGGGGG - Intergenic
1015228127 6:130882211-130882233 GTGTGGGGGAGGAGGGAAGGAGG - Intronic
1015735659 6:136397496-136397518 TGGTGGGGGTGGGGGCAAGGTGG - Intronic
1015743243 6:136481629-136481651 TGGTGGGGATGGAGGGAGTAGGG + Intronic
1015795527 6:137007391-137007413 GGGTGAGGGAGGAGGAAAGCAGG + Intronic
1015938748 6:138428596-138428618 TGGTGTGGGGGGAACGAAGCCGG - Intronic
1016174462 6:141062211-141062233 AGGTGGGGGTGGGGGGAAGATGG + Intergenic
1016335324 6:142998763-142998785 TGGTGTGGGGGGAGGGAGGATGG - Intergenic
1016542052 6:145177587-145177609 TAGTGGGGGTAGAGGGAGGTGGG + Intergenic
1016711130 6:147173121-147173143 TGGTGGGGACTGTGGGAAGCTGG + Intergenic
1017380713 6:153826044-153826066 TGGAGGGGGTGGGGGGCAGATGG - Intergenic
1017622676 6:156315262-156315284 TGGTGGGGGTGGGGCTAGGCCGG - Intergenic
1017646420 6:156543537-156543559 TGGTGGGAGGGAAGGGGAGCTGG - Intergenic
1018271193 6:162079659-162079681 AGGTGGGGAAGGAGGGAAGTGGG - Intronic
1018501747 6:164418850-164418872 TGTTGGGGGTGGAGGGTAAGGGG - Intergenic
1018653747 6:166012224-166012246 TGGAGGGGCAGGTGGGAAGCAGG + Intergenic
1018674496 6:166207146-166207168 TGGTGGGTCTTCAGGGAAGCCGG - Intergenic
1019019781 6:168908674-168908696 TGGAGGTTGTGGAGGCAAGCAGG + Intergenic
1019033645 6:169035193-169035215 TGATGTGGGCGGAGGGCAGCAGG - Intergenic
1019059023 6:169242621-169242643 AGGTGGGAGTGGTGGGAAGGTGG - Intronic
1019059029 6:169242638-169242660 AGGTGGGAGTGGTGGGAAGGTGG - Intronic
1019059035 6:169242655-169242677 AGGTGGGAGTGGTGGGAAGGTGG - Intronic
1019059049 6:169242696-169242718 AGGTGGGAGTGGTGGGAAGGTGG - Intronic
1019059077 6:169242778-169242800 AGGTGGGAGTGGTGGGAAGGTGG - Intronic
1019059086 6:169242803-169242825 AGGTGGGAGTGGTGGGAAGGTGG - Intronic
1019059109 6:169242869-169242891 AGGTGGGAGTGGTGGGAAGGTGG - Intronic
1019059122 6:169242911-169242933 AGGTGGGAGTGGTGGGAAGGTGG - Intronic
1019059168 6:169243050-169243072 AGGTGGGAGTGGTGGGAAGGTGG - Intronic
1019059216 6:169243192-169243214 AGGTGGGAGTGGTGGGAAGGTGG - Intronic
1019082680 6:169445896-169445918 TGGGTGGGGTGGGGGGAGGCAGG + Intergenic
1019103571 6:169650737-169650759 TGGTGGGGATGGAGGGATGGAGG - Intronic
1019271201 7:150078-150100 TGGTGGCGGTGGAGGGGAGATGG + Intergenic
1019395862 7:817111-817133 TGGGTGGGGTGGTGGGAAGACGG + Intronic
1019523178 7:1469558-1469580 CGGCTGGGGTGGAGGGCAGCCGG + Intergenic
1019588831 7:1818863-1818885 GGGTGGGGGTGGACGGAGACAGG + Intronic
1019626553 7:2018813-2018835 TGGAGGGGGCGGAGGGAGGGAGG - Intronic
1019772385 7:2891720-2891742 GGGGAGGGGGGGAGGGAAGCGGG + Intergenic
1019772565 7:2892999-2893021 GGGTGGGGCTGGAGAGAAGCAGG + Intergenic
1020095098 7:5363874-5363896 TGTTGGAGGAGGAAGGAAGCGGG - Intronic
1020381991 7:7557217-7557239 TGGTGGTGGTGGTGGGGAGGTGG - Intergenic
1020718209 7:11705585-11705607 AGTTGGAGGTGGAGGGAAGTAGG + Intronic
1020876141 7:13696868-13696890 TGGTGGGAATGGAGAGAAACAGG - Intergenic
1020968423 7:14902521-14902543 TGGTGCGGGGGAAGGGAAGCTGG - Intronic
1021209754 7:17834043-17834065 TGATGGGGATGGAGGTAAGGTGG - Exonic
1021345158 7:19518217-19518239 TTGTGGGGTTGGGGGGAAGGGGG + Intergenic
1021403479 7:20237190-20237212 TGGTGGGGGTGGGTGGGAGGTGG + Intergenic
1021569728 7:22052596-22052618 AGGTTGGGGTGGAGGGAGGAAGG + Intergenic
1021632279 7:22659211-22659233 TTGGGGGGGTGGGGGGAAGTGGG - Intergenic
1022130949 7:27403911-27403933 TGGTGGGGTGGGAGGGAAGGTGG + Intergenic
1022207788 7:28180309-28180331 AGGTGGGGGTGGCGGGATGCGGG - Intronic
1022209332 7:28193581-28193603 GGGTGGGGGTGGGGGAAAGAGGG - Intergenic
1022339693 7:29456610-29456632 TGGTGGTGGTGGGGGGGAGGGGG - Intronic
1022363534 7:29685677-29685699 GGCTGGGGGAGGAGGGAAGGTGG - Intergenic
1022384549 7:29889097-29889119 TGGTTGGGATGGAGGGAAGCAGG - Intronic
1022420827 7:30221757-30221779 TGGTGGGGGTAGAGGGTAATGGG + Intergenic
1022427753 7:30284848-30284870 GGCTGGGGGAGGAGGGAAGGTGG + Exonic
1022697840 7:32728067-32728089 GGCTGGGGGAGGAGGGAAGGTGG + Intergenic
1022811459 7:33872882-33872904 TGTGAGAGGTGGAGGGAAGCTGG - Intergenic
1022992998 7:35726696-35726718 TGGTGGGGGTGAGGGAAAGCTGG - Intergenic
1023127462 7:36969624-36969646 TGGTGGGGGTGTGGGGTAGGAGG + Intronic
1023255801 7:38311361-38311383 TGGTGGCGGCGGAGGGACCCGGG - Intergenic
1023356229 7:39369863-39369885 TGGTGGGGGTGGTTAGAGGCAGG + Intronic
1023505874 7:40899228-40899250 TGGTGAGGAGGGAGGGAAGGAGG - Intergenic
1023586870 7:41739814-41739836 AGGAGGGGGAGGAGGGAAGGGGG + Intergenic
1023732629 7:43206629-43206651 GGGAGGTGGGGGAGGGAAGCTGG - Intronic
1023773908 7:43584674-43584696 GGGTGGGGGTGTAGGGAGGGTGG + Intronic
1023839832 7:44090471-44090493 TGGCGGGGGTGGTGGGGAGAGGG + Intergenic
1023845497 7:44117853-44117875 AGGTGGGGTTGTGGGGAAGCAGG - Intronic
1023978101 7:45047695-45047717 TGCTAGGGGTGGAGAGAAGTAGG + Intronic
1024543647 7:50499685-50499707 TGGTGGGGATGGAGTGGGGCAGG - Intronic
1024617747 7:51129772-51129794 TGCTGGGTGTGGGGAGAAGCAGG + Intronic
1025016271 7:55441227-55441249 TGGCTGGGGAGGAGGGAAGGGGG + Intronic
1025174614 7:56792101-56792123 AGGTGGGGGTGGTGACAAGCAGG + Intergenic
1025697189 7:63784312-63784334 AGGTGGGGGTGGTGACAAGCAGG - Intergenic
1025801322 7:64789218-64789240 AGGTGTGGGAGGAGGGCAGCAGG - Intergenic
1026273100 7:68853386-68853408 ATGTGGGGGTGGAGGGGAGGGGG - Intergenic
1026385197 7:69839868-69839890 TGGTGGAGGTGGAGGAGAGGGGG + Intronic
1026442791 7:70458612-70458634 TTTTTAGGGTGGAGGGAAGCGGG + Intronic
1026498396 7:70922632-70922654 TGGGGAGGGTGGAGAGAAGTTGG - Intergenic
1026612380 7:71871622-71871644 TGGTGGGAGTGGGGGCAGGCAGG - Intronic
1026843630 7:73684625-73684647 GGATGGGGGCGGGGGGAAGCTGG + Intronic
1026869572 7:73842203-73842225 TGAAGGGGGAGGAGGGAAGGGGG - Intronic
1026874892 7:73873562-73873584 TGGGGGGTGAGGAGGGAAGCAGG + Intergenic
1026944227 7:74306041-74306063 TGGTGGGGCTGGAAGGCAGCAGG - Intronic
1027047166 7:74998688-74998710 TGGTGGGGGTGAAAGGAAGTTGG + Intronic
1027419038 7:78002245-78002267 TGTTAGGGGTGAGGGGAAGCAGG + Intergenic
1027455839 7:78390633-78390655 TGGTGGGGGTGGGGGGTGGAGGG + Intronic
1028362281 7:89983764-89983786 TGGTGGGGGGAGAGGGGAGGGGG - Intergenic
1028399625 7:90410703-90410725 TTGTGGGGGTGGAAGGAGGAGGG + Intronic
1028499007 7:91497269-91497291 TTGTGGGGTTGGGGGCAAGCAGG - Intergenic
1028531264 7:91841275-91841297 TGCTGGGGATGGAGGGAGGTGGG - Intronic
1028716419 7:93976274-93976296 TGAAGGGGTTGGAGGGAAGCAGG - Intronic
1028948122 7:96603734-96603756 AGGTGGGGTTGGAGGGAGGGAGG - Intronic
1029071876 7:97906236-97906258 TGGTGGTGGTGGTGGGAAACTGG - Intergenic
1029335780 7:99898119-99898141 TGGTGGTGCTGAAGGGAAGTGGG - Intronic
1029385830 7:100242943-100242965 TGGTAGGGGTGAAAGGAAGTTGG - Intronic
1029433256 7:100546163-100546185 TGGTGGGGGTGGCGGGCGGGGGG - Intronic
1029507536 7:100971403-100971425 TGGTGAGGGGGCAGGGGAGCTGG + Intronic
1029670932 7:102030369-102030391 TGGTGGGCGGGGAGGGGAGGGGG - Intronic
1029743291 7:102503246-102503268 TGGTGGGGGTGGAGGAAGATTGG + Intronic
1029761280 7:102602407-102602429 TGGTGGGGGTGGAGGAAGATTGG + Intronic
1029850227 7:103453959-103453981 TGGTGGGGGTGGAGCCAAGACGG - Intergenic
1030334396 7:108308766-108308788 TGGTGGGAGTGGTGAGAAGGGGG + Intronic
1030594890 7:111525970-111525992 GGGTGGGGGTGGAGTGGGGCAGG - Intronic
1030990927 7:116298978-116299000 TGATAGGGCTGGAGGGAAGTGGG + Intronic
1031100499 7:117474111-117474133 TGAATGGGGTGGAGGGAAGATGG + Intronic
1031692909 7:124812930-124812952 TGGGGGGTGGGGAGGGATGCAGG - Intergenic
1031833783 7:126657788-126657810 TGGTGGGGGTGGAGTGAGTGGGG + Intronic
1031941461 7:127793797-127793819 AGGTGAGGGTGGAGGGGAGGAGG - Intronic
1031982393 7:128136206-128136228 TGGTGGGGTGGGGAGGAAGCGGG + Intergenic
1031992200 7:128205879-128205901 TGGTGGAGGGGGTGAGAAGCAGG + Intergenic
1032076483 7:128838482-128838504 GTGTGGGGGTGGGGGGAGGCTGG + Intronic
1032091853 7:128915240-128915262 GGGTGGGGGCGGAGGGGAGGGGG - Intergenic
1032096074 7:128939038-128939060 GGGTGGGGGCGGAGGGGAGGGGG + Intronic
1032503470 7:132417706-132417728 AGGTGGGGGAGGAGGGGAGAGGG + Intronic
1032560285 7:132883859-132883881 TGTTGGTGGTGGAGGAAATCAGG - Intronic
1033220610 7:139524291-139524313 GGGTGGGGTGGGAGGGAACCGGG + Intronic
1033291984 7:140093352-140093374 TTGTGGGGGAGAAGGGAAGGAGG - Intronic
1033569333 7:142612216-142612238 TGGTGGGGGTCGGGGGGAGGGGG + Intergenic
1033599694 7:142880196-142880218 TGGTGGTGATGGAGGGAATGTGG - Intronic
1033624670 7:143097206-143097228 TGTGGGGGGTGGGGGGAAGGGGG - Intergenic
1033773702 7:144582664-144582686 AGGTGCAGCTGGAGGGAAGCAGG - Intronic
1034468984 7:151245748-151245770 TGGTGGGGGAGGGGAGACGCCGG - Intronic
1034470592 7:151252345-151252367 TGCTGGGGGTGTAGGGAAAAGGG - Intronic
1034839914 7:154386294-154386316 TGGTGGGGGTGGGGGGCAGGAGG - Intronic
1034885289 7:154794213-154794235 CTGTGGGGGTGGAGGGGAGACGG + Intronic
1034918460 7:155059961-155059983 TGGTCGGGGGAGGGGGAAGCAGG - Intergenic
1034967973 7:155403264-155403286 TGGTGGGTGAGGAGGGAGCCGGG + Intergenic
1035045370 7:155962226-155962248 TGGCTTGGGTGGAGGGAATCGGG - Intergenic
1035062645 7:156080313-156080335 TTGTGGGGCTGCTGGGAAGCTGG - Intergenic
1035172449 7:157025194-157025216 TGGTGAGGGTGGAGAGAAAGAGG - Intergenic
1035265838 7:157690025-157690047 TGCTGGGGGTGGGGGGGTGCAGG - Intronic
1035389615 7:158496428-158496450 TGGAGGGGGCGCAGGGAAGGGGG - Intronic
1035389818 7:158496917-158496939 GGGAGGGGGTGCAGGGAAGGGGG - Intronic
1035533347 8:372702-372724 TGGAGGGGGTGGAGCCAAGATGG - Intergenic
1035587275 8:785862-785884 GGGTGAGGGAGGAGGGAGGCCGG - Intergenic
1036133337 8:6136542-6136564 TGGTGGTGGTGGGGGGGCGCGGG - Intergenic
1036245816 8:7115760-7115782 TGGTGGTGGTGGTGGGAAACTGG + Intergenic
1036259820 8:7230622-7230644 TGGTGGGGGTGGTGGGTAGGAGG - Intergenic
1036311863 8:7689192-7689214 TGGTGGGGGTGGTGGGTAGGAGG - Intergenic
1036561544 8:9903762-9903784 CGGAGGGGGTGGAGGGATGGGGG + Intergenic
1036614439 8:10377805-10377827 TGCTGGGTGTGGAGGCAAGTGGG + Intronic
1036633043 8:10528957-10528979 TGAGAGGGGTGGAGGGAAGCAGG - Intronic
1036699828 8:11005394-11005416 TGGAAGGGCTGGAGGGAAGTGGG + Intronic
1036703259 8:11028123-11028145 TGCCGGGGTTGGAGGGAGGCAGG - Intronic
1036888451 8:12578269-12578291 TGGTGGTGGTGGTGGGAAACTGG - Intergenic
1036999021 8:13695458-13695480 GGGTGGATGTGGAGGGATGCTGG + Intergenic
1037018345 8:13936856-13936878 TGGGTGGGGTGGAGGGAGGGGGG - Intergenic
1037313701 8:17581518-17581540 TGGTGGTGGTGGTGGGAGGTAGG + Intronic
1037856376 8:22374183-22374205 TGGTGGGGTTGGGGGGAGGTTGG + Intronic
1037939732 8:22942493-22942515 TGGTGGGGGTGGTGGGGGGTGGG - Intronic
1038307749 8:26420052-26420074 TGGTGGGCGTGGAGGGCAGGAGG - Intronic
1038447049 8:27611545-27611567 TGGTGGGGGTGGAGTGCAGGGGG - Intronic
1038482159 8:27909269-27909291 TGGTGGGGCGGGAGGGTGGCAGG + Intronic
1038935596 8:32246805-32246827 GGATGGGGGTGGAGGGAATGGGG + Intronic
1039105330 8:33983600-33983622 TGGTTGGGGTGGAGGGACTGGGG + Intergenic
1039116873 8:34101000-34101022 TGGTGGGGGTAGGGGGAGGTAGG - Intergenic
1039398162 8:37245144-37245166 TGGTGGAGATGGAGAGCAGCAGG + Intergenic
1039542128 8:38381566-38381588 TGGGGGGTGTGGAGGGAATTGGG - Intronic
1039581374 8:38669586-38669608 TGGGGGTGGTGGAGGCATGCAGG + Intergenic
1039615374 8:38951087-38951109 GGGTGGGAGTGGGGGGCAGCTGG + Intronic
1039778511 8:40760462-40760484 TGGTGAGGGTGCTGCGAAGCAGG - Intronic
1040046286 8:42967258-42967280 AGGTGTGTGTGGAGGGCAGCCGG - Intronic
1040464282 8:47679577-47679599 TGGAGGGGATGGAGGCAGGCGGG - Intronic
1040464294 8:47679620-47679642 TGGAGGGGATGGAGGCAGGCGGG - Intronic
1040661577 8:49582255-49582277 TGGTGGGGGTGGGGGGGCGGTGG - Intergenic
1040841570 8:51790682-51790704 TGGAGGCGGCGGAGGGCAGCGGG + Intronic
1040880400 8:52198923-52198945 TGGTGGGGCTGGAAGGAGGTGGG - Intronic
1041090961 8:54300301-54300323 GGGTGGGGATGGGGGGAAACCGG + Intergenic
1041128520 8:54669874-54669896 TGGTGGGGTGGGAGGGAAGGGGG + Intergenic
1041304815 8:56447513-56447535 TGGTGGGGAGGGAGGGATGAGGG + Intergenic
1041427416 8:57738410-57738432 TGGTGGGGGTGGGTGGTGGCAGG + Intergenic
1041500419 8:58533632-58533654 TGATTGGGGTGGAGGGAATGTGG - Intergenic
1041973427 8:63769212-63769234 TTGTGGTGGTGCAGGGGAGCTGG - Intergenic
1042143785 8:65706109-65706131 GGGTGGGGGTGGAGGCACTCTGG + Intronic
1042170355 8:65985300-65985322 TGGTGGGGGTGGGGGGTGGGAGG + Intergenic
1042198175 8:66252205-66252227 GGTTGGGGGTTGAGGGAGGCAGG + Intergenic
1042317123 8:67436063-67436085 TGGTGGGGGTGGGGTGCAGGAGG - Intronic
1042361979 8:67893940-67893962 TGGAGGGGGTGGAGCCAAGATGG + Intergenic
1042713718 8:71748054-71748076 TGGGGAGGGTGGAGGGAAAATGG - Intergenic
1042851960 8:73225790-73225812 TGGTGGTGGTGGAGGGCTGGGGG - Intergenic
1043171499 8:76972344-76972366 CGGTGTGGGTGGGGGGCAGCAGG + Intergenic
1043991000 8:86754526-86754548 TTGTGGGGGTGGGGGGAAAGGGG - Intergenic
1044053944 8:87544233-87544255 TAGTGTCAGTGGAGGGAAGCTGG - Intronic
1044125900 8:88457591-88457613 TGGTGGGGATGGGGGGTGGCTGG - Intergenic
1044222331 8:89683860-89683882 TGGTGGGGTTGCAGAGAAACGGG + Intergenic
1045445354 8:102256762-102256784 TGGGGGTGGTGGAGGGAAGGAGG - Intronic
1045491319 8:102671393-102671415 GGGTGGGGTGGGAGGGAACCTGG - Intergenic
1045906782 8:107355241-107355263 TGGTAGGGAGAGAGGGAAGCGGG - Intronic
1045962880 8:107989379-107989401 TGGAGGAGGTAGAGGGAAGAAGG - Intronic
1046181616 8:110656207-110656229 TGTTGGGGGTGCAGGAATGCTGG - Intergenic
1046604312 8:116353806-116353828 GGGTGGCGGTTGAGGAAAGCAGG + Intergenic
1046757647 8:117988617-117988639 TGCTGGAGGTGGAGGGAGGTGGG - Intronic
1047248872 8:123166754-123166776 TGGGTGGGGTGGAGGGAATGGGG - Intergenic
1047845500 8:128801229-128801251 GGGTGGGGGTGGAGCCAAGATGG + Intergenic
1048170833 8:132104690-132104712 AGGTGGAGGTGGTAGGAAGCAGG + Intronic
1048171622 8:132112166-132112188 TGGTGTGGGTAGAGGGAATGGGG - Intergenic
1048332483 8:133480104-133480126 GGATGGGGAAGGAGGGAAGCTGG + Intronic
1048365308 8:133733228-133733250 TGGGAGTGGTGGAGGGAAGAGGG - Intergenic
1048510179 8:135055004-135055026 CGGTGGGGCTGGGGGGAAGCTGG - Intergenic
1048520565 8:135150458-135150480 GGGTTGGGGTGGGGGGAAGGGGG - Intergenic
1048794597 8:138138182-138138204 TGGAGGAGGAGGAGGGAGGCAGG - Intronic
1049040342 8:140107955-140107977 TGGTGGGGGTGGGGTGTAGGGGG + Intronic
1049256015 8:141614352-141614374 GGCTGGGGGTGGAGGGGAGCAGG - Intergenic
1049405146 8:142449069-142449091 TGGTGGGTGTAGATGGAAGTGGG - Intergenic
1049452007 8:142666977-142666999 AGGCAGGGGTGGAGGGATGCAGG + Intronic
1049466337 8:142752741-142752763 TGGTGGCGGAGGCGGGGAGCTGG - Intergenic
1049469099 8:142767439-142767461 TGGCTGGGGTGGGGGGTAGCAGG + Intronic
1049564435 8:143330931-143330953 TGGTGCGGGGGGAGGGAGGGGGG + Intronic
1049601230 8:143508719-143508741 TGAAGGGGGTGGAGGGGGGCGGG - Intronic
1049643315 8:143725162-143725184 GGGGGGGGGGGGAGGGAAGGAGG + Exonic
1049663454 8:143831034-143831056 TGGAGGGGGTGGATGGGAGGTGG + Intergenic
1049756173 8:144312179-144312201 TGGGCGGGGGGGAGGGAGGCCGG - Exonic
1049776476 8:144408184-144408206 TGGTGGGGATGGAGGGAGGTAGG - Intronic
1049939579 9:532528-532550 TGGAGGGAGTGGAGGGAAATGGG - Intronic
1049998500 9:1052182-1052204 TGGGGGAGTTGGAGGGGAGCGGG + Intronic
1050091214 9:2017237-2017259 GGGGTGGGGTGGAGGGAAGTTGG + Intronic
1050113461 9:2240367-2240389 TGGGTGGGGTGGTGGGAAGCAGG + Intergenic
1050203700 9:3175982-3176004 TGGTGGGTTTTGAGTGAAGCAGG - Intergenic
1050260697 9:3837991-3838013 TGGAGGGGGTGGGGGGAGGAGGG + Intronic
1050552910 9:6763030-6763052 TGGTGGGGGGGGATGGATGGGGG + Intronic
1050744185 9:8857912-8857934 GGGTAGGGGTGGAGGGAGGGCGG - Intronic
1051075537 9:13230160-13230182 TGGTGAGGATGTAGAGAAGCTGG + Intronic
1051169274 9:14302741-14302763 TGGTGGTGGTGGTGGGAGTCGGG - Intronic
1051170942 9:14317007-14317029 TGGTGAGGAGGGAGGGAAGAAGG - Intronic
1051306982 9:15720830-15720852 TGGGGTGGGTGGAGGGAGGAGGG - Intronic
1051330856 9:16023834-16023856 TTGTGGGGGTGGGGGGAGGGTGG - Intronic
1051370942 9:16358503-16358525 TGGTAGGGATGGTGGGAAGTGGG + Intergenic
1051693573 9:19743866-19743888 TGGTGGGGGTGCAGGTAAGGAGG + Intronic
1051847982 9:21474367-21474389 TGGTGGGGAGGGAGGGAAGGTGG - Intergenic
1051923178 9:22291600-22291622 TGGAGAGGATTGAGGGAAGCAGG + Intergenic
1052237905 9:26234934-26234956 TGGTGTGGGTGGAGTGCCGCTGG - Intergenic
1052237911 9:26234959-26234981 TGGTGTGGGTGGAGTGCCGCTGG - Intergenic
1052395154 9:27929504-27929526 GGGTGGGGGTGGAGGGAAGGAGG + Intergenic
1052417837 9:28201222-28201244 TGGTGGGGTTGGGGGGAGGGGGG - Intronic
1052814590 9:33091401-33091423 TGTTGGGGGTGGGGGGAGGGGGG + Intergenic
1052826853 9:33182953-33182975 TGCAGGAGGTGGAGGGAAGTTGG - Intergenic
1052866697 9:33468425-33468447 TGGGGGGTGTAGAGAGAAGCAGG + Intronic
1052935513 9:34089689-34089711 TGGGGCGGGTGGAGGGGAGCAGG - Intronic
1053166876 9:35851229-35851251 TGGCGGGGGTGGGGGGCAGAAGG - Intronic
1053238829 9:36479459-36479481 ATGTGGGGGTGGAGAGAAGCAGG + Intronic
1053348084 9:37392731-37392753 TGGGGGGGGTGGGGAGAGGCGGG + Intergenic
1053434279 9:38065258-38065280 GGGTGGAGGTGGAGGGGTGCTGG + Intronic
1053628407 9:39902386-39902408 TGTTGGGGGTGGAGGGCAAGGGG - Intergenic
1053777652 9:41563941-41563963 TGTTGGGGGTGGAGGGCAAGGGG + Intergenic
1054215480 9:62348315-62348337 TGTTGGGGGTGGAGGGCAAGGGG + Intergenic
1054672001 9:67807032-67807054 TGTTGGGGGTGGAGGGCAAGGGG - Intergenic
1054734980 9:68741884-68741906 TGTTGGGGGTGGGGAGAACCAGG + Intronic
1054781924 9:69173951-69173973 TGGCGGGGGTGGAGGGGTGCAGG + Intronic
1054902375 9:70382990-70383012 TGGTGAGGATGGAGGAAAGGGGG - Intergenic
1055398841 9:75901466-75901488 TGTTGGGGGTGGCGGGAAAAGGG + Intronic
1055587087 9:77766634-77766656 TGGTGGGGGTGTAGGGTGGGAGG + Intronic
1056102068 9:83309186-83309208 TTGTGGGGGTGGGGGGAGGAGGG + Intronic
1056201157 9:84278025-84278047 TGGTGGGGAGGGAGGGGAGGAGG + Exonic
1056461659 9:86814808-86814830 TGGTCGGGGTGAAGGGGGGCGGG + Intergenic
1056531179 9:87489232-87489254 AGGAGGGGGTGGAGTGAAGGTGG + Intergenic
1056628540 9:88274032-88274054 GGGTGGGGATGGAGGGAGGCTGG + Intergenic
1057023644 9:91719502-91719524 TGCTAGGGGTGGAGGGAACTTGG - Intronic
1057151524 9:92800123-92800145 TGGTGGGGGGCAAGGGAAGGGGG + Intergenic
1057222274 9:93263762-93263784 TGGTGGGGGTGGGGGCATGGTGG + Intronic
1057314319 9:93958889-93958911 GGGTGTGGGTGGAGGGGAGGTGG - Intergenic
1057398929 9:94705156-94705178 TAGTGGGAGGGGAGGGAAGTAGG - Intergenic
1057689548 9:97271438-97271460 TGGGGGGTGGGGAGGGGAGCCGG - Intergenic
1057743213 9:97730447-97730469 TGGTGGGTGTGCAGGGATCCTGG - Intergenic
1057778798 9:98033430-98033452 GGGTGGGGCTGGAGGGAAGTGGG + Intergenic
1057791399 9:98127364-98127386 TTGTGGGGGTGGAAGGGAGAGGG + Intronic
1057831931 9:98413771-98413793 TGTGTGCGGTGGAGGGAAGCGGG + Intronic
1057959144 9:99438124-99438146 GGGAGGGGGTGAAGGGAGGCTGG - Intergenic
1058012584 9:99994497-99994519 TGGTGTGGGGTGAGGGGAGCGGG + Intronic
1058035976 9:100253560-100253582 TGGTGTGGGATGGGGGAAGCAGG - Intronic
1058093553 9:100833029-100833051 TGTTGTGGGTGGGGGGAAGGAGG + Intergenic
1058177605 9:101755585-101755607 CTGTTGGGGTTGAGGGAAGCAGG + Intergenic
1058282413 9:103131905-103131927 TGCTTGGGGTGCAGGGAAGGTGG + Intergenic
1058381732 9:104384296-104384318 AGGTGTGGTTGGAGGGAGGCAGG - Intergenic
1058606412 9:106728207-106728229 TGTTGGTGGAGGAGGGAGGCTGG + Intergenic
1058875158 9:109237794-109237816 TGGTGATGGTGGAGGGAACATGG + Intronic
1059008939 9:110435467-110435489 AGATGGGGGTGGAGGGAAGCAGG + Intronic
1059359300 9:113727887-113727909 TGGTGGGGGTGGGGGTGAGTTGG + Intergenic
1059974585 9:119701973-119701995 GGGTGGTGGTGGAGGGAATTGGG + Intergenic
1060228406 9:121809853-121809875 TGGTGGGGGAGGGAGGAGGCTGG + Intergenic
1060298145 9:122356838-122356860 TGGAGGGGATGAAGGGACGCAGG + Intergenic
1060319891 9:122548739-122548761 GGGTGGGGGTAGAGGGGAGGGGG - Intergenic
1060508894 9:124218068-124218090 TTGTGGGAGTGGCGGGTAGCAGG - Intergenic
1060736455 9:126069560-126069582 AGCTGGGGGCGGAGGGGAGCCGG - Intergenic
1060786766 9:126457224-126457246 TGTTGGTGATGGAGGGAAGAAGG - Intronic
1060967976 9:127722223-127722245 AGGTGTGGGTGGAGGGAGGGAGG - Intronic
1061186724 9:129059295-129059317 GGGTGGGCGTGGAGGGTGGCAGG + Intronic
1061223266 9:129264811-129264833 TGGTGGGGGTGGTGGGGAGTTGG + Intergenic
1061403435 9:130381039-130381061 TGGTAGGGTTGGAGGTAAGTGGG - Intronic
1061450655 9:130665307-130665329 GGGAGGGGGTGGAGGGAGGGCGG + Intronic
1061484336 9:130912724-130912746 TCGGTGGGGTGGAGGAAAGCCGG + Intronic
1061489680 9:130938278-130938300 TGCTGGGGGTGCGGGGACGCGGG + Intronic
1061911049 9:133724518-133724540 TGGTGAGGATGGAGGGGAGCTGG + Intronic
1061921266 9:133783765-133783787 TGGTGGAGGTAGGGGAAAGCAGG - Intronic
1062016784 9:134295020-134295042 AGGTGGGGGTGGTGGGGGGCAGG + Intergenic
1062016907 9:134295672-134295694 TGGTGGAGATAGAGGGGAGCTGG - Intergenic
1062036606 9:134385321-134385343 TTGTGTGGCTGGAGGGAGGCTGG + Intronic
1062254546 9:135614817-135614839 TGGTGGGAGTGCAGGGATGGAGG + Intergenic
1062327055 9:136017504-136017526 TGGTGGGGGTGGGGGGCAACAGG - Intronic
1062463359 9:136671024-136671046 TGGTGGGGGGGGGGGGGGGCAGG + Intronic
1062517948 9:136945467-136945489 TGGGGGGGGTAGAGGGAGGCAGG + Intronic
1062517971 9:136945561-136945583 TGGGGGGTGTAGAGGGAAGCAGG + Intronic
1062544560 9:137055660-137055682 CGCTGGGCCTGGAGGGAAGCGGG - Intergenic
1062629653 9:137458189-137458211 TGGTGGGGGGAGGGGGAAGTTGG - Intronic
1062658316 9:137615293-137615315 GGGTGGGGGTGGCAGGGAGCTGG + Exonic
1203470168 Un_GL000220v1:112644-112666 TGGTGGGGGAGGAGGAAGGCGGG + Intergenic
1203477989 Un_GL000220v1:156616-156638 TGGTGGGGGAGGAGGAAGGCGGG + Intergenic
1185451991 X:286856-286878 AGGTGGGGGTAGGGGGCAGCAGG + Intronic
1185475611 X:413706-413728 TGGTCAGGGAGGAAGGAAGCTGG + Intergenic
1185867885 X:3639343-3639365 GGGTGGGGGTGGATGGATGAAGG + Intronic
1185867918 X:3639429-3639451 GGGTGGGGGTGGATGGATGAAGG + Intronic
1186137303 X:6533571-6533593 TGGTGGGGAGGGAGGGAGGGAGG - Intergenic
1186190454 X:7062690-7062712 AGGTGGGTGGGGAGGGAAGCTGG + Intronic
1186267141 X:7844168-7844190 TGGTGGGGAGGGAGGGAGGGAGG + Intergenic
1186298004 X:8169897-8169919 TGGTGGGGAGGGAGGGAGGGAGG - Intergenic
1186324846 X:8466535-8466557 TGGTGGGGAGGGAGGGAGGGAGG + Intergenic
1186657351 X:11629133-11629155 TGGTGGAGATGGAGGAAAGTAGG - Intronic
1186942846 X:14529583-14529605 TGGAGTGGGTGGGGGGAAGAGGG - Exonic
1187024210 X:15417057-15417079 TACTGGGGGTGGAGGGGGGCGGG - Intronic
1187147537 X:16651180-16651202 TGGTGGGAGGGGAGGGAGGGAGG + Intronic
1187237099 X:17477602-17477624 GGGCAGGGGTGGATGGAAGCAGG + Intronic
1187417060 X:19102614-19102636 TGGTGGGGGTGGGGAGATGGGGG + Intronic
1187688438 X:21839754-21839776 TGGTGGTGGTGGTGGGTGGCTGG + Exonic
1187834979 X:23423439-23423461 TGGTGTGGGGGGAGGGAGGAGGG - Intergenic
1187929515 X:24281067-24281089 CCGTGGGGGTGGTGAGAAGCGGG + Intergenic
1187945905 X:24426326-24426348 TGGTGCTGTTGAAGGGAAGCAGG - Intergenic
1188104731 X:26136292-26136314 GGGTGGGGGTTGGGGGAGGCAGG + Intergenic
1188340693 X:28997774-28997796 TTGTGGGGGTGGGGGGAACATGG - Intronic
1188642121 X:32519327-32519349 TGGTGGGGGTGGAGAGTAGTTGG + Intronic
1188747376 X:33862751-33862773 GGGTGGGTGTGGAGGGGAGGTGG - Intergenic
1189083075 X:37994732-37994754 TGGTGGTGATGGGGGGAAGGAGG + Intronic
1189192061 X:39118847-39118869 CAGTGAGGGAGGAGGGAAGCAGG + Intergenic
1189313452 X:40036230-40036252 GGGAGAGGGTGGAGGGAAGGAGG - Intergenic
1189324092 X:40102663-40102685 TGGGAGTGGAGGAGGGAAGCTGG - Intronic
1189365246 X:40383210-40383232 TGGTGGGGGTGGGGGGTGGGCGG + Intergenic
1189500300 X:41550218-41550240 AGATGGGGGTGGAGGGAGGGAGG - Intronic
1189579298 X:42388911-42388933 TTGTGAGGGAGGAGGGAAGTGGG + Intergenic
1189644850 X:43116913-43116935 TGGAGGGGGTGGTGGCAAGTGGG + Intergenic
1189800568 X:44688481-44688503 TGGTGGGGGTGGGGGGTGGCGGG + Intergenic
1189988103 X:46571597-46571619 GGCGGGGGGTGGGGGGAAGCGGG + Intergenic
1190109126 X:47578682-47578704 GGGTGGGGGTGGAGGGAGCGGGG - Intronic
1190179276 X:48177671-48177693 TGGCGGGGCTGGAAGGAAACAGG + Intergenic
1190326528 X:49210160-49210182 TGGACGGGGTGGGGGGAAACAGG + Intronic
1190328057 X:49218774-49218796 TGGTGGGGGTTGGGGGAGGTGGG + Intronic
1190448220 X:50552431-50552453 TGGTGGGGCTGGAGAGAAACAGG + Intergenic
1190590714 X:51997405-51997427 TGGGGGGGGTGGAGCCAAGACGG - Intergenic
1190879343 X:54481904-54481926 TGGTTGTGGTGTAGGGAAGGGGG - Intronic
1190985088 X:55492547-55492569 GGGTGGGGGTGGGGGGGAGTTGG - Intergenic
1191048322 X:56162899-56162921 TCGTGGGGGTGGAGCCAAGGTGG - Intergenic
1192232739 X:69277302-69277324 TGGTGGTGGTGGTGGGGAGGTGG + Intergenic
1192503943 X:71669732-71669754 TGATAGGGGTGGAGGGGAGAGGG + Intergenic
1192510037 X:71716156-71716178 TGATAGGGGTGGAGGGGAGAGGG - Intronic
1192516660 X:71765397-71765419 TGATAGGGGTGGAGGGGAGAGGG + Intronic
1192529168 X:71871279-71871301 TGATAGGGGTGGAGGGGAGAGGG - Intergenic
1192553693 X:72073259-72073281 GGGTGGGGGCGGGGGGGAGCGGG + Intergenic
1192569255 X:72189343-72189365 AGGTGGGGCAGGAGGGAAGCGGG - Intronic
1192706976 X:73536906-73536928 TGTTTGGGGTGGAGGGAAGGGGG - Intergenic
1193194238 X:78611146-78611168 GGGTGGGGGTGGAGGTGGGCGGG - Intergenic
1193655627 X:84193676-84193698 TGGTGAGGATGGAGAGAAGAGGG - Intergenic
1193731633 X:85109417-85109439 TGGTGAGGGTGGGGCAAAGCAGG + Intergenic
1193783163 X:85728667-85728689 GGGTGGCGGTGGGGGGAAGGGGG - Intergenic
1194478274 X:94388101-94388123 TGGGGGAAGTGGAGGGTAGCAGG + Intergenic
1195000592 X:100639614-100639636 TGGTAGGGATGGAGGGAGGCTGG - Intronic
1195202536 X:102564761-102564783 AGGTGGGGAAGGAGGGAAGGTGG - Intergenic
1195431176 X:104791215-104791237 GGGTGGGGGTGGAGAGAGGAGGG - Intronic
1195520397 X:105822648-105822670 AGTTGGGAGTGGAGGGAAACCGG - Exonic
1195691303 X:107628253-107628275 GACTGGGGGTGGAGGGATGCTGG - Intergenic
1195720739 X:107865545-107865567 GGGTGGGCGGGGAGGGAAACAGG - Intronic
1195906356 X:109848511-109848533 TGGAGGGGGTGGAGGGGAGCAGG - Intergenic
1196007644 X:110852906-110852928 AGGTGGGGGAGCAGGGGAGCAGG - Intergenic
1196163139 X:112507897-112507919 TGTTGTGGGTTGGGGGAAGCGGG + Intergenic
1196174521 X:112626468-112626490 TGGCGGGGGTGGGGGGTATCAGG - Intergenic
1196637948 X:118025388-118025410 TGGGTGGGGTGGAGTGAAGTAGG - Intronic
1196856471 X:119989993-119990015 GGGTGAGGATGGAGGGAAGACGG + Intergenic
1197115203 X:122823831-122823853 TGTTGGGGGTGGGTGGAAGGAGG + Intergenic
1197229516 X:123988965-123988987 TGGTGGGGGCTGAGGGGAGAAGG - Intronic
1197383125 X:125769886-125769908 TCATGGGGAGGGAGGGAAGCAGG - Intergenic
1197416440 X:126179560-126179582 TGGGGTGGGGGGAGGGGAGCGGG + Intergenic
1197668280 X:129246839-129246861 TGGTGGGGGGGGAGGGGGGAGGG + Intergenic
1197718143 X:129724971-129724993 TGGTGGGGGTTGGGAGAAACAGG + Intergenic
1198636788 X:138710750-138710772 AGGTGGGGGCGGTGGGGAGCAGG - Intronic
1198684308 X:139211572-139211594 CTGTGGGGGTGGGGGGTAGCGGG - Intronic
1198712742 X:139523551-139523573 TGGAGGGGGTGGAGCCAAGATGG + Intergenic
1198958897 X:142162594-142162616 TGGCGGGGGTGGAGGGTGGGAGG + Intergenic
1199668254 X:150119332-150119354 TAGTGGGTGTTGAGGGGAGCTGG + Intergenic
1199698666 X:150361488-150361510 GCGTGGGCGTGGAGGGAAGGAGG + Intronic
1199874233 X:151918993-151919015 TGGGATTGGTGGAGGGAAGCGGG + Intronic
1199874409 X:151919678-151919700 TGGGACTGGTGGAGGGAAGCGGG + Intronic
1199954619 X:152733814-152733836 TGACGTCGGTGGAGGGAAGCAGG + Intronic
1199963756 X:152801072-152801094 TGGTGGGGAGGGAGGGAGGAAGG - Intergenic
1200479498 Y:3682696-3682718 GGGTGGGGGAGGACGGGAGCCGG - Intergenic
1200778270 Y:7190159-7190181 TGGGGTGGGTGGAGGGGAGAGGG - Intergenic
1201077885 Y:10200448-10200470 TGGTGGGGGTGGGGGGGAAGGGG - Intergenic
1201438646 Y:13985638-13985660 TGGTGGGTGGGGAGGGAGGAAGG - Intergenic
1201445927 Y:14057070-14057092 TGGTGGGTGGGGAGGGAGGAAGG + Intergenic
1201570830 Y:15412107-15412129 TTGTGGGGGTTGGGGGAAGGGGG + Intergenic
1201933565 Y:19380957-19380979 TGTTGGGGTTGGAGGGAAGATGG - Intergenic
1202063177 Y:20909807-20909829 TGGTGGGTTTGGAGAGAAGGGGG + Intergenic
1202331300 Y:23756278-23756300 TGGAGGGGGTGGAGCCAAGATGG + Intergenic
1202539470 Y:25913782-25913804 TGGAGGGGGTGGAGCCAAGATGG - Intergenic