ID: 1102242108

View in Genome Browser
Species Human (GRCh38)
Location 12:111331059-111331081
Sequence GAGCCTAGATGTTTGTGAAG GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 129
Summary {0: 1, 1: 0, 2: 1, 3: 7, 4: 120}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1102242104_1102242108 6 Left 1102242104 12:111331030-111331052 CCTGAGCAAAGACATAGGGGCTT 0: 1
1: 0
2: 0
3: 5
4: 125
Right 1102242108 12:111331059-111331081 GAGCCTAGATGTTTGTGAAGGGG 0: 1
1: 0
2: 1
3: 7
4: 120
1102242101_1102242108 10 Left 1102242101 12:111331026-111331048 CCAGCCTGAGCAAAGACATAGGG 0: 1
1: 0
2: 3
3: 21
4: 194
Right 1102242108 12:111331059-111331081 GAGCCTAGATGTTTGTGAAGGGG 0: 1
1: 0
2: 1
3: 7
4: 120
1102242099_1102242108 26 Left 1102242099 12:111331010-111331032 CCTCAGGATGGCAAGACCAGCCT 0: 1
1: 0
2: 13
3: 326
4: 786
Right 1102242108 12:111331059-111331081 GAGCCTAGATGTTTGTGAAGGGG 0: 1
1: 0
2: 1
3: 7
4: 120

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1102242108 Original CRISPR GAGCCTAGATGTTTGTGAAG GGG Intronic
901183602 1:7358050-7358072 AAGCCCAGATCTTTGTGGAGGGG + Intronic
905815199 1:40944641-40944663 GGGCCTGAATGTTTGTGAAATGG + Intergenic
906562266 1:46767880-46767902 GAGCCTGAGTGTGTGTGAAGTGG - Intronic
912393443 1:109320964-109320986 GAGCCCACATGTTTGGGAAGTGG - Intronic
915759123 1:158292913-158292935 GAGCCTAGAGGTTAGGGGAGAGG + Intronic
916541417 1:165758780-165758802 GATCCTGGATGTTTTTTAAGTGG - Intronic
917399248 1:174628760-174628782 GCGTCTAGATATTAGTGAAGTGG + Intronic
917745496 1:178002889-178002911 GCTCCTAGATGTTTGAGAAGAGG - Intergenic
918488810 1:185057909-185057931 GAGCCCAGATGTTTGAGACCAGG + Intronic
923292585 1:232560872-232560894 GAGTCTAGATTTTCATGAAGAGG + Intronic
1067069252 10:43120158-43120180 GTCCCGAGATGTTTATGAAGAGG + Exonic
1070941239 10:80349884-80349906 AAGCCTAGTTTTTTGTGAACAGG - Intronic
1071867643 10:89753913-89753935 CAGCCTAGAAGTTTTTTAAGTGG + Intronic
1074784923 10:116830558-116830580 GAGCCTAGGAGTTTGAGAACCGG + Intergenic
1074829323 10:117237710-117237732 GGGCTAAGATGTTTGAGAAGTGG + Intergenic
1080116538 11:28627789-28627811 GAGCCTTTCTGTTTCTGAAGAGG + Intergenic
1085455369 11:76662438-76662460 GAGCCTAGATTTCTGTAAATAGG - Intronic
1087065943 11:94028122-94028144 GAGCCCACATGTCTGTGTAGAGG - Intronic
1087423334 11:97960698-97960720 GAGGGTAGATTTTTTTGAAGTGG - Intergenic
1091050082 11:132359699-132359721 TTGCCTAGAAGTTTGTGAACAGG + Intergenic
1091673853 12:2473267-2473289 GGCCCTAGAAGTTTGTGTAGGGG - Intronic
1092001792 12:5038848-5038870 GAGCCTTGATTTGTGTGAATGGG + Intergenic
1093582152 12:20795091-20795113 GAGCCTAGAAAATTTTGAAGTGG - Intergenic
1095413921 12:41954671-41954693 GAGGTTAGAAGTTTGTGATGAGG + Intergenic
1096838148 12:54364292-54364314 AAGCCTATATGTGTGTGTAGTGG - Exonic
1100431610 12:94535917-94535939 GAGCCTATATGTTCCAGAAGTGG - Intergenic
1102242108 12:111331059-111331081 GAGCCTAGATGTTTGTGAAGGGG + Intronic
1102708494 12:114904227-114904249 GTGCATACATGTTTGTGAAAGGG + Intergenic
1107131005 13:36895391-36895413 GAGGCTAGATTTGTGTGGAGGGG + Intronic
1108884621 13:55164954-55164976 GAGCCTAGAGGTTTTGGCAGAGG + Intergenic
1111164289 13:84437984-84438006 CAGCCTAGAGGTTTGGGGAGAGG + Intergenic
1114695622 14:24624573-24624595 GTGCCTAGATCTGTGTGAGGTGG + Intergenic
1115861838 14:37695245-37695267 GAGGCTTGATGGGTGTGAAGTGG + Intronic
1116025078 14:39505273-39505295 CAGCACAGGTGTTTGTGAAGTGG + Intergenic
1116949506 14:50866188-50866210 AAGCCTAAATGTTTGTGATCTGG - Intronic
1117181085 14:53192373-53192395 GAAAATAAATGTTTGTGAAGAGG + Intergenic
1118708597 14:68501935-68501957 GAGCCTGCAAGTCTGTGAAGAGG - Intronic
1130855980 15:87840678-87840700 GAGCCTAGATGTTAGGGGAAAGG + Intergenic
1135561416 16:23479648-23479670 GAGTCGAGATGGTTGTGAATAGG - Intronic
1136553526 16:30994649-30994671 GAGGCTGGGTGTTTGTGGAGAGG - Intronic
1137533708 16:49300948-49300970 GAGGCTAGATATTAATGAAGAGG - Intergenic
1137729324 16:50678316-50678338 GAACCTAGATGGGTATGAAGTGG - Intronic
1139492769 16:67295438-67295460 GAGGCTAGGTCTTTGCGAAGGGG + Intronic
1142762081 17:2048652-2048674 GCTACTACATGTTTGTGAAGGGG - Intergenic
1150291597 17:63985557-63985579 GGGCTTAGATGTGTGTGTAGAGG - Intergenic
1151777814 17:76219690-76219712 GAACCTAGGTGTGTGTGTAGTGG + Intronic
1153463829 18:5366757-5366779 GAGTGTAGATGTCTTTGAAGTGG - Intergenic
1153864021 18:9245754-9245776 GAGCCTAGATTTTTGTGGCAGGG + Intronic
1155108288 18:22688693-22688715 GAGCCTGGAAGATTTTGAAGGGG - Intergenic
1156695774 18:39764956-39764978 GTGCCTAGATGTTTTTGCACTGG - Intergenic
1156774558 18:40771274-40771296 GAGCCTGAATGTTAGTAAAGAGG - Intergenic
1156951224 18:42900767-42900789 AAACTTAGATGTTTGTGAAAGGG + Intronic
1158534073 18:58291887-58291909 GAGCATAAATGTTTGGGAAGGGG - Intronic
1159814886 18:73060627-73060649 GAGCCTAGATGTCTGTGCAGGGG + Intergenic
1166629420 19:44392058-44392080 GAGCCTAAATGTGTGAGTAGGGG + Intronic
927486271 2:23490565-23490587 GAGCCAAGTAGTTTGAGAAGGGG - Intronic
933654835 2:84879063-84879085 GAGGCTACATGTGTGTGATGAGG + Intronic
937191429 2:120104041-120104063 GAGCCTGGATGGTTGGGGAGTGG - Intronic
939682498 2:145155879-145155901 GAGAAAAGATCTTTGTGAAGAGG - Intergenic
941078560 2:161033904-161033926 CAACCTAGAGGTTTCTGAAGTGG - Intergenic
942548993 2:177094888-177094910 GAGCATGTCTGTTTGTGAAGTGG - Intergenic
943474361 2:188336338-188336360 CAGTCTACATGTTTGTGAAATGG + Intronic
945278617 2:208013968-208013990 GAGCCTAGGTCTTTGTTAACTGG + Intronic
948338962 2:237233771-237233793 GCCCCTATATGTTTGTCAAGTGG + Intergenic
1173023277 20:39285502-39285524 GAGCCTATATGTTTAACAAGAGG + Intergenic
1173808704 20:45942968-45942990 CAGCCTAGAAGCTTCTGAAGTGG + Intronic
1174353433 20:49983494-49983516 GAGACGAGATGTGTGTGAGGAGG + Intronic
1175090031 20:56494938-56494960 GGGCCTAGCTGTTGGTGCAGAGG + Intronic
1177145750 21:17405180-17405202 TATCCTAGATATTTTTGAAGAGG + Intergenic
1181529349 22:23507906-23507928 GGCCCTAGATATTTGTTAAGTGG - Intergenic
1184262455 22:43326840-43326862 GTGAGTAGATGTTTGTGGAGGGG - Intronic
950813913 3:15678476-15678498 GAGCCTATTTGTTTGTGTACAGG - Intronic
953746976 3:45582625-45582647 CAGCCCAGATGTCTGTGAATAGG + Intronic
960766784 3:121139664-121139686 GAGCCTAAATGATGGTGATGAGG - Intronic
961161206 3:124727916-124727938 CAGCCTATATTTTTTTGAAGGGG + Intergenic
963913109 3:150831755-150831777 GAGCTTATATCTTAGTGAAGAGG + Intergenic
964573191 3:158134569-158134591 CAGCCTTGATCTTTGTGAAATGG - Intronic
966855450 3:184190761-184190783 AAGCTTAGATGTTTGCGACGTGG + Intronic
968551043 4:1223509-1223531 CTGCCTGGATGTTTGGGAAGCGG + Intronic
971035354 4:22687149-22687171 GATCCTCTATGTTTGTGAAATGG + Intergenic
971824685 4:31605685-31605707 GACACCAGATGTTTGTGAAATGG - Intergenic
975249083 4:72156272-72156294 AAGCCTAGATCTTTTTGAACGGG + Intergenic
982907561 4:161094665-161094687 GAGCCTAGAATCTTGTGAAAAGG - Intergenic
987322809 5:16786001-16786023 GAGCCCAGAGGACTGTGAAGGGG - Intronic
989113641 5:37930888-37930910 GAGTCTAGCTTTTTCTGAAGAGG + Intergenic
990002204 5:50907698-50907720 GAGCCTTGACCTTGGTGAAGTGG + Intergenic
992941859 5:81770471-81770493 GAACCTAGAAGGTCGTGAAGGGG - Intergenic
993499261 5:88646065-88646087 AAGTCTAAATGTGTGTGAAGAGG - Intergenic
997098842 5:130945396-130945418 GAGCCAAGATATTTGGCAAGAGG - Intergenic
1001255671 5:170181826-170181848 GAGCCTGGAGGTTTGTCAGGAGG + Intergenic
1002103090 5:176866961-176866983 GAGCCCAGAGGCTTGTGAGGAGG + Intronic
1005326202 6:24703088-24703110 GAGCCTAGGAGTTTGAGACGAGG - Exonic
1006832439 6:36976964-36976986 GAGCCTAGATGCCTTTGCAGAGG - Intronic
1007293544 6:40804593-40804615 GAGCTAAGATGTGTGTGCAGTGG + Intergenic
1008144940 6:47879754-47879776 CAGCCTCTATGTTTGTGAATGGG + Exonic
1014548404 6:122759180-122759202 GAGCCTAGATGTTCCTCATGGGG + Intergenic
1014577578 6:123092456-123092478 GATCCTAAATGTTGGTGGAGGGG + Intergenic
1015620887 6:135130442-135130464 CAGAATAGATGTTTGTTAAGAGG - Intergenic
1022465786 7:30652610-30652632 GAGCAGAGATGTTTCTGAAGGGG + Intronic
1023459053 7:40374856-40374878 GAGCCTAGGTTTTCATGAAGGGG + Intronic
1027516864 7:79153108-79153130 GAGCCTAGATTCTAGTGAAAGGG + Intronic
1027755683 7:82209089-82209111 GAGTGTAGATGTGTGTGAATTGG - Intronic
1027933360 7:84569141-84569163 GTCCCCAGATGTATGTGAAGTGG + Intergenic
1028131346 7:87177938-87177960 CAGCCAAGATATTTATGAAGAGG - Intronic
1030896445 7:115066337-115066359 GAGCCCAGCTGTGTGTGAAGGGG + Intergenic
1036153827 8:6323717-6323739 GAGCCCAGAAGTTTGAGAACAGG - Intergenic
1040922441 8:52637414-52637436 GAGCCTAGGGGTTTGTGAACAGG - Intronic
1042998025 8:74722186-74722208 GAGCCTTGATTTTTTTGAGGGGG - Intronic
1044131555 8:88530256-88530278 GAGCCTAGATATTTATGAATAGG + Intergenic
1050148378 9:2593789-2593811 AAGCCTAGAAGTTAGAGAAGAGG + Intergenic
1050916474 9:11141494-11141516 GAGCCTAGATCTTAGTGTACAGG - Intergenic
1051155419 9:14139162-14139184 GAGCCTAGATCTTTGTTCAAGGG - Intronic
1051359450 9:16269143-16269165 GGGCCTGGATGTGTGTGTAGAGG + Intronic
1051907172 9:22108564-22108586 AAGCCTCCATGTTTGTTAAGGGG - Intergenic
1052431765 9:28375779-28375801 GAGCCTAAACTTTTGTGAACAGG - Intronic
1057065058 9:92041513-92041535 AAGCCTAGATGGCTGTAAAGTGG + Intronic
1057901754 9:98954455-98954477 GTGTCTAGATGATTGTTAAGGGG - Intronic
1057959149 9:99438138-99438160 GATCCTATATGTTTGGGAGGGGG - Intergenic
1058654927 9:107211649-107211671 GTGTCTTGATGTTTATGAAGGGG + Intergenic
1059958227 9:119540647-119540669 GTGAGTAGATGTTTGTTAAGTGG + Intergenic
1060455696 9:123793732-123793754 GATCCTAGTAGTTTGTGAATAGG - Intronic
1061254807 9:129448637-129448659 GGCCCTAGATATTTGTTAAGTGG + Intergenic
1061537300 9:131258045-131258067 GGTCCTGGATGTTTCTGAAGTGG - Intergenic
1187249592 X:17584740-17584762 GAGACTATTTGTTTGTGAAAAGG - Intronic
1187950095 X:24463301-24463323 GAAGCTGGATGTTTGTGGAGAGG - Intergenic
1196080872 X:111629457-111629479 GAGCCTATATTTTTGTGTAAAGG - Intergenic
1196434063 X:115659093-115659115 GAGCCTAGGAGTTTGAGAACAGG + Intergenic
1197249239 X:124197552-124197574 GAGTCTAGATGTTTGTTTAACGG + Intronic
1197580478 X:128276990-128277012 CAGCCTAGATGTCTTTCAAGAGG + Intergenic