ID: 1102240248

View in Genome Browser
Species Human (GRCh38)
Location 12:111320547-111320569
Sequence CCTTGAGCTCGCCCGTCCTG GGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 85
Summary {0: 1, 1: 0, 2: 0, 3: 4, 4: 80}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1102240248_1102240258 9 Left 1102240248 12:111320547-111320569 CCCCAGGACGGGCGAGCTCAAGG 0: 1
1: 0
2: 0
3: 4
4: 80
Right 1102240258 12:111320579-111320601 CGACGGCCGAGGCGGGCGCGCGG 0: 1
1: 0
2: 1
3: 30
4: 288
1102240248_1102240256 1 Left 1102240248 12:111320547-111320569 CCCCAGGACGGGCGAGCTCAAGG 0: 1
1: 0
2: 0
3: 4
4: 80
Right 1102240256 12:111320571-111320593 TGAGGGCGCGACGGCCGAGGCGG 0: 1
1: 0
2: 0
3: 6
4: 221
1102240248_1102240254 -8 Left 1102240248 12:111320547-111320569 CCCCAGGACGGGCGAGCTCAAGG 0: 1
1: 0
2: 0
3: 4
4: 80
Right 1102240254 12:111320562-111320584 GCTCAAGGCTGAGGGCGCGACGG 0: 1
1: 0
2: 0
3: 11
4: 112
1102240248_1102240255 -2 Left 1102240248 12:111320547-111320569 CCCCAGGACGGGCGAGCTCAAGG 0: 1
1: 0
2: 0
3: 4
4: 80
Right 1102240255 12:111320568-111320590 GGCTGAGGGCGCGACGGCCGAGG 0: 1
1: 0
2: 0
3: 21
4: 232
1102240248_1102240260 25 Left 1102240248 12:111320547-111320569 CCCCAGGACGGGCGAGCTCAAGG 0: 1
1: 0
2: 0
3: 4
4: 80
Right 1102240260 12:111320595-111320617 CGCGCGGCTGCCCTACTACCCGG 0: 1
1: 0
2: 1
3: 3
4: 128
1102240248_1102240257 2 Left 1102240248 12:111320547-111320569 CCCCAGGACGGGCGAGCTCAAGG 0: 1
1: 0
2: 0
3: 4
4: 80
Right 1102240257 12:111320572-111320594 GAGGGCGCGACGGCCGAGGCGGG 0: 1
1: 0
2: 2
3: 15
4: 201

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1102240248 Original CRISPR CCTTGAGCTCGCCCGTCCTG GGG (reversed) Exonic
904002183 1:27345165-27345187 CCTTGAGCTCAGCCATCCTGGGG + Exonic
912628875 1:111229360-111229382 CCTTGAGGTCCCCAGCCCTGGGG - Intronic
1065522527 10:26586398-26586420 CCCTGAGCTGGCCCGGCTTGTGG - Intergenic
1073037561 10:100574856-100574878 GCTTGAGCTCGCCGGGCATGGGG - Intergenic
1077087915 11:763823-763845 CTTTGATCTCGCCCGTGTTGCGG - Exonic
1077104447 11:836063-836085 CGTTGAACTCACCCATCCTGGGG - Exonic
1077237369 11:1488231-1488253 CCTGGAGCCCGCTCTTCCTGTGG - Intronic
1084178615 11:67435844-67435866 CCCTGCGCTCGCTGGTCCTGGGG + Exonic
1084557513 11:69883747-69883769 CCTTGGGCTCCCCCGGCCAGAGG - Intergenic
1086350015 11:85935528-85935550 CCTTGAGCTCCTCCTTCCTCAGG - Intergenic
1089324579 11:117648306-117648328 CCTTGAGCCGGCCCCTGCTGGGG - Intronic
1090205739 11:124883141-124883163 CCTTGATTTCACCCATCCTGAGG - Intergenic
1091699011 12:2647750-2647772 CCTTCAGCTGGCCCTGCCTGGGG + Intronic
1092096572 12:5847574-5847596 CATGGTGCTCGCCCGGCCTGAGG - Intronic
1092241656 12:6839643-6839665 CCTGGAGCTCACCAGGCCTGGGG + Exonic
1093561981 12:20552546-20552568 ACTTGCCCTTGCCCGTCCTGGGG - Intronic
1096527001 12:52216036-52216058 CCTAGAGCTTGCCCAGCCTGGGG + Intergenic
1102240248 12:111320547-111320569 CCTTGAGCTCGCCCGTCCTGGGG - Exonic
1102466754 12:113134846-113134868 CCCTGAGCTCCCCAGTCTTGTGG - Intronic
1104924294 12:132305998-132306020 CCATGAGCCCCCCTGTCCTGAGG - Intronic
1113837449 13:113337773-113337795 CCCTGAGGTCACCTGTCCTGAGG - Intronic
1113885160 13:113655006-113655028 CCTTGAGCGCGTCCGTGATGTGG + Intronic
1114498943 14:23153965-23153987 CCTTGCTCTCTCCCGCCCTGTGG - Intronic
1117805369 14:59484711-59484733 CCTTGACCCCGCCCGCCCTCGGG + Exonic
1124553104 15:30700403-30700425 CCTTGAGCTTCTCCATCCTGTGG + Intronic
1124678139 15:31705267-31705289 CCTTGAGCTTCTCCATCCTGTGG - Intronic
1130547724 15:84868888-84868910 CCCTGATCTCGCCTGTCCTCAGG + Exonic
1133249842 16:4474022-4474044 CCTGAAGACCGCCCGTCCTGGGG - Intronic
1136774601 16:32865081-32865103 GATGGAGCTCGCCCATCCTGAGG - Intergenic
1136896011 16:33996433-33996455 GATGGAGCTCGCCCATCCTGAGG + Intergenic
1138470997 16:57236254-57236276 CTTTGAGCTCTCTGGTCCTGTGG + Intronic
1138535930 16:57660380-57660402 CCTTGACCTCGCCCGTTCGGTGG - Intronic
1203077028 16_KI270728v1_random:1127217-1127239 GATGGAGCTCGCCCATCCTGAGG - Intergenic
1142762267 17:2049736-2049758 GCTCGAGCGCGCGCGTCCTGCGG - Intergenic
1149654791 17:58304611-58304633 CCTTGAGCTTGCCTCTCCTTGGG - Intronic
1152108714 17:78345215-78345237 CCTTGATCTCCCCAGGCCTGTGG - Intergenic
1152843902 17:82587594-82587616 CCTTGGCCTCGCGCGCCCTGTGG + Intronic
1161557809 19:4954448-4954470 ACTTGCCCTTGCCCGTCCTGGGG - Exonic
1161578634 19:5068416-5068438 CCTTCTGGTCCCCCGTCCTGGGG + Intronic
1166333187 19:42090458-42090480 CCTTGAACTCTCCCCTGCTGGGG + Exonic
926633476 2:15158111-15158133 CCTTGAGCTGGTCCATCCTAAGG - Intergenic
940660020 2:156534162-156534184 CCTGGAGTTTGGCCGTCCTGTGG + Intronic
1172344563 20:34187490-34187512 CTTTAAGCTGGCCTGTCCTGGGG + Intergenic
1173222533 20:41141526-41141548 CCTTGCCCTCTCCCGTGCTGTGG - Intronic
1174139719 20:48404282-48404304 CCTTGTGGTCGCCCTTCCTGGGG + Intergenic
1175667096 20:60870018-60870040 CCATCAGCTCTCCCGTCGTGGGG - Intergenic
1175890452 20:62313628-62313650 CGGTGAGCCCGCCCGGCCTGGGG - Exonic
1176288622 21:5032834-5032856 CCTTGAGCACTCCTGCCCTGTGG + Intronic
1179868562 21:44230641-44230663 CCTTGAGCACTCCTGCCCTGTGG - Intronic
1179923446 21:44520074-44520096 CCTTGAGCTCGCTAGTGCTGTGG - Intronic
1179984304 21:44912519-44912541 CCTTGATCCTTCCCGTCCTGGGG + Intronic
1180002766 21:45002581-45002603 CCTTGACCTCGCTGGCCCTGGGG + Intergenic
1180058715 21:45374046-45374068 CCTTGAGCTCTCCCCTCATCAGG - Intergenic
950101324 3:10358663-10358685 CCCTGAGCTCGCTGGCCCTGGGG + Intronic
953696541 3:45164453-45164475 CCTGGATCTCACCCGTCATGAGG + Intergenic
954662900 3:52235430-52235452 CCCAGAGCTCGGCCATCCTGCGG - Intronic
956889562 3:73598687-73598709 GCCTGAGCTGGCCTGTCCTGGGG - Intronic
959330266 3:104996438-104996460 CCTAGAGCTGGCCTGTGCTGAGG - Intergenic
965934691 3:174092996-174093018 CCTTGAGCTAGCCAGTCCCATGG + Intronic
966762167 3:183428279-183428301 CCCGGAGCTCGCCCGGCCGGAGG - Intronic
978384871 4:108168775-108168797 CCTTGAGTTCGCCCGGCCGAGGG + Intronic
979174124 4:117640680-117640702 CATTGAGCTCTCACCTCCTGAGG - Intergenic
991198017 5:63959209-63959231 CCTTGGGCACGCGCGCCCTGGGG + Intergenic
998400438 5:141846028-141846050 CCCTGAGCTCCTCCGTCCTCAGG + Intergenic
999394718 5:151220133-151220155 CCTTTAGCTCCCACGTCCCGGGG + Intronic
1001429465 5:171647812-171647834 CCTTCAGCCCGCCTGTCCTTTGG - Intergenic
1002455245 5:179342589-179342611 CCCTGAGCACGCCCGTACTCGGG - Intronic
1003495640 6:6660974-6660996 CCTTTAGCTCCCTCTTCCTGGGG - Intergenic
1009427346 6:63528677-63528699 CCTTGACCTCCCCCGTGCTCAGG - Intronic
1015042859 6:128742767-128742789 CCTGGAGTTCAGCCGTCCTGTGG - Intergenic
1017124555 6:151052951-151052973 CACTGAGATCGCCCGTCGTGGGG + Intronic
1019265711 7:116445-116467 CCCTGAGCTCGCCCATTCTCTGG + Intergenic
1039968329 8:42299765-42299787 CCCTGAGCCTGCCCGTCCTTTGG + Intronic
1046063218 8:109164134-109164156 CCTTGTGCTAGCAGGTCCTGAGG - Intergenic
1046567249 8:115917619-115917641 CCTGGAGTTCGGCCATCCTGTGG - Intergenic
1049662058 8:143823996-143824018 CCTGGAGCTCGCGCGTTCTTAGG - Intronic
1053357063 9:37455279-37455301 CCTGGAGTTCGGCTGTCCTGTGG - Intronic
1060220105 9:121759998-121760020 TCTTGAGCTTGCCCGTGGTGCGG - Exonic
1062394020 9:136345476-136345498 CCATGAGGGCGCCCGCCCTGGGG + Intronic
1198321398 X:135521542-135521564 CCACGAGCTCGGCCCTCCTGCGG - Intronic
1200182665 X:154160222-154160244 CCTCGAGCTGCCCCCTCCTGAGG - Intergenic
1200188319 X:154197336-154197358 CCTCGAGCTGCCCCCTCCTGAGG - Intergenic
1200193969 X:154234476-154234498 CCTCGAGCTGCCCCCTCCTGAGG - Intergenic
1200199724 X:154272280-154272302 CCTCGAGCTGCCCCCTCCTGAGG - Intronic
1201751505 Y:17436692-17436714 CCTTGAGTTTGGCCATCCTGTGG + Intergenic