ID: 1102243373

View in Genome Browser
Species Human (GRCh38)
Location 12:111339448-111339470
Sequence GTCTCTTGTAGGGCTGGGCA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 397
Summary {0: 1, 1: 0, 2: 1, 3: 44, 4: 351}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1102243360_1102243373 21 Left 1102243360 12:111339404-111339426 CCCATTACCCAGATTCTACATAA 0: 1
1: 0
2: 1
3: 12
4: 170
Right 1102243373 12:111339448-111339470 GTCTCTTGTAGGGCTGGGCAAGG 0: 1
1: 0
2: 1
3: 44
4: 351
1102243364_1102243373 13 Left 1102243364 12:111339412-111339434 CCAGATTCTACATAACAAAGGAC 0: 1
1: 0
2: 1
3: 10
4: 134
Right 1102243373 12:111339448-111339470 GTCTCTTGTAGGGCTGGGCAAGG 0: 1
1: 0
2: 1
3: 44
4: 351
1102243361_1102243373 20 Left 1102243361 12:111339405-111339427 CCATTACCCAGATTCTACATAAC 0: 1
1: 0
2: 1
3: 11
4: 164
Right 1102243373 12:111339448-111339470 GTCTCTTGTAGGGCTGGGCAAGG 0: 1
1: 0
2: 1
3: 44
4: 351
1102243359_1102243373 27 Left 1102243359 12:111339398-111339420 CCTTGGCCCATTACCCAGATTCT 0: 1
1: 0
2: 1
3: 13
4: 240
Right 1102243373 12:111339448-111339470 GTCTCTTGTAGGGCTGGGCAAGG 0: 1
1: 0
2: 1
3: 44
4: 351
1102243358_1102243373 28 Left 1102243358 12:111339397-111339419 CCCTTGGCCCATTACCCAGATTC 0: 1
1: 0
2: 3
3: 23
4: 189
Right 1102243373 12:111339448-111339470 GTCTCTTGTAGGGCTGGGCAAGG 0: 1
1: 0
2: 1
3: 44
4: 351
1102243363_1102243373 14 Left 1102243363 12:111339411-111339433 CCCAGATTCTACATAACAAAGGA 0: 1
1: 0
2: 0
3: 13
4: 211
Right 1102243373 12:111339448-111339470 GTCTCTTGTAGGGCTGGGCAAGG 0: 1
1: 0
2: 1
3: 44
4: 351

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1102243373 Original CRISPR GTCTCTTGTAGGGCTGGGCA AGG Intronic
900800139 1:4732206-4732228 GTCTCTTCTAGGGAAGGGAAAGG - Intronic
900878874 1:5366217-5366239 GTCTCCTCTAGGGCTGGGCTGGG + Intergenic
902948203 1:19859292-19859314 CCATCTAGTAGGGCTGGGCACGG + Intergenic
903189982 1:21651018-21651040 GCCGCTTGTCTGGCTGGGCAGGG + Intronic
903223549 1:21882232-21882254 GTGTGTTGTAAGCCTGGGCAAGG + Intronic
903431031 1:23300164-23300186 GTCACCTTTAGGGCTGGGCATGG + Intergenic
903672675 1:25045908-25045930 CTTTCTTGGAGGGCTGGGCCCGG + Intergenic
903822794 1:26115905-26115927 GTCTGCTTTTGGGCTGGGCATGG + Intronic
904169044 1:28578436-28578458 ATCTCTTTAAGGGCTGGGCATGG + Exonic
904172101 1:28598658-28598680 GCCTCTGGTAGGGCCGGGCACGG - Intronic
904227983 1:29040569-29040591 TATTCTTGTATGGCTGGGCATGG - Intronic
904405612 1:30286291-30286313 GGCTCGTGCTGGGCTGGGCAAGG + Intergenic
904458599 1:30662255-30662277 GGCTCGTGCTGGGCTGGGCAAGG + Intergenic
905703668 1:40038667-40038689 GTCACATGAAGGGCTGGGCGCGG - Intergenic
905943001 1:41878955-41878977 GTCTCTTCCACGGCTGGGGATGG + Intronic
905997304 1:42392439-42392461 GTCTTCTTAAGGGCTGGGCATGG - Intronic
906833325 1:49057983-49058005 GTTTCTTGCAGAGCTGGGTAGGG + Intronic
906931735 1:50176813-50176835 ATCTCTTGTGTGGCTGTGCAGGG + Intronic
907017823 1:51034456-51034478 GTCTCTATGGGGGCTGGGCACGG - Intergenic
907420996 1:54347256-54347278 GTATATAGGAGGGCTGGGCACGG - Intronic
907839709 1:58144831-58144853 GTCTCTTGTAGGCCTGTGTGTGG - Intronic
909703703 1:78555226-78555248 ATCTCTTGTAGGGTTGGTCTGGG - Intergenic
910012485 1:82482614-82482636 GTCTATTGAGGGGCTGGGCTGGG - Intergenic
911024389 1:93421604-93421626 GACTCAAGAAGGGCTGGGCACGG - Intergenic
911272971 1:95825980-95826002 ATATATTGGAGGGCTGGGCATGG - Intergenic
911524888 1:98972801-98972823 GGCTAGTGTAGGCCTGGGCATGG + Intronic
912690982 1:111804514-111804536 GTCACTTGCAGGGCTCCGCAAGG + Intronic
912728999 1:112085105-112085127 ATATCTAGTGGGGCTGGGCACGG - Intergenic
914690538 1:150022105-150022127 ATCTCATGCTGGGCTGGGCATGG + Intergenic
914732457 1:150383605-150383627 ATCTCTTCTTTGGCTGGGCACGG - Intronic
914838838 1:151230930-151230952 GTTAATTTTAGGGCTGGGCATGG + Intronic
915360637 1:155284504-155284526 GTATATTGCAGAGCTGGGCATGG - Intronic
916510418 1:165468034-165468056 GTCTCTTGCTGGACTGGGAATGG + Intergenic
917003632 1:170387842-170387864 AACTCTTGCTGGGCTGGGCATGG + Intergenic
917580505 1:176372978-176373000 ATCTCATTTATGGCTGGGCAGGG - Intergenic
918326772 1:183417902-183417924 GTATCATTTGGGGCTGGGCAGGG - Intronic
919800151 1:201349019-201349041 AGCTCCTATAGGGCTGGGCACGG - Intergenic
920947501 1:210543596-210543618 GTCTTTTGAAGGGGTGGGGAGGG - Intronic
921780662 1:219159086-219159108 GTCTATTGAAGGGCTGGGTGTGG + Intergenic
922373790 1:224940251-224940273 GTCTCTTTAAGGGCTGGGCCTGG + Intronic
922420599 1:225458846-225458868 ATCAGTTGTAAGGCTGGGCATGG + Intergenic
922940646 1:229462172-229462194 ATCAGTTGTTGGGCTGGGCAAGG - Intronic
923025526 1:230200806-230200828 GTCTCTTCTCTGGCTGCGCATGG + Intronic
924302179 1:242651042-242651064 GTCTCTAGCAAGGCTGGGGAAGG + Intergenic
924737288 1:246769570-246769592 GTCTGTCTTTGGGCTGGGCACGG + Intergenic
924798860 1:247312469-247312491 GTCTGTTCATGGGCTGGGCACGG + Intronic
1062865371 10:847817-847839 GTCTCATGTCAAGCTGGGCACGG - Intronic
1063348490 10:5333928-5333950 AGCTCTTGTTAGGCTGGGCACGG + Intergenic
1063809687 10:9690747-9690769 GTCTCCTGGGGGGCGGGGCATGG + Intergenic
1064171990 10:13041915-13041937 TTCTCTGCCAGGGCTGGGCACGG - Intronic
1066393977 10:35001249-35001271 ATCTCATTTTGGGCTGGGCACGG + Intergenic
1067236723 10:44457282-44457304 GTGGATTCTAGGGCTGGGCAGGG + Intergenic
1068341364 10:55708358-55708380 GTCTCTTGTAGGTCAGGTCAAGG - Intergenic
1068786103 10:60976014-60976036 TTCTCTTGTAAGGCTAGGTAAGG + Intronic
1068876223 10:61999532-61999554 CTCTCCTGTAAGGCTTGGCAGGG - Intronic
1071035267 10:81237475-81237497 AGCTCTTGCAGGGCAGGGCAGGG + Intergenic
1072020386 10:91393190-91393212 GTCTCATAAAGGGCTGGGCGCGG - Intergenic
1072952480 10:99859892-99859914 GGTTCGGGTAGGGCTGGGCACGG + Intergenic
1073057481 10:100711575-100711597 TTCTGTTGTGGAGCTGGGCATGG - Intergenic
1073923281 10:108483165-108483187 GTATATTGTTGGGCTGGGCATGG - Intergenic
1074977303 10:118591983-118592005 ATCCTTTCTAGGGCTGGGCATGG - Exonic
1075176857 10:120172463-120172485 GGTTCTTGAAGGGCTGGGGAAGG - Intergenic
1075827596 10:125373059-125373081 GTGCCAAGTAGGGCTGGGCATGG + Intergenic
1075928267 10:126271048-126271070 GGCCCTTGTAGAACTGGGCATGG - Intronic
1076302911 10:129441584-129441606 GTCTCCTGTTGGGCTGGCCCAGG + Intergenic
1077309719 11:1882954-1882976 GTCATTTGGAGGGCTAGGCAGGG - Intronic
1077461423 11:2712666-2712688 CTCTCCTGTAGGCCTGAGCAGGG - Intronic
1078013396 11:7591836-7591858 TTCTGTTCTAGGACTGGGCATGG + Intronic
1078875278 11:15388660-15388682 GTCTCTAATATGGCTCGGCATGG + Intergenic
1080204444 11:29712874-29712896 GCCTCCTGCAGGGCAGGGCAGGG + Intergenic
1081794251 11:45808710-45808732 CTCTGTGGTTGGGCTGGGCATGG + Intronic
1081905308 11:46665541-46665563 GTCTCTGGTAAGGCTGGCCAGGG + Intronic
1082052714 11:47785419-47785441 TTTCCTTGTAAGGCTGGGCATGG - Intronic
1083556200 11:63630505-63630527 GGCTATTTTTGGGCTGGGCACGG + Intronic
1084460297 11:69293296-69293318 GTGTCCTGGAGAGCTGGGCAGGG + Intergenic
1085244852 11:75092653-75092675 GGCTTTTGTTAGGCTGGGCATGG + Intergenic
1085606907 11:77909090-77909112 GTCTCTCGCCGGACTGGGCAAGG + Intronic
1086191043 11:84079571-84079593 AGCTGTTGTAGGGCTGGACACGG - Intronic
1088285879 11:108187158-108187180 TGCTCTTTTATGGCTGGGCATGG + Intronic
1088346389 11:108831113-108831135 TACTCTTATCGGGCTGGGCATGG + Intronic
1088466337 11:110143811-110143833 GTATCTTTTTAGGCTGGGCACGG - Intronic
1088494972 11:110423523-110423545 ATCTCTTGTAGGGCTGTCCTGGG - Intergenic
1089218316 11:116849440-116849462 GTCTTTTGGAGGGCTGGTCCAGG - Intronic
1089475766 11:118760456-118760478 TTCTGTTGTGGAGCTGGGCATGG - Intronic
1090795938 11:130135688-130135710 TTCTCAGGTAGGGCTGGGAAGGG - Exonic
1092123866 12:6062685-6062707 GGCTCTTGTGGGGCTGGGGAAGG - Intronic
1094119707 12:26958068-26958090 ATTTCTTAAAGGGCTGGGCATGG + Intronic
1096093938 12:48922097-48922119 GCCTCTGGTAGGGATGGCCATGG - Exonic
1096573205 12:52536491-52536513 GAGTATTGTAGGGCTGGGCACGG + Intergenic
1096709108 12:53442531-53442553 GTCTCTTTTCTGGCTGGGCGCGG - Intronic
1097834872 12:64263002-64263024 GTCACTTGTCAGGCCGGGCATGG + Intergenic
1098037942 12:66325375-66325397 GTCTCCAGTATGGCTTGGCATGG + Intronic
1101618583 12:106361709-106361731 TTCTCAAGTAGGGCTGGGAATGG - Intronic
1101810835 12:108106465-108106487 AACTCTTTTAGGGCTGGGTATGG - Intergenic
1102091083 12:110188632-110188654 GTCTTTTGTCAGGCTGGGCACGG + Intronic
1102243373 12:111339448-111339470 GTCTCTTGTAGGGCTGGGCAAGG + Intronic
1102399258 12:112614391-112614413 ATCCTTTGTGGGGCTGGGCATGG + Intronic
1106021567 13:25920607-25920629 GGTTCTTGTGAGGCTGGGCAGGG - Intronic
1106203280 13:27562709-27562731 GTGTGTTGCAGGGCTGGGAAAGG + Exonic
1106482348 13:30146364-30146386 GTCTGTTTTTAGGCTGGGCATGG + Intergenic
1106994578 13:35466757-35466779 TTTTTTTTTAGGGCTGGGCATGG - Intronic
1107685560 13:42894704-42894726 TTTTTTTGTAGGTCTGGGCAAGG + Intronic
1107698848 13:43026742-43026764 ATATCTTGTTGGGCTGGACATGG + Intronic
1109980719 13:69902747-69902769 GTCTGTTGTAGGGTTGGGGGAGG + Intronic
1111369969 13:87304645-87304667 GGCTCTTGTGGGACTGGGCCCGG - Intergenic
1111597638 13:90431986-90432008 GTCTCTTGTAGGGCTGTCCTGGG + Intergenic
1115579646 14:34745531-34745553 GTCTCATCATGGGCTGGGCATGG - Intergenic
1115765082 14:36614938-36614960 ATCAATTGTGGGGCTGGGCATGG + Intergenic
1116632753 14:47355726-47355748 TTCTCTTGTAGAGGTGGGGAAGG - Intronic
1117276101 14:54195419-54195441 GTCTTTGACAGGGCTGGGCACGG + Intergenic
1117637419 14:57759287-57759309 ATCTTTTGAGGGGCTGGGCATGG + Intronic
1122206422 14:100150142-100150164 GTCTCCTGTCAGGCAGGGCAAGG + Intronic
1122949040 14:105030621-105030643 GCCCCTTTTGGGGCTGGGCATGG + Intergenic
1125538935 15:40458794-40458816 GCCGCTTGCGGGGCTGGGCAAGG - Exonic
1125887423 15:43239088-43239110 GTTTGTTGCAGGGCTGGGCAGGG + Intronic
1126443224 15:48714264-48714286 GTCTATAATAAGGCTGGGCATGG - Intronic
1129235610 15:74222094-74222116 GACTCTTGGAGGGCTGGAAAGGG + Intergenic
1130014727 15:80177722-80177744 GTCTCTTTTAGGAGTGGCCATGG + Intronic
1130354759 15:83119130-83119152 GTGGCTTGCTGGGCTGGGCATGG - Intronic
1130867782 15:87947167-87947189 GAGACTTGTAGGGCCGGGCACGG - Intronic
1131088038 15:89594481-89594503 TTCTCTGGTAGAGCTCGGCAAGG - Exonic
1131162396 15:90115798-90115820 GTTTCTTGTAAGGCAGGGAAAGG + Intergenic
1132796261 16:1724731-1724753 GGCTCTGGTTGGGGTGGGCATGG + Intronic
1133137767 16:3723924-3723946 ATCTCAGGTTGGGCTGGGCATGG - Intergenic
1133806970 16:9133189-9133211 TCCTCTTTTAAGGCTGGGCACGG - Intergenic
1133977658 16:10611474-10611496 ATCAGTTTTAGGGCTGGGCATGG + Intergenic
1134906929 16:17987906-17987928 ATCTCTCATAGGGCCGGGCACGG - Intergenic
1135567068 16:23519331-23519353 ATCTTTTCCAGGGCTGGGCACGG - Intronic
1136123959 16:28162845-28162867 GTTTATTACAGGGCTGGGCATGG - Intronic
1136706179 16:32189746-32189768 GTCTCTTTTGCGGCTGGACACGG - Intergenic
1136761731 16:32739659-32739681 GTCTCTTTTGCGGCTGGACACGG + Intergenic
1136806369 16:33130730-33130752 GTCTCTTTTGCGGCTGGACACGG - Intergenic
1137599859 16:49749231-49749253 GTTTCTTGTGGGGGTGGGCTGGG - Intronic
1138657971 16:58501537-58501559 GTCCCTTGGAGCGCTGCGCAAGG - Intronic
1138766654 16:59613364-59613386 TTCTCTTGCAGGCCTGGGCAGGG - Intergenic
1139200294 16:64969065-64969087 GTCTCTTATAGGAGAGGGCAGGG + Intronic
1139613072 16:68072721-68072743 GTGTCCTGGAGGGCTGGGGAAGG + Intronic
1141398202 16:83723492-83723514 GTCACATGAAGGCCTGGGCAAGG - Intronic
1203063888 16_KI270728v1_random:999974-999996 GTCTCTTTTGCGGCTGGACATGG + Intergenic
1143068094 17:4265553-4265575 GTCTCATGCTGGGCCGGGCATGG - Intergenic
1143143929 17:4760858-4760880 AGCTCCAGTAGGGCTGGGCATGG - Intergenic
1143234586 17:5388289-5388311 GTCTCAAGTTAGGCTGGGCACGG - Intronic
1143510222 17:7391332-7391354 CTCTCATGCAGTGCTGGGCAAGG - Intronic
1143723296 17:8828571-8828593 GTCTGTGGTAGGCCTGGGCCAGG + Exonic
1143767636 17:9148075-9148097 GCCTCTTGAGGGGCTGGGTAGGG + Intronic
1143895302 17:10131325-10131347 GTCTCATGTATTCCTGGGCAGGG + Intronic
1143945886 17:10591640-10591662 GTCAATTGGTGGGCTGGGCACGG - Intergenic
1144202569 17:12954491-12954513 GCCTCTTGGAGGGTGGGGCATGG + Intronic
1145228121 17:21148203-21148225 TTATTTTTTAGGGCTGGGCATGG - Intronic
1145372858 17:22321999-22322021 GTTTCTTGGAGGGCTGGGGCAGG - Intergenic
1146134380 17:30305667-30305689 GACTTTTGTGGGGCTGGGCGCGG - Intergenic
1147239313 17:39080119-39080141 GTTTCTTTTAGGGCTGGGTGTGG + Intronic
1147392744 17:40120710-40120732 GACTATTTCAGGGCTGGGCACGG + Intergenic
1147983474 17:44289829-44289851 ATATCTTATTGGGCTGGGCATGG + Intergenic
1148927603 17:51101055-51101077 GACCCTTATGGGGCTGGGCATGG + Intronic
1150095406 17:62370362-62370384 GTGTATTTTTGGGCTGGGCATGG + Intronic
1150265405 17:63829320-63829342 GACTCTTGAAGGACAGGGCAGGG + Intronic
1150742799 17:67792995-67793017 CACTTTTGTAGGGGTGGGCATGG - Intergenic
1151585873 17:75008086-75008108 GTGTGGTGTGGGGCTGGGCATGG + Intergenic
1151659077 17:75509217-75509239 GGCTCTTGAAGTGCTGGGGAGGG + Intronic
1151707852 17:75780382-75780404 GTCTCTTGGTGGGGTGGGAAGGG + Intronic
1152098276 17:78285632-78285654 TGTTCTGGTAGGGCTGGGCAGGG + Intergenic
1152241639 17:79164169-79164191 GCCTCTGGGAGGGGTGGGCATGG + Intronic
1152923626 17:83078122-83078144 GTCACTTGATGTGCTGGGCAAGG + Intergenic
1153615069 18:6926626-6926648 GTCTCCTGTGAGGCCGGGCATGG + Intergenic
1153642559 18:7169414-7169436 GTCTCTTGTAAGGCCTGGGAGGG + Intergenic
1154129816 18:11727162-11727184 GGGCCTTGCAGGGCTGGGCAGGG - Intronic
1154312095 18:13274871-13274893 GTATCTTAAAGAGCTGGGCATGG + Intronic
1154392772 18:13955240-13955262 GTCTCTTGTAAGGCAGGTCTGGG - Intergenic
1156238489 18:35228269-35228291 ATTTTTTGTGGGGCTGGGCACGG + Intergenic
1157009179 18:43625891-43625913 GTCTCATGTGGGGTTGTGCATGG + Intergenic
1157261693 18:46180969-46180991 GTCGTTTTTTGGGCTGGGCATGG + Intronic
1157762924 18:50277192-50277214 GTCTCCTGTGGGGCTAGGGATGG + Exonic
1158066687 18:53419064-53419086 GTTTTTTGTAGGGTTGGGTAAGG + Intronic
1159884984 18:73895307-73895329 GTCACTTGGTGGGCAGGGCAGGG + Intergenic
1160441249 18:78894508-78894530 GTTTCCTGAAGGGCTGGGCAGGG + Intergenic
1161645538 19:5451223-5451245 GGCTCCTTGAGGGCTGGGCAGGG + Intergenic
1162197631 19:8998013-8998035 GCGTCTTGGAAGGCTGGGCACGG + Intergenic
1162909614 19:13842148-13842170 GTCTCTTGTTGGGCAGGGGCTGG - Intergenic
1163379604 19:16956401-16956423 GTCTTCTGGAAGGCTGGGCATGG - Intronic
1163862211 19:19748382-19748404 CTGGCCTGTAGGGCTGGGCAGGG + Intergenic
1164552358 19:29222143-29222165 GTCTCTTGCAGGGCAAGCCAGGG - Intergenic
1164680284 19:30130021-30130043 ATGTCCTGAAGGGCTGGGCACGG + Intergenic
1165048509 19:33125664-33125686 GTTTTTTTAAGGGCTGGGCATGG - Intronic
1165359649 19:35328345-35328367 ATATCTTGTAGGACTGGGCATGG - Intronic
1166321873 19:42023684-42023706 GCCTCTTGCTGGGCTGGGCAAGG + Intronic
1166683221 19:44780887-44780909 GTCGCCTGTGGGGATGGGCAAGG - Exonic
1166938375 19:46348602-46348624 TCTTCTTGTAGGGCTGGGCGTGG - Intronic
1167002104 19:46751855-46751877 GCATCTTGGTGGGCTGGGCATGG - Intronic
1167242591 19:48353472-48353494 GTTTGTTGTTGGGCCGGGCATGG - Intronic
1167497189 19:49826614-49826636 CTCTCTTGGAGGGCTGCACAGGG + Intronic
1168393841 19:56032049-56032071 ATCTGATGCAGGGCTGGGCACGG + Intronic
925134090 2:1514532-1514554 CCCTCTGGTGGGGCTGGGCAAGG - Intronic
925909773 2:8566069-8566091 GTCTCTTCTAGGCCTGGGTCAGG - Intergenic
926806194 2:16713988-16714010 TTCTTTTGTAGGGCTGGAAATGG + Intergenic
927064500 2:19457673-19457695 CTATCTCTTAGGGCTGGGCATGG - Intergenic
927283219 2:21329266-21329288 ATTTCTTTTTGGGCTGGGCATGG - Intergenic
927872153 2:26630480-26630502 GTCTCTTGGAGGGCTGTGGCGGG + Intronic
929087936 2:38186792-38186814 ATCTCTTGGTCGGCTGGGCACGG - Intergenic
929206073 2:39294847-39294869 GTCTCCTGTAGGGGTCTGCAAGG + Intronic
930513704 2:52379897-52379919 GTCTCTTGAGGGGCTGAGCGTGG + Intergenic
931693963 2:64858558-64858580 CTTTCCTGTAGGGCTTGGCAAGG + Intergenic
931726241 2:65113788-65113810 ATCTTTTGAGGGGCTGGGCATGG + Intronic
932168079 2:69526596-69526618 GTTGCTAGTACGGCTGGGCATGG - Intronic
932611105 2:73200913-73200935 GTCTGTTGTAGGGCTGGGTGCGG + Intergenic
933319000 2:80748305-80748327 GTCTCTGGGAGGGTTGGGTAGGG + Intergenic
933973467 2:87489238-87489260 GTCTAGTGCAAGGCTGGGCATGG - Intergenic
934083965 2:88494041-88494063 TTCTCTGCTAGGGCTGGGCGCGG + Intergenic
934094008 2:88581898-88581920 GTACCTTGCAGGGCTGGGCCAGG + Intronic
935257271 2:101321886-101321908 AAAACTTGTAGGGCTGGGCATGG - Intergenic
935300367 2:101688501-101688523 GTGTGTTGCAGGGCTAGGCATGG + Intergenic
936320258 2:111460975-111460997 GTCTAGTGCAAGGCTGGGCATGG + Intergenic
936644416 2:114352022-114352044 TTCTATTTTTGGGCTGGGCATGG - Intergenic
937065072 2:119011623-119011645 GGCTCCTGGAGGGCTGAGCACGG - Intergenic
937985370 2:127635908-127635930 GTCCCTGGTCGGGCTGGGGAAGG + Intronic
938085606 2:128398622-128398644 ATCAACTGTAGGGCTGGGCACGG - Intergenic
941552941 2:166939389-166939411 TTCTTTTCTTGGGCTGGGCACGG + Intronic
943718037 2:191173643-191173665 ATGTCTTTAAGGGCTGGGCACGG - Intergenic
944447936 2:199810506-199810528 GCCTCTTGTATAGCTGGGGATGG - Intronic
945882989 2:215345826-215345848 TTCTCTTGTAGCTGTGGGCAGGG + Intronic
947363747 2:229372740-229372762 GGCTCCTGTAGGACGGGGCAGGG + Intronic
948023103 2:234753414-234753436 GGCTCTTGTAGGTCTGCCCAAGG - Intergenic
948811655 2:240481474-240481496 GACTCTTCGAGGGCAGGGCATGG + Intronic
1168945850 20:1756716-1756738 GTGTTTTAGAGGGCTGGGCATGG - Intergenic
1169798833 20:9494895-9494917 GTCGCTTGTATGGCTGTGCTTGG + Intergenic
1170251110 20:14283788-14283810 CTCTTTTGTATGGCTGGGCATGG - Intronic
1170599994 20:17834622-17834644 GTCAGTTGTGGGGCTGGGCAAGG - Intergenic
1172887448 20:38240751-38240773 GTTTCTGCTAGGGCAGGGCATGG + Exonic
1173850442 20:46214518-46214540 GTGTTTTGTAGGGCAGGCCAAGG - Intronic
1174104230 20:48150766-48150788 GTCACTGGTAGGGGTGGGGATGG + Intergenic
1178936290 21:36865093-36865115 GTCAGTTGTGGGGCGGGGCAGGG + Intronic
1179399306 21:41069500-41069522 GTAAATTGTAGGGCTGGGCATGG + Intergenic
1181332624 22:22105867-22105889 GACACTTGTATGGCCGGGCACGG + Intergenic
1181854290 22:25771053-25771075 ATCTCTTGCAGGACTGGGGAAGG - Intronic
1183710534 22:39500985-39501007 GTCTGTTGCAGGGCTGGGCACGG - Intronic
1184186099 22:42866419-42866441 GTCTGTGGAAGGGCTGGGGAGGG + Intronic
1184670825 22:46011601-46011623 TTCTCCTGAATGGCTGGGCAAGG - Intergenic
1184749808 22:46478840-46478862 GTCTCATCTTCGGCTGGGCACGG - Intronic
950480604 3:13241502-13241524 GTGACTTCAAGGGCTGGGCAAGG - Intergenic
951150809 3:19287872-19287894 GTCGAATGTGGGGCTGGGCATGG - Intronic
952836149 3:37603878-37603900 TTGTCTTGTTGGGCTGGGGAAGG + Intronic
953393219 3:42545772-42545794 GTCAACTGCAGGGCTGGGCAAGG + Intergenic
954004663 3:47581125-47581147 GTCTCAAGTTGGGCCGGGCACGG - Intergenic
954252378 3:49377856-49377878 AACTCTTTTTGGGCTGGGCACGG + Intronic
954273106 3:49524690-49524712 GTATATTTAAGGGCTGGGCATGG + Intronic
954782912 3:53073814-53073836 GTCTCCCGCAGGGCTGGGTAGGG - Intronic
954805856 3:53220062-53220084 GCCACCTGTAGGGCTGGGGAGGG - Intergenic
958441748 3:94164135-94164157 GTCTCAGTTAGGGCCGGGCATGG + Intergenic
960362729 3:116734210-116734232 GGCTATTGTAGGGCCAGGCACGG - Intronic
962415399 3:135177439-135177461 GCCTGTTGTACGGGTGGGCAGGG - Intronic
962501949 3:136003883-136003905 GTCTCTTGGTTGGCTGGGGAGGG - Intronic
963017389 3:140838953-140838975 GTCTCATTGAAGGCTGGGCATGG - Intergenic
963413661 3:144964734-144964756 GCCTGTTTAAGGGCTGGGCAAGG - Intergenic
963798495 3:149655152-149655174 AAATCATGTAGGGCTGGGCATGG + Intronic
964003912 3:151808018-151808040 GTCTGTTGGCAGGCTGGGCAAGG - Intergenic
964343966 3:155737485-155737507 ATCTCTAGGAGGGCAGGGCATGG - Intronic
965080222 3:164023819-164023841 GTCTGTTGGCAGGCTGGGCAAGG + Intergenic
965691453 3:171361184-171361206 GTCTGATGTTGGGCTGGGGAAGG - Intronic
968078300 3:195829303-195829325 GGCTACTGTAGGGCTTGGCAGGG - Intergenic
968314484 3:197711542-197711564 TTCTCTGGAAGGGCTGGGCATGG + Intronic
969946404 4:10787853-10787875 GTCTAGTGTTGGGCTGGGCATGG + Intergenic
971202910 4:24529327-24529349 GTTTCTTCAGGGGCTGGGCATGG - Intronic
971304238 4:25466117-25466139 AGGTCTGGTAGGGCTGGGCAGGG + Intergenic
971897668 4:32618451-32618473 ATACCTTGCAGGGCTGGGCAAGG + Intergenic
972690857 4:41396438-41396460 GCATCTTGTTGGGCTGGGAAGGG - Intronic
973376578 4:49291240-49291262 GTCTCTTGTGAGGCTGGGTGTGG + Intergenic
975746016 4:77474851-77474873 ATCTCTTTTAGGGCTGGTCTTGG - Intergenic
978308869 4:107363851-107363873 GTCACTTCACGGGCTGGGCATGG + Intergenic
978524450 4:109651373-109651395 GGCTATTCTAGGGCTGGGCATGG - Intronic
978760946 4:112356173-112356195 GGCATTTGTAGGGCTGGGAAGGG - Intronic
979597539 4:122550847-122550869 ATATCTTCTGGGGCTGGGCATGG + Intergenic
981679006 4:147372865-147372887 GTTTATTCTAGGGCTGGGGAAGG - Intergenic
981745448 4:148048111-148048133 CTCTCTGGATGGGCTGGGCATGG - Intronic
981799695 4:148640995-148641017 GTCTTTTTCAGGGCTGGACAGGG + Intergenic
984138658 4:175974509-175974531 GTGTCATTTAGGGCTGGGCATGG - Intronic
985027502 4:185752564-185752586 GTCTGCTGCAGGGCTGGGCACGG - Intronic
985440975 4:189982198-189982220 GGCTCTAGGAGGGCTCGGCATGG - Intergenic
986404955 5:7416355-7416377 GCCCCTTGGAGGGCTGGGCGCGG + Intronic
989463824 5:41731158-41731180 GCCTCTTGTGGGGGAGGGCAGGG - Exonic
989481918 5:41940550-41940572 ATGTATTTTAGGGCTGGGCACGG - Intronic
990375689 5:55168195-55168217 GTCTCTTGCAGAGCAGTGCAGGG + Intronic
991722713 5:69508629-69508651 GTATCTAGTCCGGCTGGGCACGG - Intronic
991949138 5:71931086-71931108 ATATCTTGTTGGGCTGGGCTCGG - Intergenic
993999409 5:94760973-94760995 TTTTGTTATAGGGCTGGGCATGG - Intronic
995483470 5:112615504-112615526 ATACCTTGCAGGGCTGGGCAGGG - Intergenic
996909280 5:128636541-128636563 GTTTCTTGGAGGCCTGGGCCTGG + Intronic
997328030 5:133038155-133038177 GTTCCATGTATGGCTGGGCATGG + Intergenic
997370273 5:133355365-133355387 GTCTAGTTTTGGGCTGGGCATGG + Intronic
997389919 5:133506034-133506056 GTCTCTTTTGGAGCTGGGGAAGG + Intronic
998656962 5:144192018-144192040 GTTTCTTATAGGGCTTGGCAGGG + Intronic
999019459 5:148147420-148147442 GCCTCTTTTAGGGCTGGGCTGGG + Intergenic
999174324 5:149621170-149621192 ATCTTTTCTAAGGCTGGGCAAGG + Intronic
1000605727 5:163325575-163325597 TTATATTGTAGGGCCGGGCACGG - Intergenic
1001507257 5:172289558-172289580 ATTTCTTTTTGGGCTGGGCACGG + Intergenic
1003122582 6:3330076-3330098 GTGTGTTCTGGGGCTGGGCAGGG - Intronic
1004007739 6:11652490-11652512 ATCTCTGGTGCGGCTGGGCATGG - Intergenic
1004346255 6:14851970-14851992 AATACTTGTAGGGCTGGGCATGG + Intergenic
1004620238 6:17325102-17325124 GTCTGTTGGCAGGCTGGGCAAGG + Intergenic
1004970450 6:20904243-20904265 GTCTAGTCCAGGGCTGGGCATGG + Intronic
1005028810 6:21490601-21490623 TTCTTTTTTAAGGCTGGGCATGG - Intergenic
1005651533 6:27889666-27889688 GTCTCTTGTCAGGGTGGGCGTGG - Intergenic
1006190462 6:32204430-32204452 GTCCCTTGTAGTGCTGGGTTGGG - Intronic
1006271927 6:32971759-32971781 GTCTCCAGTTGGGCTGTGCATGG + Exonic
1007790951 6:44307846-44307868 ATCTTTTGTGGGGGTGGGCAGGG + Intronic
1007848290 6:44779363-44779385 GTCTCTTGAAGGGCTCACCAAGG - Intergenic
1007966353 6:46006960-46006982 ATGTCTTTTGGGGCTGGGCATGG - Intronic
1008614753 6:53215679-53215701 GTCCCTTGTAGGGCTGTGTCAGG + Intergenic
1011045819 6:83081395-83081417 GTTGGTTGTAGGGCTGGGCATGG - Intronic
1012559292 6:100559557-100559579 TTCTGTTACAGGGCTGGGCATGG + Intronic
1013656958 6:112255897-112255919 GTCTCATTTAGGGCTGGGCGTGG + Intergenic
1014578757 6:123108254-123108276 GTCTGTTGTGGGGCTGGGTTGGG - Intergenic
1015174317 6:130289788-130289810 ATCTTTTCTTGGGCTGGGCACGG - Intronic
1015213857 6:130727591-130727613 GTTTCTTTGAGGGCTGGGCCAGG - Intergenic
1015623998 6:135160862-135160884 GTATATAGGAGGGCTGGGCATGG - Intergenic
1015795811 6:137009892-137009914 GTGTCTTTTAAGGCTGGGCGCGG - Intronic
1016479061 6:144462059-144462081 GTCTGTTGGAGGGTGGGGCATGG - Intronic
1017084721 6:150703314-150703336 AGCTCTTGTCTGGCTGGGCATGG + Intronic
1017166278 6:151411247-151411269 ATCTCTTATAGGGCCGGGCATGG - Intronic
1018129769 6:160717959-160717981 ATTCATTGTAGGGCTGGGCACGG + Intronic
1018905038 6:168071084-168071106 GACTCCTGCAGGGCTGGCCAAGG + Intronic
1019599337 7:1873568-1873590 GGCTCTTCTGGGGCTGGGCAGGG + Intronic
1022394588 7:29974970-29974992 GAATCATGTAGGGCTGAGCACGG - Intronic
1023367350 7:39476945-39476967 TTCTCTTAGAGGTCTGGGCAAGG - Intronic
1023845561 7:44118130-44118152 CTCTCATGGAGTGCTGGGCAGGG - Intronic
1024004082 7:45212553-45212575 GTCTCCTGTAGGGTGGGACAAGG - Intergenic
1024581642 7:50805480-50805502 GTCCTTTGAAGGGCTGGGCAGGG + Intergenic
1024585524 7:50838634-50838656 TTCTCTCGTAGGGCTGAGCTTGG + Intergenic
1024645162 7:51364773-51364795 GTATATTCTAAGGCTGGGCATGG + Intergenic
1025864068 7:65363737-65363759 GTATATTGTGGGGCCGGGCATGG + Intergenic
1028449225 7:90962194-90962216 ATCTAGTGTGGGGCTGGGCATGG + Intronic
1028815317 7:95137233-95137255 GTCTCTTGTGGGGTTGGGGGAGG - Intronic
1029170374 7:98625853-98625875 GTCTTCTCAAGGGCTGGGCATGG + Intronic
1030446054 7:109647341-109647363 TTCTCTTGTGGGGAGGGGCAGGG + Intergenic
1031594037 7:123627021-123627043 GCCTGTTGTGGGGCTGGGCATGG - Intronic
1032253569 7:130278911-130278933 GTCCATTGTAGGCCTGGCCAGGG - Intronic
1034388857 7:150766291-150766313 GCCTCTTATTGGGCTGGGCGCGG - Intergenic
1034625649 7:152490326-152490348 TAATCTTGTAGGGCTGGGCACGG + Intergenic
1034849421 7:154480021-154480043 GTCACCTGTGGGGCGGGGCAGGG - Intronic
1034954570 7:155326713-155326735 GTGTTTTGTGGGGCTGGGCAGGG - Intergenic
1036698768 8:10997227-10997249 GTGTGTTGTTGGGCTGAGCATGG - Intronic
1038153780 8:24967617-24967639 GTATTTTATAGGACTGGGCATGG + Intergenic
1039194279 8:35013690-35013712 GTCTCAAGTGAGGCTGGGCATGG + Intergenic
1040503217 8:48023504-48023526 GTTTCATGTTAGGCTGGGCATGG - Intronic
1040558796 8:48505217-48505239 GGCTCTTCTAGGGATGGGCATGG + Intergenic
1041246232 8:55891017-55891039 TTCCATTGTATGGCTGGGCACGG - Intronic
1042836207 8:73081075-73081097 CTCTCTTCCAGGGGTGGGCAGGG + Exonic
1043006091 8:74820486-74820508 GGCTCTTGTAAGGCAGGTCAAGG + Intronic
1043434431 8:80224459-80224481 GTCTTCTGTCGGGCTGGACATGG + Intronic
1044693392 8:94900184-94900206 GTCTCTTTCAGGGCTGGCCTGGG + Intronic
1045188030 8:99857968-99857990 CTCTCTTCGTGGGCTGGGCATGG + Intronic
1045191007 8:99883590-99883612 GTTTCATAGAGGGCTGGGCATGG - Intronic
1045289343 8:100819105-100819127 CAGTCATGTAGGGCTGGGCATGG + Intergenic
1046557340 8:115790973-115790995 GTCTGTTGTAGTGGTGGCCACGG + Intronic
1047963743 8:130030057-130030079 GTGACTTTTATGGCTGGGCATGG - Intergenic
1048274349 8:133054975-133054997 ATTTTCTGTAGGGCTGGGCAGGG - Intronic
1048600109 8:135910778-135910800 ATCTATTCTAAGGCTGGGCAAGG + Intergenic
1049413900 8:142486502-142486524 GTCTGTTTTAGGCCTGGGGATGG - Intronic
1051206445 9:14693586-14693608 GGCTCAAGTAGGGCTGGGGAGGG - Intergenic
1051634639 9:19170489-19170511 GTGGCTTGTTGGGCTGGACACGG - Intergenic
1052470650 9:28890603-28890625 ATCTCTACTAGGGCTGGGGAAGG + Intergenic
1052859609 9:33428989-33429011 GTTACTTCCAGGGCTGGGCACGG + Intergenic
1053209787 9:36218103-36218125 GTCTCTTCTGGGGCCGGGCTGGG + Intronic
1055119823 9:72646852-72646874 GTGTTCTGTTGGGCTGGGCATGG + Intronic
1055202919 9:73689597-73689619 TTCTGTTTTAGGGCTGAGCATGG - Intergenic
1056001823 9:82225925-82225947 GCCTGTTGGAGGGCAGGGCAGGG - Intergenic
1057001169 9:91511296-91511318 GTCTTTTGTTAGGCTGGGCATGG + Intergenic
1057584627 9:96318137-96318159 GGCTTCTGGAGGGCTGGGCATGG - Intergenic
1059862324 9:118478600-118478622 ATCTCTTTCTGGGCTGGGCACGG - Intergenic
1061759763 9:132842484-132842506 GCCTCATCTGGGGCTGGGCAAGG + Intronic
1061969117 9:134034407-134034429 GGCTCTTGTGGGGCTGGACTGGG - Intronic
1062327442 9:136018983-136019005 GGCTCTTGGGGAGCTGGGCAGGG - Intronic
1185894933 X:3849638-3849660 ATCTCATGTAAGGCTGGGCACGG - Intergenic
1185900051 X:3888063-3888085 ATCTCATGTAAGGCTGGGCACGG - Intergenic
1185905167 X:3926491-3926513 ATCTCATGTAAGGCTGGGCACGG - Intergenic
1186390351 X:9152443-9152465 CTTTCTTGTAGGGATGGGGAAGG - Intronic
1186736731 X:12473281-12473303 AGCTCTTGTAGGGCAGGGCAGGG - Intronic
1187826647 X:23337790-23337812 GTGACTTGTAGGGCTGTGTAGGG + Intronic
1188688346 X:33097903-33097925 GTTACTGGTGGGGCTGGGCATGG - Intronic
1189100098 X:38180144-38180166 GTGTGTTGGAGGGCTGGGCGGGG - Intronic
1189166693 X:38867799-38867821 TTGTTTTGTTGGGCTGGGCATGG - Intergenic
1189235319 X:39482560-39482582 GTTACTTCTAGGGGTGGGCATGG + Intergenic
1189443830 X:41062119-41062141 CTCCATTGTGGGGCTGGGCACGG + Intergenic
1192169055 X:68843218-68843240 GGCTAGTGTAGGGCTGGGCCTGG + Intergenic
1192212945 X:69139297-69139319 GCTTCCTTTAGGGCTGGGCACGG - Intergenic
1192621003 X:72680302-72680324 GTTTCTTTTATGGCTGGGCATGG - Intronic
1195469244 X:105213943-105213965 ATCTCTTGTAAGGCAGGGCCTGG - Intronic
1196000058 X:110773436-110773458 ATATATTGTAGGGCCGGGCACGG + Intronic
1196835441 X:119809428-119809450 ATCTTTTTGAGGGCTGGGCATGG + Intergenic
1198301706 X:135339764-135339786 GGCTCTTCTAGAGCTGGGCAAGG - Intronic
1199427431 X:147719189-147719211 GACTCGGGTATGGCTGGGCACGG + Intergenic
1199431894 X:147771188-147771210 GTCTCTTGTAGGTCTGTCCTGGG - Intergenic
1199978382 X:152907507-152907529 GTCCCTGGCAGGGCTGGGCGGGG - Intergenic
1201310811 Y:12596896-12596918 GTCTCCTGGCGGACTGGGCAAGG + Intergenic
1202111710 Y:21427756-21427778 GTCTTTTCTGGGGGTGGGCAGGG - Intergenic
1202240647 Y:22764422-22764444 AAGTCTTGTAGGGCTGGGCGCGG + Intergenic
1202393633 Y:24398175-24398197 AAGTCTTGTAGGGCTGGGCGCGG + Intergenic
1202477152 Y:25271925-25271947 AAGTCTTGTAGGGCTGGGCGCGG - Intergenic