ID: 1102240691

View in Genome Browser
Species Human (GRCh38)
Location 12:111322729-111322751
Sequence GAACATGGCGGGGGGTCCTG GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 170
Summary {0: 1, 1: 0, 2: 1, 3: 12, 4: 156}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1102240676_1102240691 22 Left 1102240676 12:111322684-111322706 CCTGCTGCCCTGGCTTTCATCCC 0: 1
1: 0
2: 3
3: 41
4: 421
Right 1102240691 12:111322729-111322751 GAACATGGCGGGGGGTCCTGGGG 0: 1
1: 0
2: 1
3: 12
4: 156
1102240680_1102240691 2 Left 1102240680 12:111322704-111322726 CCCAGTCACTGTCATGGCTGCAC 0: 1
1: 0
2: 1
3: 5
4: 182
Right 1102240691 12:111322729-111322751 GAACATGGCGGGGGGTCCTGGGG 0: 1
1: 0
2: 1
3: 12
4: 156
1102240681_1102240691 1 Left 1102240681 12:111322705-111322727 CCAGTCACTGTCATGGCTGCACT 0: 1
1: 0
2: 1
3: 12
4: 163
Right 1102240691 12:111322729-111322751 GAACATGGCGGGGGGTCCTGGGG 0: 1
1: 0
2: 1
3: 12
4: 156
1102240678_1102240691 14 Left 1102240678 12:111322692-111322714 CCTGGCTTTCATCCCAGTCACTG 0: 1
1: 0
2: 0
3: 27
4: 251
Right 1102240691 12:111322729-111322751 GAACATGGCGGGGGGTCCTGGGG 0: 1
1: 0
2: 1
3: 12
4: 156
1102240674_1102240691 26 Left 1102240674 12:111322680-111322702 CCTCCCTGCTGCCCTGGCTTTCA 0: 1
1: 3
2: 1
3: 62
4: 491
Right 1102240691 12:111322729-111322751 GAACATGGCGGGGGGTCCTGGGG 0: 1
1: 0
2: 1
3: 12
4: 156
1102240675_1102240691 23 Left 1102240675 12:111322683-111322705 CCCTGCTGCCCTGGCTTTCATCC 0: 1
1: 0
2: 1
3: 36
4: 409
Right 1102240691 12:111322729-111322751 GAACATGGCGGGGGGTCCTGGGG 0: 1
1: 0
2: 1
3: 12
4: 156
1102240673_1102240691 27 Left 1102240673 12:111322679-111322701 CCCTCCCTGCTGCCCTGGCTTTC 0: 1
1: 2
2: 9
3: 77
4: 791
Right 1102240691 12:111322729-111322751 GAACATGGCGGGGGGTCCTGGGG 0: 1
1: 0
2: 1
3: 12
4: 156
1102240677_1102240691 15 Left 1102240677 12:111322691-111322713 CCCTGGCTTTCATCCCAGTCACT 0: 1
1: 0
2: 3
3: 20
4: 328
Right 1102240691 12:111322729-111322751 GAACATGGCGGGGGGTCCTGGGG 0: 1
1: 0
2: 1
3: 12
4: 156

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1102240691 Original CRISPR GAACATGGCGGGGGGTCCTG GGG Intronic
900226180 1:1534584-1534606 GAACCTGGCGGGGGTGTCTGAGG + Exonic
900648233 1:3718527-3718549 GACTATGGCCGGGGGTGCTGGGG + Intronic
905445364 1:38025234-38025256 GAACAGGGAGCGGGGTTCTGGGG + Intergenic
907903633 1:58764253-58764275 GAAGAAGGCGGGGGGTGGTGGGG + Intergenic
911561802 1:99415646-99415668 GAACATGGAGGGTGGTCTTGGGG + Intergenic
911674874 1:100647556-100647578 GAACATGGGTGGGGTTGCTGGGG - Intergenic
913529717 1:119725052-119725074 GCAGATGGCGGGGGCTCCTGAGG + Intronic
913663165 1:121022242-121022264 GATCATGTCGGGGTGTGCTGAGG - Intergenic
914014550 1:143805507-143805529 GATCATGTCGGGGTGTGCTGAGG - Intergenic
914163270 1:145155694-145155716 GATCATGTCGGGGTGTGCTGAGG + Intergenic
914193449 1:145431068-145431090 GAACAAGGCGGCTGCTCCTGAGG - Intergenic
914376973 1:147080347-147080369 GAACAAGGCGGCTGCTCCTGAGG + Intergenic
914474778 1:148013958-148013980 GAACAAGGCGGCTGCTCCTGAGG - Intergenic
914653174 1:149714064-149714086 GATCATGTCGGGGTGTGCTGAGG - Intergenic
915595661 1:156895062-156895084 GAACATGGTGGGTGGGCCTTCGG - Intronic
916168270 1:161982309-161982331 GAACAAGGTGGGGGGCCATGAGG - Intergenic
916506044 1:165429003-165429025 GAACATGGAAAGGGGCCCTGGGG + Intronic
918076704 1:181176125-181176147 GAAGATGGCCTGGGGTCCTGTGG + Intergenic
920969792 1:210733415-210733437 GAAGATGAAGGGGGTTCCTGGGG - Intronic
923857210 1:237858056-237858078 GAACATGGCTGGGAGGCCTTGGG - Intergenic
1065571355 10:27073372-27073394 GAACGTGGAGGGCAGTCCTGTGG - Intronic
1067895383 10:50173956-50173978 GAAAATGTAGTGGGGTCCTGTGG - Intergenic
1067953602 10:50768022-50768044 GAAAATGTAGTGGGGTCCTGTGG + Intronic
1070850891 10:79560784-79560806 GACACTGGCTGGGGGTCCTGGGG - Intergenic
1073474059 10:103741489-103741511 GAAGATGAGAGGGGGTCCTGAGG - Intronic
1073682252 10:105717282-105717304 GAACATGGCCGGGTGTGCAGTGG + Intergenic
1076734100 10:132451107-132451129 GAACATGAGGGGGGGCCCAGAGG - Intergenic
1078416548 11:11170893-11170915 GATCATTGTGGTGGGTCCTGGGG + Intergenic
1080924195 11:36739032-36739054 GAACATTGCTAGGGGTCCTGAGG + Intergenic
1081108924 11:39107387-39107409 GTACATGGCAGGGGCTCATGGGG - Intergenic
1082118895 11:48357068-48357090 AAGCATGGCTGGGGGTCCTCAGG + Intergenic
1084554780 11:69869175-69869197 GAGCATGTCCTGGGGTCCTGGGG - Intergenic
1096430472 12:51538878-51538900 GACCATGTGGGGAGGTCCTGAGG - Intergenic
1096745742 12:53725790-53725812 GAATATGGCTGGGGGTCGAGGGG + Intronic
1096993911 12:55827341-55827363 GACCATGGCTGGGGTTCCTGAGG - Exonic
1097051566 12:56226251-56226273 CAACAAGGCGGTGAGTCCTGTGG + Exonic
1099214469 12:79837827-79837849 CCACATGGCTGGGGGTCCTCAGG - Intronic
1101504824 12:105336624-105336646 GATCATGGCTGTGGGCCCTGAGG + Intronic
1102183610 12:110931504-110931526 GAAGCTGGCGGGGGAGCCTGGGG - Intergenic
1102240691 12:111322729-111322751 GAACATGGCGGGGGGTCCTGGGG + Intronic
1104979330 12:132566770-132566792 GCACATAGCGCGGTGTCCTGTGG + Intronic
1104979355 12:132566878-132566900 GCACATAGCGCGGTGTCCTGTGG + Intronic
1106062394 13:26307152-26307174 GAACATGGTTGGGGGTGGTGGGG - Intronic
1107878019 13:44807405-44807427 GAAAATGGCGGGGGGTGGGGGGG + Intergenic
1114626147 14:24131560-24131582 GAACATGGAGCGGGGGCCGGTGG + Exonic
1116174355 14:41448205-41448227 GCACATGGAAGGGTGTCCTGGGG - Intergenic
1117313043 14:54547626-54547648 GGACATGGTGGAGGGGCCTGTGG - Intergenic
1119758143 14:77133105-77133127 GAACCTGGTGGGGGGTGGTGAGG + Exonic
1120359845 14:83485429-83485451 GAACATGGCGGGGGGGGGGGGGG - Intergenic
1121101640 14:91253781-91253803 GCAGATGGCGGGGTGGCCTGGGG + Exonic
1122503051 14:102213994-102214016 GGGCATGGCGGGGGATCCGGTGG + Intronic
1126896769 15:53266178-53266200 GCACATGGCAGGGGGTGTTGTGG - Intergenic
1128794583 15:70456000-70456022 GGACATGGTGGTGGGCCCTGTGG - Intergenic
1128817873 15:70627578-70627600 GAACATGTCGAGGGTTCCCGAGG - Intergenic
1128992795 15:72274406-72274428 GAACATGGCCCTGGGGCCTGTGG - Intronic
1130350351 15:83085745-83085767 GAATATGGTCTGGGGTCCTGAGG + Intergenic
1130957776 15:88639363-88639385 GAACATGGCTGGGAGCCGTGAGG + Exonic
1135164189 16:20124304-20124326 GAACATGGAGGCAGGTCCTATGG - Intergenic
1138113419 16:54342120-54342142 GAGCATGGGCGGGGCTCCTGGGG + Intergenic
1142209975 16:88804197-88804219 GGACAGGCCGGGGGATCCTGGGG + Intronic
1144852091 17:18248993-18249015 GAGCTTGGCGGGGGGTCCCTGGG - Intronic
1147465499 17:40607724-40607746 GTACATGCTGGGGGGTCCTGTGG + Intergenic
1148910451 17:50939792-50939814 GAGCAAGGCGGGGGGTCCTTGGG - Intergenic
1149553205 17:57555232-57555254 GAGCATGGCGGTGGGTGCAGAGG - Intronic
1152461601 17:80444906-80444928 GAACCTGGAGGGTGGGCCTGGGG + Intergenic
1152602775 17:81273292-81273314 GACCACAGCTGGGGGTCCTGGGG - Intronic
1160897131 19:1408114-1408136 CAACCTGGGGGGGTGTCCTGGGG + Intronic
1162771724 19:12953392-12953414 GAGGATGGGGGGGGGTCCTCAGG - Exonic
1163009083 19:14413536-14413558 GAACAAGGCTGGGGGTGGTGTGG - Intronic
1163051763 19:14689860-14689882 GAGCATGGAGGGTGGTGCTGGGG - Intronic
1163462692 19:17448457-17448479 GGCCATGGCGGGGGTTCCTGCGG + Exonic
1165119706 19:33551269-33551291 GAGCATGGCTGTGGGCCCTGGGG + Intergenic
1166169268 19:41016109-41016131 GAACATGGCGCCGGGTGCAGTGG + Intronic
1166412640 19:42566474-42566496 GGACAGGGACGGGGGTCCTGGGG + Intergenic
1167266952 19:48487970-48487992 GACCATGGTGTGGGGGCCTGAGG - Intronic
1167299486 19:48670714-48670736 GATGAGGGCTGGGGGTCCTGGGG + Exonic
1167515982 19:49923395-49923417 GCACAGGGCGGGGGGTTGTGGGG + Intronic
1167636832 19:50660113-50660135 GAACATGGGGGGGGGACCTGAGG + Intronic
1167697496 19:51024005-51024027 GAACCTGGCAGGGGGTGGTGAGG - Intronic
1168072798 19:53962219-53962241 GAACGCGACGGGGGCTCCTGGGG + Intergenic
1168240493 19:55086657-55086679 GCTCAGGGCGAGGGGTCCTGGGG - Intronic
925254139 2:2467903-2467925 GAACCTGCCGGAGGGGCCTGTGG - Intergenic
928449448 2:31365528-31365550 GCACAGGGCGGCCGGTCCTGGGG + Exonic
932209531 2:69915433-69915455 AAACGAGGCCGGGGGTCCTGTGG + Intronic
935868684 2:107420869-107420891 CAGCATGGCTGGGGTTCCTGAGG + Intergenic
938230873 2:129657606-129657628 GAACCTAGTAGGGGGTCCTGGGG + Intergenic
943953881 2:194161905-194161927 AAGCATGACAGGGGGTCCTGGGG + Intergenic
944010181 2:194965296-194965318 GAACATAGCAGGGGGACCTTGGG + Intergenic
947526185 2:230878110-230878132 GAACACGGCAGGGGGTTCTGGGG - Exonic
1171447441 20:25214610-25214632 GAACATGGCAGGTGCCCCTGGGG + Intronic
1172090948 20:32432214-32432236 GCACATGGGGTGGGGTCCAGGGG + Intronic
1173986765 20:47267571-47267593 GCACATGGTGGGGAGACCTGTGG - Intronic
1174171245 20:48619498-48619520 GAAGAGGGCAGGGGGTCCTGGGG - Intergenic
1174416869 20:50373190-50373212 GAACCGGGCAGGGGGTGCTGAGG + Intergenic
1176048489 20:63104616-63104638 GCACATGGTGAGGGCTCCTGGGG - Intergenic
1178682035 21:34680333-34680355 GCACACAGCAGGGGGTCCTGTGG + Intronic
1179418355 21:41216208-41216230 GAAAATGGTGGTGGCTCCTGCGG + Intronic
1179631904 21:42683973-42683995 GCAGAAGGCGGGGGGCCCTGTGG - Intronic
1179951952 21:44713193-44713215 GGAGCTGGCAGGGGGTCCTGGGG - Intergenic
1180214794 21:46317226-46317248 GAACGTGGAAGGGGGACCTGAGG - Exonic
1181670952 22:24425202-24425224 GACCATGGTGGAGGGTTCTGTGG + Intronic
1182563482 22:31180101-31180123 GAACATGGCGGGGGGGTGGGGGG + Intronic
1184841085 22:47052764-47052786 GAAGATGCCCGGGGGTACTGTGG - Intronic
1185347500 22:50316972-50316994 GGACAGGGCGGGGGGCCCCGAGG + Intronic
949379790 3:3431723-3431745 GAACTTGGGGGCGGGTCCAGGGG + Intergenic
950200377 3:11038055-11038077 GCACATTGCGGGGGGTTCTCTGG - Exonic
952744588 3:36764767-36764789 GAGGATGGCTGGTGGTCCTGGGG - Intergenic
953770531 3:45775972-45775994 GACCACGGCAGGGGATCCTGTGG + Exonic
955391687 3:58526663-58526685 GAACATGGAGGGGGGTTGGGCGG + Intronic
958771954 3:98435820-98435842 GAAAATGTTGGGGGGTCTTGTGG - Intergenic
961246035 3:125454455-125454477 GACCAGGGCAGGGGGTGCTGAGG - Intronic
961829885 3:129618048-129618070 GCACATGGCGGGAGATGCTGTGG + Intergenic
964351327 3:155806234-155806256 GAACATGGCGGGGCAGCCCGCGG - Exonic
968735200 4:2291615-2291637 GGACAGGGCTGGGGGTCCTGGGG + Intronic
971714152 4:30153669-30153691 GAACCTAACGGGGGGTGCTGAGG - Intergenic
973853592 4:54986983-54987005 GCACATAGCTTGGGGTCCTGGGG + Intergenic
979646956 4:123080703-123080725 AAACATGGTGGGTTGTCCTGTGG - Intronic
982123727 4:152166321-152166343 GAACAGGGCGGGGAGTGGTGGGG + Intergenic
986739526 5:10694003-10694025 GAACCTTGCTTGGGGTCCTGGGG + Intronic
994300613 5:98142687-98142709 GAGCATGGGGAGGGGTCCTAAGG - Intergenic
996443051 5:123512739-123512761 GACCATGGCGGGTGGCCCGGAGG + Intronic
998133047 5:139660714-139660736 GAACATGGGGGGGTTTGCTGGGG + Intronic
1000165025 5:158640029-158640051 GAGGATGGCGGGTGTTCCTGTGG - Intergenic
1001677789 5:173532878-173532900 GACCATGGCTGCGGGTACTGAGG + Intergenic
1002474927 5:179459551-179459573 AAACATGGCAAGTGGTCCTGGGG - Intergenic
1006300380 6:33190882-33190904 GAAGATGGTGGGCGGACCTGTGG - Intronic
1018637112 6:165872406-165872428 GAACATGTTGGTGGGTCCAGAGG + Intronic
1018828433 6:167424117-167424139 GAGCTTGGCTGGGGCTCCTGGGG + Intergenic
1018848849 6:167573352-167573374 GAACATCGTGGTGAGTCCTGGGG - Intergenic
1019758997 7:2795026-2795048 GAACAAGGCGGGGCTGCCTGTGG - Exonic
1020105177 7:5419533-5419555 GAACTTGGGGGGCGGCCCTGGGG - Intronic
1020551092 7:9605709-9605731 GAACCTGTCGGGGGTTCCGGGGG - Intergenic
1024117807 7:46209763-46209785 GAGCACTGTGGGGGGTCCTGAGG - Intergenic
1024512274 7:50213327-50213349 GTACATGGCAGGGGGACCTCGGG + Intergenic
1024777529 7:52805037-52805059 TATCATGGGAGGGGGTCCTGAGG + Intergenic
1026765874 7:73159269-73159291 GAACGTACCTGGGGGTCCTGGGG - Intergenic
1027042348 7:74968966-74968988 GAACGTACCTGGGGGTCCTGGGG - Intronic
1027081294 7:75233392-75233414 GAACGTACCTGGGGGTCCTGGGG + Intergenic
1029112809 7:98222351-98222373 GAACACTGCAGGGGCTCCTGGGG + Intronic
1029495774 7:100895020-100895042 GAACTTGGGGAGGGGGCCTGGGG + Intronic
1034374134 7:150628217-150628239 GAGCACGGCGTGGGGCCCTGGGG + Exonic
1035096442 7:156360008-156360030 GTCCTTGGCGTGGGGTCCTGGGG + Intergenic
1035710489 8:1709831-1709853 GAACCTGGCGGGGGGGGCGGGGG - Intergenic
1047774748 8:128060537-128060559 GAACAGGGCAGGGACTCCTGAGG + Intergenic
1049191556 8:141290787-141290809 GGATGTGGCGGGGGGGCCTGGGG + Intronic
1049615045 8:143572370-143572392 GAACCGGCCTGGGGGTCCTGTGG - Intronic
1049789977 8:144468068-144468090 GACCATCCCGGGAGGTCCTGAGG - Intronic
1049844170 8:144792124-144792146 GCCCATGGCGACGGGTCCTGGGG + Exonic
1050952751 9:11618380-11618402 GAACATGGCGTGCGGGCCTCAGG - Intergenic
1053435268 9:38069615-38069637 GAACAACGCGCGGGGTCCCGGGG - Intergenic
1053577641 9:39369069-39369091 GGACATGGTGGGGGCGCCTGTGG + Intergenic
1053842146 9:42197021-42197043 GGACATGGTGGGGGCACCTGTGG + Intergenic
1054099217 9:60927786-60927808 GGACATGGTGGGGGCGCCTGTGG + Intergenic
1054120614 9:61203410-61203432 GGACATGGTGGGGGCGCCTGTGG + Intergenic
1054587134 9:66979146-66979168 GGACATGGTGGGGGAGCCTGTGG - Intergenic
1059592489 9:115677241-115677263 GATCATGGGGATGGGTCCTGAGG - Intergenic
1061258349 9:129465767-129465789 GCACAGGGCGTGGGGTTCTGTGG + Intergenic
1062565271 9:137161504-137161526 GCAGATGGTGGGGGGTCCTGGGG + Intronic
1203773473 EBV:60826-60848 GAAGAGGGCGGGGGCCCCTGGGG - Intergenic
1185735575 X:2493083-2493105 GTGCAAGGAGGGGGGTCCTGTGG + Intronic
1186515995 X:10166499-10166521 GCACATGGCTCTGGGTCCTGAGG + Intronic
1188594612 X:31883341-31883363 GAACATGAGAGGGGCTCCTGAGG + Intronic
1190115509 X:47623952-47623974 GAACGTGCCGGGCGGCCCTGAGG + Intergenic
1190305438 X:49079227-49079249 GAGGATGGGGGGGGTTCCTGGGG - Intronic
1193919809 X:87411018-87411040 AAGCATGGCTGGGGGTCCTCAGG + Intergenic
1195269363 X:103215244-103215266 GAACCCGGCGGGGGGTCCCTGGG + Intronic
1197478563 X:126953033-126953055 GCACATGGCCTGGGGACCTGTGG - Intergenic
1198563313 X:137877018-137877040 AAACATGGCTGGGAGTCCTCGGG + Intergenic
1201147583 Y:11073256-11073278 GAACCTGGCGGGGAGGTCTGGGG + Intergenic
1201241077 Y:11956877-11956899 GAAATTGGCGGGGGGTAGTGGGG - Intergenic