ID: 1102243651

View in Genome Browser
Species Human (GRCh38)
Location 12:111341607-111341629
Sequence ATGCAGAAGGAGAGTGAGGA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 1049
Summary {0: 1, 1: 0, 2: 5, 3: 97, 4: 946}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1102243651 Original CRISPR ATGCAGAAGGAGAGTGAGGA GGG Intronic
900365911 1:2311931-2311953 ATGCAGAGGTAGGGTGGGGAGGG - Intergenic
900459308 1:2793945-2793967 AAGAAGAAGGAGGGCGAGGAGGG - Intronic
900704369 1:4070702-4070724 ATGTAGAATCAGAGAGAGGAAGG + Intergenic
900811569 1:4805722-4805744 ATTCAGAATGAGAGAGAGCATGG + Intergenic
900919986 1:5663934-5663956 ATGGAGATGGAGACTGAAGAGGG + Intergenic
900932844 1:5747664-5747686 AGGGAGGAGGAGAGGGAGGAAGG + Intergenic
900932855 1:5747714-5747736 AGGAAGAAGGAGATGGAGGAGGG + Intergenic
901017038 1:6237891-6237913 GGGCAGAAGGAGAGCAAGGATGG + Intergenic
901197914 1:7450518-7450540 ATGCAGAAGTAGAGACAGGTGGG + Intronic
901316290 1:8311780-8311802 AAGCAGAAAGAGAGTGAGACAGG - Intergenic
901386124 1:8910467-8910489 ATGGAGCTGGAGAATGAGGAAGG + Intergenic
901472920 1:9470224-9470246 AAGAAGAAAGAGAGGGAGGAAGG + Intergenic
901710054 1:11106770-11106792 CTGCAGAAGGCCAGTGAGGGTGG + Exonic
902098347 1:13965034-13965056 ACACAGCAGGAGAGTGAGGCTGG + Intergenic
902768870 1:18634262-18634284 ATGCAGAAGGAGAGAGGTGCAGG - Intronic
903117830 1:21192678-21192700 TGGCAGCAGGAGAGTGAGGAAGG - Intergenic
903384884 1:22919695-22919717 AGGGAGCAGGAGAGGGAGGAGGG + Intergenic
903947067 1:26970682-26970704 ATGCAGAGGGTGAGGGAAGAGGG + Intergenic
904043471 1:27597293-27597315 ATGCAGAATGAGTGTGAGGGTGG + Intronic
904295762 1:29518859-29518881 AAGGAGAAGGAGAATGAGGAAGG - Intergenic
904319951 1:29690083-29690105 GAGGAGAAGGAAAGTGAGGAAGG + Intergenic
904797696 1:33069822-33069844 ATATAGAATGAGAGTGGGGAAGG - Intronic
904807272 1:33140861-33140883 AAGGAGAAGGGGAGAGAGGAGGG - Intergenic
904894107 1:33801192-33801214 AGAGAGATGGAGAGTGAGGATGG - Intronic
905006566 1:34714621-34714643 CTGCGGAAGGAGAGACAGGAAGG + Intronic
905011245 1:34748302-34748324 CTGTGGGAGGAGAGTGAGGAGGG - Intronic
905356619 1:37389265-37389287 ATTCAGAGGGAGAGTGGGAAGGG - Intergenic
905583882 1:39102500-39102522 AGGCCAAAGGAGAGTGATGAAGG + Intronic
905649349 1:39646215-39646237 ATGGAGCAGGAAAGTGATGATGG - Intergenic
905795364 1:40813114-40813136 AGCCAGCAGGAGAGTGAAGAAGG + Intronic
905945819 1:41900800-41900822 AGGCTGAAGGAGAGGGAGAAAGG + Intronic
905973199 1:42156151-42156173 AGACAGAAGGAGAGAGTGGAGGG + Intergenic
906771488 1:48489136-48489158 AGGGAGAGGGAGAGAGAGGAAGG - Intergenic
907255287 1:53174179-53174201 AGGCAGGAGGAAAGTGAGGGTGG + Intergenic
907477470 1:54715272-54715294 GGGCTGAAGCAGAGTGAGGAAGG - Intronic
908802635 1:67896455-67896477 ATGCAGAGGGATTATGAGGAGGG - Intergenic
908848167 1:68346195-68346217 AGGGAAAAGGAGAGTGAGGCAGG - Intergenic
909252924 1:73381311-73381333 AGGGAGCAGGAGAGTGAGGTGGG - Intergenic
909433984 1:75619107-75619129 AGGAAGAAGGGGAGGGAGGAAGG + Intergenic
910380327 1:86620379-86620401 ATGCAGGAGGGAAGTGAAGACGG - Intergenic
910537465 1:88314665-88314687 ATGCACAAGGAGAGAGAAAAGGG + Intergenic
911161795 1:94688854-94688876 AGGCGGGAGGAGAGTGAGGTTGG - Intergenic
911218345 1:95219973-95219995 GTACAAAAGGAGAGTGGGGAAGG - Intronic
911525368 1:98978349-98978371 ATGGAGAAGAAGATTGAAGATGG - Intronic
912445625 1:109733923-109733945 ATGGACATGGAGAGTGAGTAGGG + Exonic
912962169 1:114206017-114206039 ATAAAGCAGGAGAGTGTGGAGGG + Intergenic
913074900 1:115333756-115333778 ATGAAGAAAGAGAGAGAGGGGGG - Intronic
913532066 1:119740533-119740555 TTGCAGAGGGAGGGGGAGGAGGG + Intronic
913964258 1:143362151-143362173 ATGGAAAAGGAGAGGGAAGAAGG - Intergenic
914792310 1:150889002-150889024 ATTCAGAAGTAGAGTGAGATCGG - Intergenic
915156512 1:153881029-153881051 ATGGACAAGGAGAGGGAGGGGGG - Intronic
915733663 1:158071255-158071277 AGGCAGAGGGAGAGCGAGGAGGG - Intronic
915748912 1:158186272-158186294 ATGCAGAAGGCCAGTGGGGTTGG - Intergenic
916178715 1:162065270-162065292 ATGCAGAAGGAGAGACAGCACGG - Intergenic
916315310 1:163442283-163442305 CTCCATAAGGAGAGTCAGGAAGG + Intergenic
916838141 1:168570439-168570461 ATGAAGAATGAGAGAGAGCATGG - Intergenic
917313592 1:173702588-173702610 AGGAAGAAGGAGAAGGAGGAAGG + Intergenic
917926753 1:179795514-179795536 TGGCAGAAGGTGAGTGAGCAAGG - Intronic
918069512 1:181124595-181124617 AAGCAGAAGGAGGAGGAGGAGGG - Intergenic
918304423 1:183233108-183233130 ATGCAGAAGGGAGGTGAGGCAGG - Intronic
918469966 1:184861726-184861748 AAGGAGAAGGGGAGGGAGGAAGG + Intronic
918966076 1:191350163-191350185 ATGAAGAAGGATAGTGATGATGG + Intergenic
919003043 1:191859620-191859642 AAACAGAAGGAGAGAGAGGAAGG - Intergenic
919263260 1:195226373-195226395 AGGAAGAAAGAGAGGGAGGAAGG + Intergenic
919434826 1:197544954-197544976 AGGGAGAAGGAGAAGGAGGAAGG + Intronic
919548448 1:198953234-198953256 TTAAAGAAGGAGAATGAGGAAGG - Intergenic
919595845 1:199561519-199561541 AAGAAGAAGGAGAAGGAGGAGGG - Intergenic
919765909 1:201127272-201127294 ACCCAGAAGGGGAGGGAGGAGGG + Intergenic
920159848 1:203988159-203988181 ATGAAATAGGAGAGTGAGGTGGG + Intergenic
920246679 1:204593061-204593083 ATGCAGATGTTGACTGAGGATGG + Intergenic
920308282 1:205032756-205032778 AGGCAGAAGGAACGTGAGGCTGG - Intergenic
920341640 1:205278843-205278865 AGTGAGAAGGAGAATGAGGATGG + Intergenic
920365098 1:205444125-205444147 ATGGAAAAGGAGGGGGAGGATGG - Intronic
920960020 1:210655808-210655830 CTGCAGAAGCAGGGAGAGGAGGG - Intronic
920982980 1:210855685-210855707 AGGCAGCAGGTGAGTGGGGAGGG - Intronic
921418584 1:214919808-214919830 ATGGAGAAGGAGAATCAGGAAGG - Intergenic
922224552 1:223634062-223634084 ATCCAGAAGCAGAGTAAAGATGG + Intronic
922244594 1:223783250-223783272 CTGCAGAAGGAACGTGGGGAGGG - Intronic
922434290 1:225588178-225588200 AGGAAGAAAGAGAGGGAGGAGGG + Intronic
922544019 1:226441734-226441756 ATGGAGAAGGCGAGGCAGGAAGG + Intergenic
922723284 1:227909791-227909813 AGGCAGGAGGGGAGGGAGGAGGG + Intergenic
922723315 1:227909872-227909894 AGGCAGGAGGGGAGGGAGGAGGG + Intergenic
922783181 1:228269471-228269493 ATGCAAAAGGAAAGTGAGATTGG - Intronic
922791157 1:228311833-228311855 AGGGAGGAGGAGAGTGTGGAAGG + Intronic
922929813 1:229380330-229380352 TTGCAGAAGGAAAGAGGGGAGGG + Intergenic
923176982 1:231476221-231476243 ATGCAGAAGCACGGGGAGGAGGG - Intergenic
923295877 1:232594548-232594570 TCCCAGAAGGAGAGTGAGGATGG - Intergenic
923357632 1:233176339-233176361 AGGAAGAAGGAGAGAAAGGAAGG - Intronic
923492189 1:234493771-234493793 GGGAAGAAGGAGAGTGGGGAAGG + Intergenic
923566502 1:235080387-235080409 ATGAAGAAAGAGAGAAAGGAAGG + Intergenic
923576314 1:235161904-235161926 TTGCAGAAGGGGAAAGAGGAGGG - Intronic
924064908 1:240210998-240211020 AGGAAGAAGGGGAGGGAGGAAGG - Intronic
924260787 1:242228663-242228685 AGGGAGAGGGAGAGAGAGGAAGG + Intronic
924290353 1:242529852-242529874 AAGGAGAAAGAGAGAGAGGAAGG - Intergenic
924877643 1:248122767-248122789 ATTCAGCATGGGAGTGAGGATGG - Intergenic
924879631 1:248145983-248146005 ATTCAGCATGGGAGTGAGGATGG - Exonic
924882785 1:248180821-248180843 ATTCAGCATGGGAGTGAGGATGG - Exonic
1063159973 10:3412122-3412144 AGACAGCAGGAGAGTGAGGGGGG - Intergenic
1063278401 10:4597188-4597210 ATGCAGGAGCAGGGTGAGGAGGG - Intergenic
1063465037 10:6237414-6237436 TTGCAGAAGGAGGCTTAGGAAGG + Intergenic
1063475571 10:6325895-6325917 CGGCAGAAGGAGCATGAGGAAGG - Intergenic
1063532213 10:6844500-6844522 AAGCAGAAGGCCAGTGAAGAAGG + Intergenic
1064184177 10:13146473-13146495 ATGCACACAGAGAGGGAGGAAGG - Intergenic
1064558008 10:16566758-16566780 ACACAGAAGGAGAGAGAAGAGGG + Intergenic
1065504325 10:26414301-26414323 ATGAAGAAGGAGAGGGTGGGAGG + Intergenic
1065734596 10:28740234-28740256 AAGAAGAAAGAGAGAGAGGAAGG - Intergenic
1066192588 10:33069520-33069542 AGAGAGAAGGAGAGAGAGGAAGG - Intergenic
1066211511 10:33243899-33243921 AAGGAGAAGGAGAGTGGAGAAGG + Intronic
1067543279 10:47173171-47173193 GTGCGGGGGGAGAGTGAGGAGGG + Intergenic
1068143903 10:53040885-53040907 CTCCAGGAGTAGAGTGAGGAGGG + Intergenic
1068271762 10:54736812-54736834 AGGGAAAAGGAGAGTGAGGCAGG + Intronic
1068591826 10:58860892-58860914 ATGCAGAGAGAGAGAGAGCAGGG - Intergenic
1068731012 10:60357861-60357883 TTGCAGAAGGAGAGAGAGTAGGG - Intronic
1068833949 10:61531364-61531386 AGGGAGTAGGAGAGTGGGGATGG + Intergenic
1068861889 10:61855834-61855856 ATACAGTAGGAGACTAAGGAAGG + Intergenic
1069207526 10:65710443-65710465 AAGGAGAGGGAGAGTGATGAGGG + Intergenic
1069298473 10:66877101-66877123 ATGAAGTAGGAGTGAGAGGAGGG - Intronic
1069720117 10:70544494-70544516 AGGCAGGAGCTGAGTGAGGAGGG + Intronic
1070167031 10:73906694-73906716 AGGCAGAAAAAGAGTGAGGAAGG + Intergenic
1070258095 10:74827198-74827220 GTGCAGAGGGAGAGTTAGGGAGG + Intronic
1070276064 10:75008147-75008169 ATGGTGATGCAGAGTGAGGATGG + Intronic
1070313072 10:75287702-75287724 ATGGAGCAGCAGAATGAGGAGGG - Intergenic
1070723654 10:78773561-78773583 AATCAGGAGGAGAGTGAGGGAGG - Intergenic
1070837010 10:79454408-79454430 GTCCGGAAGGAGAGAGAGGAAGG - Intergenic
1071018750 10:81028129-81028151 ATGCAGAGGAAGAGTGGGGAGGG - Intergenic
1071117316 10:82236674-82236696 ATGGAGAAGGAGATAGAGGGAGG - Intronic
1071604352 10:86974502-86974524 ATGAAGAAGAAGAGGGAGGAAGG - Intronic
1071948694 10:90678052-90678074 ATGCAGAAAGAGAAAGAGTATGG - Intergenic
1071959028 10:90790800-90790822 ATGCAGAGAGAGAGAGAGAAAGG + Intronic
1072798879 10:98377964-98377986 ATGAAGAAAGAGGGTAAGGAAGG - Intergenic
1072833013 10:98679228-98679250 CTGCTGATGTAGAGTGAGGATGG - Intronic
1073116372 10:101094080-101094102 ATGCTGAAGGAAAGGGAGAAGGG - Intronic
1073192155 10:101659212-101659234 TTGCCGAAGGGGAGTGAGGGAGG - Intronic
1073290863 10:102412623-102412645 AGGCAGAAGGAGGGTCTGGATGG - Intronic
1073379885 10:103070066-103070088 CTGCACAAGGATAGTGAGAAGGG - Intronic
1073748881 10:106501274-106501296 AAGAAGAAAGAGAGGGAGGAAGG + Intergenic
1074056216 10:109924485-109924507 CAGCTGAAGAAGAGTGAGGAAGG - Intergenic
1074746180 10:116534837-116534859 GGGTAGAAGGAGGGTGAGGATGG - Intergenic
1074763707 10:116685699-116685721 ATGTAGAAAGAGAGGGAGGGTGG + Intronic
1075193588 10:120334236-120334258 TTCCAGATGGAGGGTGAGGAAGG + Intergenic
1075808133 10:125204786-125204808 AGACAGTAGGAGAGTGGGGAGGG + Intergenic
1075976249 10:126698109-126698131 ATGCAGAGGAAGAGTCTGGATGG - Intergenic
1075985327 10:126780088-126780110 ATAGAGATGGAAAGTGAGGAAGG - Intergenic
1076233427 10:128842260-128842282 TTCCAGAAGGAGAGAAAGGACGG + Intergenic
1077309009 11:1880325-1880347 GTGCAGGATGAGAGCGAGGAAGG + Intronic
1077657060 11:4029538-4029560 AGGGAGAGGGAGAGAGAGGAGGG + Intronic
1077916554 11:6615397-6615419 ATGCAGGGTAAGAGTGAGGATGG - Intronic
1078001838 11:7503032-7503054 AGGCAGAAAGAGAGTTTGGAGGG + Intronic
1078125741 11:8561144-8561166 ATGAAGAAGCAGAGATAGGAAGG - Intronic
1078357948 11:10646881-10646903 TAGCTGAAGGAGAATGAGGAAGG - Intronic
1078382447 11:10857079-10857101 ATCCAAAAGGAGACTGTGGAAGG - Intronic
1078391528 11:10939187-10939209 ATGAAGGATGAGAGTGAGCAGGG - Intergenic
1078558748 11:12352783-12352805 CTGTAAAAGGAGAGTGGGGAGGG + Intronic
1079536790 11:21524872-21524894 ATGAGGAATGACAGTGAGGAAGG + Intronic
1080187356 11:29505805-29505827 AGGCTGAAGGAGAGTAAGGTTGG + Intergenic
1080772562 11:35355344-35355366 ATGCAGTAGGAGGGTGTGAAGGG - Intronic
1081575775 11:44317813-44317835 TTGCAGAATGAAAGGGAGGAGGG - Intergenic
1082265323 11:50111602-50111624 ATTCAGCTGGAAAGTGAGGAGGG + Intergenic
1082783567 11:57304225-57304247 AAGCAGGAGGAGAGTGGGGCAGG + Intronic
1082873301 11:57963381-57963403 ATTCACAGGGAGAGAGAGGAAGG - Intergenic
1083150615 11:60789663-60789685 CTGCAAAATGAGAGTGAGGACGG + Intronic
1083160369 11:60850567-60850589 TTGGAGAAGGAGAGGAAGGAGGG - Exonic
1083181531 11:60988915-60988937 CTGGAGGAGGGGAGTGAGGAGGG - Intronic
1083489201 11:63002648-63002670 GTGGAGTAGGAGAGGGAGGAAGG - Intronic
1083690138 11:64402940-64402962 GTGCACAAGGAGAGTGAGGTTGG - Intergenic
1085446815 11:76606298-76606320 TTGCAGCAGAAGAGTGAGAAGGG - Intergenic
1085523840 11:77153226-77153248 ATGCAGATGGAGAGTGGGAGTGG + Intronic
1085632688 11:78132383-78132405 AGGCAGAAGGAGAGTCAGGAAGG - Intronic
1085706919 11:78794716-78794738 ATGTAGAAGGAGATTGAGCCAGG + Intronic
1085753961 11:79188647-79188669 AAGCAGAAGAGAAGTGAGGATGG + Intronic
1085837463 11:79972236-79972258 GTGCAGAAGGAGAGAGAGAATGG - Intergenic
1085983131 11:81748880-81748902 ATGAAGAAGGAGAAGGAGAAGGG - Intergenic
1086079574 11:82889397-82889419 AAGAAGAAGGAGAAGGAGGAGGG + Intronic
1086164425 11:83761158-83761180 AAGCAGAATGACAGTGAGAATGG + Intronic
1086439451 11:86813728-86813750 ATGGAGAAGGAGACTTATGAAGG + Intronic
1086858239 11:91892654-91892676 AGGAAAAAGGAGAGGGAGGAAGG - Intergenic
1086944951 11:92835909-92835931 ATGGGGAAGGATGGTGAGGAGGG - Intronic
1087245423 11:95829985-95830007 ATGTAGAAGGAGAGGGAGTTAGG + Intronic
1087564836 11:99841652-99841674 AAGGAGAAGGAGAATGAAGAAGG + Intronic
1087624940 11:100585477-100585499 AAGCAGAGGCAGAGAGAGGATGG - Intergenic
1088164104 11:106911058-106911080 AGGAAGAAAGAGAGGGAGGAAGG + Intronic
1088192328 11:107239830-107239852 ACCCAGAAGGAGTGAGAGGAAGG + Intergenic
1088596027 11:111440881-111440903 GGGGACAAGGAGAGTGAGGAGGG + Intronic
1088751310 11:112844409-112844431 AGGCAAAAGGAGAGAAAGGAGGG + Intergenic
1089646633 11:119884687-119884709 AAGCAGAATGAAAGTGAGGGCGG - Intergenic
1090259595 11:125309167-125309189 AGGAAGAAAGAGAGAGAGGAAGG - Intronic
1090908205 11:131095842-131095864 ACGAGGAAGGAGAGTGAGGAGGG - Intergenic
1090948370 11:131451413-131451435 ATGCAAAAGGAGTGAGAGGAGGG + Intronic
1091061591 11:132468099-132468121 AAGCAGAAAGAGAGGGAGGCTGG - Intronic
1091095955 11:132822244-132822266 TGGGAGAGGGAGAGTGAGGAGGG - Intronic
1091109039 11:132948278-132948300 AGGCAGAAGGAGTGAGAGGAAGG + Intronic
1091446739 12:548058-548080 CTGCACAAGCAGAATGAGGAGGG + Exonic
1091920640 12:4302107-4302129 ATACAGAAGCAGTGTGAGCAGGG + Exonic
1092100990 12:5883614-5883636 ATGGAGAAGCAGGGTGTGGAGGG + Intronic
1092926860 12:13279354-13279376 AGGCAGATGGAGAAAGAGGAAGG - Intergenic
1093013561 12:14133526-14133548 ATGCAGGAGTAGGGTGAGGGGGG + Intergenic
1093425149 12:19020289-19020311 GTGAAGAAGGAGCGAGAGGAAGG - Intergenic
1093822857 12:23643138-23643160 ATGGGGATGGAGAGTGAGGCAGG + Intronic
1093854828 12:24088870-24088892 ATTCAGAAGGCCAGTGAAGAAGG - Intergenic
1094188001 12:27665359-27665381 ATAGAGGAGGAGAGTGAAGAAGG + Intronic
1094205350 12:27833878-27833900 ACGGAGAGGGAGAGAGAGGAAGG - Intergenic
1094619249 12:32064558-32064580 AAGAAGAAGGAGAGGGAAGAAGG + Intergenic
1094696833 12:32827990-32828012 TAGGAGAAGTAGAGTGAGGAAGG + Intronic
1096038745 12:48495527-48495549 ATGGAGCAGGAGAGTGAAAAGGG - Intronic
1096087248 12:48874013-48874035 AAGAAGAAGAAGAATGAGGAGGG + Intergenic
1096113418 12:49041641-49041663 GTGCAGAAGGTGAGTGGGGCTGG - Exonic
1096556832 12:52409023-52409045 AGGGAGAGGGAGAGGGAGGAGGG - Intergenic
1096847092 12:54413309-54413331 ACGGAAGAGGAGAGTGAGGAGGG + Intronic
1096863114 12:54544323-54544345 ATGCAGATGCAGATGGAGGAGGG - Exonic
1097270622 12:57771942-57771964 GGGCAGAGGGAGAGAGAGGAGGG - Intronic
1097306033 12:58069985-58070007 ATACAGAAGGAAATGGAGGAAGG + Intergenic
1098170890 12:67746076-67746098 AAACAGGAGGAGTGTGAGGAAGG - Intergenic
1098460806 12:70731089-70731111 AGGAGGAAGGAGAGAGAGGAAGG + Intronic
1098573717 12:72016934-72016956 ATGCAGAGGGAGTGAGAGGAGGG + Intronic
1098701310 12:73631187-73631209 AAGAAGAAGGAGAAGGAGGAGGG + Intergenic
1099081066 12:78181843-78181865 ATACAGAAGGAGAAGGAGAAGGG + Intronic
1099732619 12:86525262-86525284 AGGCAGTAGGAGAGAGAGGATGG - Intronic
1100282162 12:93128232-93128254 ATAGGGAAGGAGAGTGAGGGCGG + Intergenic
1100401029 12:94230092-94230114 ATGGAGAATGGGAGGGAGGAGGG - Intronic
1100725442 12:97403591-97403613 ATGCAGCAGGAGGCTGAGGCAGG + Intergenic
1101065101 12:101012801-101012823 TTGCAGTAGGAGGGTGAGAAAGG + Intronic
1101535555 12:105613147-105613169 AGGCAGCAGGAGAGAGAGGAAGG - Intergenic
1102015135 12:109643223-109643245 AAGCTGAGGGAGAGTGAGTAAGG - Intergenic
1102052163 12:109870626-109870648 AAGCAGAAGGAGAGGAAGGAAGG + Intronic
1102119327 12:110428761-110428783 ATGCTGCAGCAGAGTGAGCAAGG - Intergenic
1102243651 12:111341607-111341629 ATGCAGAAGGAGAGTGAGGAGGG + Intronic
1102254536 12:111407820-111407842 GTGGAGGAGGATAGTGAGGAGGG + Intronic
1102487307 12:113266940-113266962 ATGAAGAAGGAGAAACAGGAAGG - Intronic
1102490449 12:113287121-113287143 AGGGAGAAAGAGAGGGAGGACGG + Intronic
1102514143 12:113435288-113435310 AGGGAGAAGCAGAGTGAGGGAGG - Intronic
1102517210 12:113457716-113457738 ATGGAGGAGGAAAGGGAGGAGGG + Intergenic
1102598741 12:114012875-114012897 AGGGAGAGGGAGAGGGAGGAGGG + Intergenic
1102682231 12:114698626-114698648 AGGGAGATGGAGAGAGAGGAGGG - Intergenic
1103024228 12:117560410-117560432 GTGCAGAAGGGGAGCAAGGAGGG + Intronic
1103219475 12:119231884-119231906 AAGGAGAAGGAGGGGGAGGAGGG - Intergenic
1103244699 12:119446599-119446621 AGGGAGAGGGAGAGGGAGGACGG + Intronic
1103480856 12:121248902-121248924 ATGAAGACGGAGAGACAGGACGG + Intronic
1103952735 12:124559975-124559997 ATGCAGTAGGAAAGAGGGGATGG - Intronic
1104285058 12:127417657-127417679 AAGCAGAAGGAAAGTCAGGAAGG - Intergenic
1104357913 12:128104490-128104512 ATGCAGGTGGAGATAGAGGAAGG - Intergenic
1104549952 12:129747186-129747208 AGTAAGAAGGAGAGGGAGGAGGG - Intronic
1104550045 12:129748347-129748369 ACGGAGAATGAGACTGAGGAGGG + Intronic
1104620919 12:130312302-130312324 ATGCAGGAAGAATGTGAGGATGG - Intergenic
1104714375 12:131006638-131006660 ACCCAGAAGGAGAGCAAGGAGGG + Intronic
1105284446 13:18993116-18993138 AAGCAGAAGGAAAGGAAGGAAGG + Intergenic
1105284704 13:18994574-18994596 ATGCAGAAGGCCAGGGAAGAAGG + Intergenic
1106355216 13:28975592-28975614 GTCCAGAAGGAGAGGAAGGATGG - Intronic
1106593387 13:31116934-31116956 GGGCAGAGGGAGAGGGAGGAGGG + Intergenic
1106790595 13:33151833-33151855 ATGCAAAAGGGGAGTGAGAGTGG + Intronic
1107053721 13:36080188-36080210 ATGAAGAAGGAAGGTGAGAAAGG + Intronic
1107230868 13:38108709-38108731 AGCAAGAGGGAGAGTGAGGAAGG + Intergenic
1107232584 13:38128262-38128284 GTGTGGGAGGAGAGTGAGGATGG - Intergenic
1107410698 13:40155962-40155984 ATGAAGATAGAGAGTGAGGGAGG + Intergenic
1107655509 13:42588960-42588982 ATGCAGAAGCTAAGTGAGAATGG - Intronic
1107708202 13:43127609-43127631 AGACAGAGGGAGAGGGAGGAGGG - Intergenic
1108360783 13:49666333-49666355 ATGTGGAAGCAGAGTGGGGAGGG + Intronic
1109689963 13:65873566-65873588 ATGAAGAAGGAAAGGAAGGAAGG + Intergenic
1109977231 13:69854337-69854359 ATGAAGAAAGAGAGAGAGCATGG + Intronic
1110563096 13:76930178-76930200 ATGCAGCTGGAGAGTAAGGGAGG - Intergenic
1110637552 13:77783395-77783417 GAGGAGAAGGAGAGGGAGGAGGG + Intergenic
1111057063 13:82964849-82964871 AGGCAGAAGGAGGTTGAGGGAGG + Intergenic
1111104556 13:83628849-83628871 CAGGAGAAGGAGAGTGAGGGGGG - Intergenic
1111218462 13:85175369-85175391 CTGCTGAAGAAGAATGAGGAAGG + Intergenic
1111716292 13:91883623-91883645 TAGCTGAAGCAGAGTGAGGAAGG + Intronic
1111863469 13:93738657-93738679 TTGGAGTAGGAGAGAGAGGAGGG + Intronic
1112119520 13:96394431-96394453 ATGCAGGACAGGAGTGAGGATGG - Intronic
1112373941 13:98821260-98821282 GGGCAGGAGGAGAGTGAGGTGGG + Intronic
1112870860 13:103969047-103969069 AGGAAGCAGGAGGGTGAGGAGGG + Intergenic
1113149467 13:107246057-107246079 GTGCAGAATGAGATAGAGGAGGG - Intronic
1113314028 13:109159774-109159796 CTGGAGAAGGAGAGAGAGGCTGG + Intronic
1113502867 13:110792261-110792283 ATGCACATGGAGAGAGAGGAAGG + Intergenic
1113561782 13:111287182-111287204 AAGGAGAAGGACAGTCAGGATGG - Intronic
1113677007 13:112214584-112214606 ATCCTGAAGGAGAGGAAGGAAGG + Intergenic
1114135795 14:19848190-19848212 ATTCAGAAAGGGAGTGAAGATGG - Intergenic
1114479806 14:23025670-23025692 ACGGAGAAGGAGAGAGAGGCAGG - Intronic
1114781291 14:25540955-25540977 ATGCTGAAAAGGAGTGAGGATGG + Intergenic
1114842573 14:26282465-26282487 ATGGAGACGGAGAGGGAGTAGGG + Intergenic
1114913188 14:27226755-27226777 ATGAATAAGGATAGTGAGCATGG - Intergenic
1115275589 14:31605751-31605773 AAGGAGAAGGAGAAGGAGGAAGG - Intronic
1116608525 14:47035130-47035152 ATGCAAATGGAGAGTTATGATGG - Exonic
1116654390 14:47632791-47632813 AATCAGAAGGAGAGAGAGGTTGG - Intronic
1116808391 14:49515770-49515792 ATGGAGTGGGAGAGAGAGGAGGG + Intergenic
1117242885 14:53853093-53853115 AAGGAGAAGGAGAAAGAGGAGGG - Intergenic
1117296281 14:54382616-54382638 ATGAAGAAGGAGAGAGATGGGGG - Intergenic
1117502411 14:56366513-56366535 TCTCAGAAGGAGAGTAAGGAAGG - Intergenic
1118588150 14:67376600-67376622 AGGTAGAAGGAGAGTCAAGAAGG - Intronic
1119002742 14:70897768-70897790 GTACAGAAGCAGAGGGAGGAAGG + Intergenic
1119117920 14:72044491-72044513 AAGGAGAGGGAGAGGGAGGAAGG - Intronic
1119601611 14:75980625-75980647 ATGCATGGGGAGAGGGAGGAAGG - Exonic
1119676892 14:76562540-76562562 AGGAAGAAGGAGAGCCAGGAGGG + Intergenic
1119940270 14:78633448-78633470 ATGTTGAAGGGGAGTGGGGAGGG - Intronic
1120093222 14:80358270-80358292 TGGCAGAAGGTGCGTGAGGAAGG + Intronic
1120655856 14:87189132-87189154 AAGCAGAAGGAGAATTTGGATGG - Intergenic
1120690892 14:87591059-87591081 ATGAGGAAGGAAAATGAGGATGG + Intergenic
1120814604 14:88842050-88842072 AGGCAGAAGGAGAGGGAGAAAGG + Intronic
1121051686 14:90823035-90823057 ATTCAGAACGAGAGAGGGGAAGG + Intergenic
1121080438 14:91103515-91103537 ATGCAGAAGTAGATGTAGGAAGG - Intronic
1121564380 14:94897763-94897785 TTGCAGAATGAGAGAGTGGAGGG - Intergenic
1122088369 14:99322327-99322349 AACCAGAAGGAGAGGGGGGACGG + Intergenic
1122407508 14:101509110-101509132 AGGCAGAGGGAGAGTGAAGGCGG - Intergenic
1122685066 14:103500120-103500142 ATGTAGAAGCAGAGAGAAGAGGG - Intronic
1122822230 14:104353394-104353416 GGGCAGGAGGGGAGTGAGGATGG + Intergenic
1122827738 14:104379106-104379128 ATGCAGAAAGAGAGGAAGGGAGG + Intergenic
1122969536 14:105146920-105146942 CTGCAGAAGCAGACGGAGGAGGG - Intronic
1123874128 15:24606636-24606658 AGACAGAAGGAGAGTAAGCAAGG - Intergenic
1123978005 15:25570801-25570823 ATGCTGCAGGAAAGTTAGGAAGG - Intergenic
1124986864 15:34626875-34626897 ATACAGGAGGAGAGTAAAGATGG + Intergenic
1125087872 15:35752330-35752352 AGGGAGAAGGAGAGGGAGAAAGG - Intergenic
1125222016 15:37349479-37349501 ATGCAGAAGGGGAATCAGAACGG + Intergenic
1125525408 15:40370931-40370953 GTGCAGCAGGAGAAGGAGGATGG + Exonic
1125691475 15:41599527-41599549 CAGCAGAAGGAGAGTGAGGGTGG + Intergenic
1125989693 15:44094272-44094294 AAGCAGAGGGAGAGGGAGCATGG + Intronic
1126334464 15:47571074-47571096 AGGCAGGAGAAGAGTGGGGAGGG - Intronic
1126355959 15:47796220-47796242 AGTCAGAAGAAGAGGGAGGAAGG - Intergenic
1127532140 15:59853784-59853806 ATGGGGAAGGACAGAGAGGAGGG - Intergenic
1127964610 15:63914348-63914370 GTACAGAAGGAAAGAGAGGAGGG + Intronic
1127996043 15:64153594-64153616 ATGCCGGGGGAGCGTGAGGAAGG - Intronic
1128160521 15:65420746-65420768 CTGTAGAAGGAGAATGATGATGG - Intronic
1128605692 15:69035306-69035328 AGGCAGACAGAGAGTGAGGCAGG + Intronic
1128674592 15:69599409-69599431 ACACTGAAGGAGAGTGAGGAAGG + Intergenic
1128683674 15:69668589-69668611 AGGCAGAAAGAGGGTGAGGCTGG + Intergenic
1128686175 15:69687342-69687364 AGGGAGAAGGAAAGTTAGGAAGG + Intergenic
1128796468 15:70470120-70470142 ATGCAGGAGCTGAGGGAGGATGG - Intergenic
1129111212 15:73338394-73338416 CTGCAGAAGGAGTGAGAGCAGGG - Intronic
1129389760 15:75214668-75214690 GTGCAGCAGGAGAGACAGGAGGG - Intergenic
1130533223 15:84763760-84763782 ATGCAGGATTAGAGTGAGAATGG + Intronic
1130961280 15:88660061-88660083 ATGGAATAGGAGAATGAGGAGGG - Intergenic
1130987543 15:88854616-88854638 AGGCAGAAGGACAGGGAGAAAGG - Intronic
1131312560 15:91304207-91304229 CTGCAGGAGGAGAGAGAGGGGGG + Intergenic
1131329676 15:91485412-91485434 ATGAGGAAGCAGAGTGAGAAAGG + Intergenic
1131351193 15:91701424-91701446 ATGAAGGAGGAGAGGAAGGAAGG + Intergenic
1131442233 15:92467757-92467779 TTGCTGATGGAGAGTGCGGAGGG - Exonic
1131513809 15:93064497-93064519 ACGCAGAAGGTGAAGGAGGAAGG - Intronic
1131670384 15:94613653-94613675 AGGCAGAACCAGAGTGAGAAAGG - Intergenic
1132057798 15:98665339-98665361 AGGCAGATGCAGAGTCAGGAGGG - Intronic
1133470338 16:6069067-6069089 AAGCAGAAAGAGAGGAAGGAAGG + Intronic
1133867068 16:9654255-9654277 AAGGAGAAGGAGAGGAAGGAAGG + Intergenic
1135053125 16:19208452-19208474 TGGCAGCAGGAGAGTGAGGGGGG + Intronic
1135582274 16:23638945-23638967 ACGCAGAAGGCCAGTGAGGTTGG + Intronic
1135892127 16:26366665-26366687 AAGCAGAGGGAGAGGGAGGAGGG + Intergenic
1135900866 16:26458691-26458713 ATCCATGAGTAGAGTGAGGAAGG - Intergenic
1136080411 16:27848882-27848904 ATGCTGTAGCAGAGTGAGCAAGG + Intronic
1136450941 16:30353980-30354002 CTGCAGGAGGAGATGGAGGAAGG - Exonic
1136487269 16:30581657-30581679 TTGCAGAATGAGAGTGGGGGGGG + Exonic
1136511227 16:30739255-30739277 AAGCAGAAGGAATGCGAGGACGG + Exonic
1137386499 16:48047483-48047505 AAGCAGGAGGAGGGAGAGGAAGG + Intergenic
1137578750 16:49621010-49621032 CTGCTGAAGGAGAGAGAGGGAGG - Intronic
1137836077 16:51593986-51594008 CTGCAGAAGGAAACTGAGGGAGG - Intergenic
1137844580 16:51674641-51674663 AATCAGAAGGAGAGTGAGTGAGG + Intergenic
1138242594 16:55439822-55439844 AGGCAGAAAGACAGTGAGGCAGG + Intronic
1138277439 16:55746041-55746063 AGGCAGAAGGAGAGAGGGCAGGG + Intergenic
1138337849 16:56267138-56267160 AGGTAGAAGAAGAGGGAGGAGGG + Intronic
1138443189 16:57047251-57047273 ATGGTCAAGGTGAGTGAGGATGG + Intronic
1139228698 16:65259097-65259119 ATGAAGAAGGAGAGTGTTGAGGG + Intergenic
1139250734 16:65493044-65493066 ATACCAATGGAGAGTGAGGAGGG - Intergenic
1139308094 16:66005265-66005287 ATAAAGAAAGAAAGTGAGGAGGG - Intergenic
1139329687 16:66177672-66177694 AGGGAGAATGAGAGTAAGGATGG + Intergenic
1139521924 16:67488033-67488055 ATGCTGCAGAAGAGTGAGGATGG + Intergenic
1139548691 16:67661665-67661687 GTGCAGAAGCGGGGTGAGGAGGG + Exonic
1139750468 16:69106534-69106556 ATGCAGGAAGAAAGGGAGGAGGG - Intronic
1141332735 16:83126959-83126981 ATGAAGGAGTAGAGGGAGGAGGG + Intronic
1141527065 16:84618324-84618346 AAGGAGAAGGAGAGAGAAGAGGG - Intergenic
1141631637 16:85291277-85291299 AGGGAGGAGGAGGGTGAGGAGGG - Intergenic
1141759702 16:86019953-86019975 ATGCAGAGAGAGAGAGAGAAAGG - Intergenic
1142255937 16:89013996-89014018 AGGCAGAGAAAGAGTGAGGAAGG + Intergenic
1142352221 16:89585759-89585781 ATGCAGAAGGCCTTTGAGGAGGG + Exonic
1143008261 17:3851290-3851312 ATGGAGAAGGTGAGGGAAGATGG - Intergenic
1143154447 17:4827325-4827347 ATGCAGGAGGAAACTGAGGGGGG + Intergenic
1143434894 17:6916069-6916091 ATTCAGAAGGAGATTCAGGAGGG + Intronic
1143695185 17:8609345-8609367 ATCGAGAAGGAAAGGGAGGAAGG + Intronic
1143735034 17:8905626-8905648 ATGCTGGAGGTGAGGGAGGAGGG - Intronic
1143764050 17:9126046-9126068 TTGCAGAAGCAGAGTCAGGATGG + Intronic
1144023870 17:11260730-11260752 AGACAGAAGGAGAGTGAGAGGGG - Intronic
1144143219 17:12370491-12370513 GTGGAGAAGCAGAGAGAGGAAGG + Intergenic
1144284388 17:13758918-13758940 ATGCATAATGAGAGTGATGGTGG + Intergenic
1144561846 17:16327199-16327221 GTGCAGTAGGAGAGTGTGGTAGG + Intronic
1144673582 17:17146731-17146753 AAGCAGGAAGGGAGTGAGGATGG - Intronic
1145756026 17:27390589-27390611 AGGCAGGATGGGAGTGAGGATGG - Intergenic
1145898418 17:28474196-28474218 AAGCAGCAGCAGAGTGAAGAGGG + Intronic
1146158388 17:30544010-30544032 ATGACTAAGGATAGTGAGGAAGG + Intergenic
1146234877 17:31149792-31149814 ATGAAGGAGGAGCTTGAGGAGGG + Intronic
1146448763 17:32954887-32954909 ATGTAAAAGGAGGGTGATGAGGG - Intergenic
1146742552 17:35299223-35299245 ATGGAGAAGGAGAAGGAGCAGGG - Intergenic
1147212146 17:38877886-38877908 ATGAGGAAGGAGAGAGGGGAGGG + Intronic
1147228231 17:38997662-38997684 AGGGAGAAAGAGAGAGAGGAAGG - Intergenic
1147277726 17:39333146-39333168 AGGGAGACGGAGAGGGAGGAGGG - Intronic
1147305822 17:39563774-39563796 AGGGAGAGTGAGAGTGAGGAAGG + Intronic
1147613662 17:41815805-41815827 TTTCAGAAGTAAAGTGAGGATGG - Intronic
1148128509 17:45248712-45248734 AAGGTGAAGGAGGGTGAGGAGGG + Intergenic
1148220557 17:45858745-45858767 CTGGAGAGGGAGGGTGAGGAAGG + Intergenic
1148682730 17:49484025-49484047 ATGGAGAAGAAGAGAGAGGAAGG - Intergenic
1149183827 17:53973763-53973785 ATGGAAAAGGAGAGAGAAGAGGG - Intergenic
1149465907 17:56879012-56879034 ATGGAGAGTGAGAGTGAGGCTGG + Intergenic
1150000694 17:61437134-61437156 AAGGAGAGGGAGAGGGAGGAAGG - Intergenic
1150319444 17:64199888-64199910 ATGCACAAGAAGAGAAAGGAAGG - Intronic
1150502676 17:65665996-65666018 ATGCAGATGAACAGTGAGGTAGG - Intronic
1150587072 17:66528507-66528529 ATGCAGAAGCAGAGTTGGGAGGG + Intronic
1150621047 17:66807892-66807914 CTGCAGTAGGAGGGAGAGGAAGG + Exonic
1151084337 17:71363656-71363678 ATGAAGAAGGAAAGTAATGAAGG + Intergenic
1151216346 17:72579341-72579363 ATGAAGAAGGTGTGTGAGGTTGG - Intergenic
1151429826 17:74054967-74054989 AGACAGAAGGAGAGAGAGAAAGG - Intergenic
1151632812 17:75322491-75322513 ATGCAGGAAGAAGGTGAGGAGGG + Intronic
1151768584 17:76145167-76145189 AGGCAGCAGCTGAGTGAGGATGG + Exonic
1152063505 17:78096783-78096805 CTGGAGAAGAAGAGCGAGGATGG - Intronic
1152092082 17:78252625-78252647 GTGCAGCTGGAGGGTGAGGAAGG + Intergenic
1152266277 17:79296837-79296859 AAGCAGGAGGAGGGGGAGGAGGG - Intronic
1152319571 17:79600933-79600955 GTGAAGGAGGGGAGTGAGGAAGG + Intergenic
1153488398 18:5625240-5625262 AGGCAGAATGAGAGTGAGCTGGG + Intronic
1153588791 18:6651417-6651439 AGGGGAAAGGAGAGTGAGGAAGG - Intergenic
1154316187 18:13304860-13304882 AGACGGAAGGAGTGTGAGGAAGG + Intronic
1154459885 18:14571670-14571692 ATTCAGAAAGGGAGTGAAGATGG - Intergenic
1154957757 18:21276065-21276087 AAACAGAATGAGAATGAGGAAGG - Intronic
1155116502 18:22773556-22773578 AGGAAGCAGGAGAGAGAGGAGGG - Intergenic
1155258412 18:24018403-24018425 ATGCAAACAGTGAGTGAGGAAGG - Intronic
1155654202 18:28176640-28176662 AGGCAGCAGGAGGGTGAGGCAGG - Intronic
1155681114 18:28488128-28488150 AAGCAGAGGGAGAGAGATGATGG - Intergenic
1155813770 18:30276298-30276320 AGGGAGAAAGAGAGGGAGGAAGG + Intergenic
1156379518 18:36545099-36545121 ATAAAGAAGGAGAGGGAGGGAGG - Intronic
1156492854 18:37506541-37506563 AGGCAGATGGAGAGGGAGGTTGG + Intronic
1156618000 18:38810928-38810950 ATTCAGGAGGAGAGTGTAGATGG - Intergenic
1156631536 18:38975295-38975317 AAGGAAAAGGAGAGTGTGGAAGG - Intergenic
1156683192 18:39616141-39616163 AAGCAGAAGAAGAGAGAGAAGGG + Intergenic
1157174238 18:45436760-45436782 AAGCAGAAGCTGAGTAAGGATGG + Intronic
1157231106 18:45916860-45916882 ATGGAGTTGGGGAGTGAGGAGGG - Intronic
1157267810 18:46243911-46243933 ATGCTGAAGTAGACTGAGTAAGG + Intronic
1157334135 18:46724974-46724996 AGGAAGAAAGAGAGAGAGGAAGG + Intronic
1157408077 18:47440526-47440548 GAGAAGAAGGAGAGTGAGGGAGG + Intergenic
1157430414 18:47619906-47619928 ATTCAGCAGGGGAATGAGGATGG + Intergenic
1157442476 18:47721391-47721413 AGACAAAAGGAGAGTGATGAGGG + Intergenic
1157543162 18:48526747-48526769 CAGCAGAAGGAGAGGGAGAAGGG - Intergenic
1157687868 18:49657361-49657383 AGGCAGCAGCAGGGTGAGGATGG - Intergenic
1157811881 18:50703177-50703199 ATGGAGAAGGGGAGTGAGCATGG - Intronic
1157901704 18:51524287-51524309 AGGCAGAAGGAGAGTGAGCTAGG + Intergenic
1158421624 18:57299841-57299863 ATGGACAAGGAGACTGAGGTAGG + Intergenic
1158813740 18:61069315-61069337 ATGCAGAAGCAGAGTATGGAAGG - Intergenic
1158860782 18:61590186-61590208 ATGAAGAAGGGGAGGGAGGCAGG - Intergenic
1159733018 18:72055352-72055374 ATGAACAAGGAAAGTGAGGAAGG - Intergenic
1159782475 18:72675909-72675931 ATGCAGCAGGAAAGGGAGGTGGG - Intergenic
1159933083 18:74334305-74334327 AAGCAGAAGGGGAAAGAGGAAGG + Intronic
1159989109 18:74881558-74881580 AGGCAGAGAGAGAGAGAGGAAGG - Intronic
1160004791 18:75061787-75061809 GAGCAGGACGAGAGTGAGGAGGG - Intronic
1160047291 18:75398780-75398802 ATGAAGAGAGAGAGAGAGGAAGG - Intergenic
1160533586 18:79579173-79579195 GTGCGGATGGAAAGTGAGGATGG - Intergenic
1160573187 18:79832292-79832314 CTGAGGAAGGACAGTGAGGATGG - Intergenic
1160965783 19:1746329-1746351 ATGGAGGAGGAGGGGGAGGAAGG + Intergenic
1161248602 19:3268794-3268816 AAGCAGATGGAGAGAGAGCACGG + Intronic
1161620913 19:5296680-5296702 TTGCTGGAGCAGAGTGAGGAAGG + Intronic
1162324964 19:9993499-9993521 AGGCAGATGGGGTGTGAGGAGGG + Intronic
1162765021 19:12913972-12913994 CTGGAGAAGGAGTGAGAGGAGGG - Intronic
1162996649 19:14340046-14340068 GGGGAGAAGGAGAGTGAGGAAGG - Intergenic
1163113059 19:15173045-15173067 AAGAAGAAGAAGAGGGAGGAGGG - Intronic
1163207240 19:15812618-15812640 GGAAAGAAGGAGAGTGAGGAAGG + Intergenic
1163779788 19:19240173-19240195 AGGGAGAAGGAGAGAGATGAGGG - Intronic
1164211927 19:23106145-23106167 AAGCAGAAGGAGAAGGAGAAGGG + Intronic
1164439217 19:28259285-28259307 ATGCAGATGAACAGTGAGCACGG - Intergenic
1164680384 19:30130699-30130721 AGGGAGGAGGAGAGGGAGGAAGG - Intergenic
1164680415 19:30130788-30130810 AGGGAGAAGGAGAGGGAGGAAGG - Intergenic
1164680487 19:30131008-30131030 AGGGAGGAGGAGAGGGAGGAAGG - Intergenic
1164680513 19:30131081-30131103 AGGGAGGAGGAGAGGGAGGAAGG - Intergenic
1164680539 19:30131154-30131176 AGGGAGGAGGAGAGGGAGGAAGG - Intergenic
1164714087 19:30378975-30378997 AGGCATAAGGAGTGTGGGGAGGG + Intronic
1165421310 19:35723327-35723349 AGGCAGAAGAGGAGTGAGGTAGG - Intronic
1165952804 19:39483531-39483553 AACCAGAAGGGGAGAGAGGAAGG - Intronic
1166108860 19:40610869-40610891 ATGGAGAAGCAGAATGAGGAGGG + Intronic
1166123608 19:40700455-40700477 GGGCAGAAGGAAAGGGAGGAAGG + Intronic
1166159212 19:40939139-40939161 AGGGAGAAGGAGAGGGAGGGTGG + Intergenic
1166184215 19:41128838-41128860 AGGGAGAGGGAGAGGGAGGAGGG + Intergenic
1166569642 19:43785301-43785323 CTGGTGAAGGAGAGTGAAGAGGG + Intergenic
1166784102 19:45357538-45357560 ATGCAGCTGGAGAGAGATGAGGG + Exonic
1166886632 19:45965223-45965245 TTGAAGAAGCAGAGAGAGGACGG - Intronic
1167197643 19:48041710-48041732 ATGGAGGAGGAGAGAGAGAATGG - Intronic
1167592805 19:50413619-50413641 ATGCAACAGGAGAGTGGGCAGGG - Intronic
1167608262 19:50493215-50493237 AGGTAGAAGGAGAATGGGGAGGG + Intergenic
1168182584 19:54672197-54672219 AGGCAGAGAGAGAGAGAGGATGG + Intronic
1168336828 19:55601833-55601855 ATCCAGAAGGAGAGTTAGGGAGG + Intronic
1168464866 19:56594530-56594552 ATGGGTAAGGAGAGGGAGGAGGG - Intergenic
1168659687 19:58155884-58155906 AGGGAGAAAGAGAGAGAGGAAGG + Intergenic
1202698029 1_KI270712v1_random:139642-139664 ATGGAAAAGGAGAGGGAAGAAGG - Intergenic
924959996 2:26271-26293 AGGCAGAAGGAGAGAGGGGAAGG + Intergenic
925166705 2:1720040-1720062 ATGCAGAGAGAGAGAGAGGGAGG + Intronic
925166713 2:1720068-1720090 ATGCAGAGAGAGAGGGAGGGAGG + Intronic
925166719 2:1720092-1720114 ATGCAGAGAGAGAGGGAGGGAGG + Intronic
925166727 2:1720140-1720162 ATGCAGAGAGAGAGAGAGGGAGG + Intronic
925166741 2:1720222-1720244 ATGCAGAGAGAGAGAGAGGGAGG + Intronic
925166751 2:1720278-1720300 ATGCAGAGAGAGAGAGAGGGAGG + Intronic
925596021 2:5556148-5556170 AAGCGGAAGGAGTGTGAGGGAGG + Intergenic
925613046 2:5719127-5719149 AAGAAGAAGGACAGTGAAGAAGG + Intergenic
925842588 2:8006566-8006588 ATGGAGGAGAAGAGAGAGGAGGG - Intergenic
926137436 2:10346778-10346800 ATGGAGAAGGAAGGGGAGGAAGG - Intronic
926230820 2:11002633-11002655 GTGCAGAAAGGGAGTGAGGAAGG + Intergenic
926244574 2:11113502-11113524 AGGAAGAAGGGGAGGGAGGAAGG - Intergenic
927530473 2:23793623-23793645 ATGCAGAAAGCGAGTGAGGCTGG + Intronic
927553723 2:24018550-24018572 ATGCTGCAGCAGAGTGAGCAAGG + Intronic
927637556 2:24827292-24827314 AGGCAGCAGGAAAATGAGGAGGG - Intronic
927754516 2:25698053-25698075 ACGCAGGAGGAGAGGGAGGCTGG + Intergenic
927859367 2:26550908-26550930 ATGCATCAGGGGAGTGTGGAGGG - Intronic
927877188 2:26665736-26665758 AGGTAGGAGGAGAGGGAGGAAGG - Intergenic
927947964 2:27148835-27148857 AGGCAGGAGGATAGTGGGGAAGG - Intergenic
928285671 2:29988080-29988102 CAGCAGTAGGGGAGTGAGGAAGG - Intergenic
928407200 2:31023801-31023823 CTGGAGGAGGAGAGTGATGAGGG - Intronic
928816412 2:35300156-35300178 AGGGACAATGAGAGTGAGGAGGG - Intergenic
929898422 2:45981460-45981482 AAGCAGAAGGAGAGAGAAGATGG - Intronic
929910954 2:46089185-46089207 ATGTAGAATAAGAATGAGGAGGG - Intronic
929985564 2:46728300-46728322 ATTCAGTAGGAGAGACAGGATGG + Intronic
930371466 2:50506740-50506762 AGGAAGAAAGAGAGAGAGGAGGG + Intronic
930837226 2:55807245-55807267 ATGCAGAAGAGGAGTGCTGAAGG - Intergenic
930919608 2:56736415-56736437 ATGAAGCTGGAGAGAGAGGATGG - Intergenic
931000756 2:57779496-57779518 CTGCAGAAGAACAGTAAGGATGG - Intergenic
931028380 2:58140499-58140521 ATGCACAAATAGAGTGTGGAGGG + Intronic
931121617 2:59226367-59226389 AGGAAGAAAGAGAGGGAGGAAGG + Intergenic
931255383 2:60567655-60567677 ATGCAAAAGGAAAAAGAGGAGGG + Intergenic
931328148 2:61249712-61249734 ATGCAGAAGAAGAGTCTGCAGGG + Intronic
931925838 2:67071538-67071560 GTGGTGAAAGAGAGTGAGGAAGG - Intergenic
932125422 2:69141227-69141249 ACGTAGAAGGAAAGGGAGGATGG + Intronic
932355419 2:71064549-71064571 ATGAGGAAGGAGAGAGAGGCTGG - Intronic
932460755 2:71880435-71880457 ATGTAGAGGGAGCATGAGGAAGG - Intergenic
932610086 2:73192299-73192321 CTGCAAAAGGAGAGTGAAAAAGG + Intergenic
932659964 2:73643247-73643269 ATGCAGCTAGAGAGTGAGGAAGG + Intergenic
932666532 2:73702906-73702928 ATGCAGCTAGAGAGTGAGGAAGG + Intergenic
932737459 2:74264269-74264291 ATTGAGAAGCAGATTGAGGATGG - Exonic
932871688 2:75406634-75406656 GTGCAGAAGGAGACGGAGCATGG - Intergenic
933043588 2:77503318-77503340 ATGGAGTATGAGGGTGAGGATGG + Intronic
933053978 2:77638294-77638316 AGGAAGAAAGAGAGGGAGGAGGG - Intergenic
933789208 2:85870422-85870444 ATGAAAAAGGAGAACGAGGAGGG - Intronic
933819930 2:86101724-86101746 CTGCAGATGGAGAGTGGTGATGG - Intronic
934155460 2:89195839-89195861 AAGCAGTAGGAGAATGGGGAAGG - Intergenic
934211863 2:89986919-89986941 AAGCAGTAGGAGAATGGGGAAGG + Intergenic
934279283 2:91597422-91597444 ATGGAAAAGGAGAGGGAAGAAGG - Intergenic
934609336 2:95722991-95723013 CTGCAGTAGGTTAGTGAGGATGG + Intergenic
935098533 2:99970304-99970326 AAGCAGAAGGGGAGAAAGGATGG - Intronic
935103120 2:100015707-100015729 AGGCAGAAAGACAGTGAGCATGG + Intronic
936091024 2:109501576-109501598 GTGCACAAGAAGCGTGAGGACGG + Exonic
936502215 2:113075108-113075130 CTGCAGAATGAGAGTGCTGATGG - Intronic
936958679 2:118049891-118049913 AAGCAGAAAGAGAATGAGTATGG - Intergenic
937490877 2:122365941-122365963 AGGCAGAAGGAGAAAGAAGAAGG + Intergenic
937533216 2:122854917-122854939 ATGTAGAATGATAGTGAGAAAGG - Intergenic
937624993 2:124034113-124034135 ATGAAAAAGGACAGTGAGAAGGG + Intronic
938611632 2:132953601-132953623 ATGCCAAAGGAGGGAGAGGAAGG + Intronic
938927319 2:136055829-136055851 ATGCAGCGGGAGAGGAAGGAAGG - Intergenic
939014467 2:136886107-136886129 ATGCAGGAGCAGAGTGAACATGG + Intronic
939192104 2:138929193-138929215 ATGAAGGAAGAGAGGGAGGAAGG - Intergenic
939429467 2:142084276-142084298 ATGAAAAAGAAGAGTGAGGCTGG - Intronic
940254539 2:151714830-151714852 ATGCATCTTGAGAGTGAGGAGGG + Intronic
940491021 2:154360926-154360948 ATGGGGAAGGGGAGTGAAGATGG + Intronic
940985883 2:160051830-160051852 ATGCAGAGAGAGAGGTAGGAAGG - Intronic
941344774 2:164354511-164354533 TTGCAGAAGGAGAGTGCTAATGG - Intergenic
941451594 2:165666605-165666627 ATGAAGAAAGAGAGAAAGGAAGG + Intronic
942248621 2:174029174-174029196 CTGCAGAAGGTGATTGAAGAGGG + Intergenic
942310340 2:174650572-174650594 ATGGAGAAGAACAGTCAGGATGG - Intronic
942604655 2:177677600-177677622 TTGAAGAAGGAGAGGGTGGAAGG + Intronic
942954559 2:181759119-181759141 TTGCAGAAGGTGAGTGAGAATGG + Intergenic
943060950 2:183040775-183040797 AAGGAGGAGGAGAGGGAGGAGGG + Intergenic
943490229 2:188544102-188544124 TTCCAGTAGGAGAGTGAGGGTGG - Intronic
943685474 2:190813226-190813248 CAACAGCAGGAGAGTGAGGATGG + Intergenic
944113396 2:196160200-196160222 ATGCAGAAGGGGAATGCAGAAGG - Intronic
944586976 2:201181141-201181163 ATGCTGCAGCAGAGTGAGGAGGG - Intergenic
944812476 2:203341161-203341183 AAGCAAAGGGAGAGTGAGCAAGG - Intronic
945400834 2:209380429-209380451 ATGCAGTAGAACAGTGAGGCAGG + Intergenic
945407688 2:209469594-209469616 GTGCAGAGGGAGAGTAAGAAAGG - Intronic
945431462 2:209770975-209770997 AGGAAGAAGGAGAAGGAGGAGGG + Intergenic
945471261 2:210230036-210230058 AGACAGAGAGAGAGTGAGGAAGG + Intergenic
946440297 2:219689396-219689418 TTGTGGAAGGAGAGGGAGGACGG - Intergenic
946733747 2:222733883-222733905 CTGCAGCAGGAGAGTGAGTCTGG - Intergenic
947756251 2:232567572-232567594 ATGCAGAAGTGGGGTGAGGGTGG - Intronic
948095338 2:235328994-235329016 ATTGAGAAGGGGATTGAGGAGGG + Intergenic
948230997 2:236349220-236349242 ATGGAGCTGAAGAGTGAGGAGGG + Intronic
948285579 2:236782142-236782164 CTGCAGAAGGTGTGTGAGAATGG + Intergenic
948694317 2:239725544-239725566 AGGGAGAAGGTGAGTGAGGGAGG + Intergenic
949058698 2:241944024-241944046 CTGCACATGGCGAGTGAGGAGGG + Intergenic
1168804865 20:666383-666405 ATACAGAAGGAGAAGGAGGGGGG - Intronic
1168814167 20:725335-725357 AGGCAGAAAGAGAGGGAGGGAGG - Intergenic
1168879685 20:1195906-1195928 ATGGAGAAGGTGAGTGTTGAGGG + Intergenic
1168915525 20:1482554-1482576 AAGGAGAAAGAGAGAGAGGAAGG - Intronic
1169668559 20:8068303-8068325 AGGCAGAAAGAGAGTAGGGAAGG + Intergenic
1170207550 20:13814869-13814891 TTGCAGAAGCAGTGTGAGGGTGG - Intronic
1170501800 20:16982390-16982412 ATGAAGGAAGAGAGGGAGGAAGG - Intergenic
1170589786 20:17763119-17763141 ATGCAGAATGAGAGAAAGAAAGG - Intergenic
1170664858 20:18378050-18378072 ATGAAGAAGGAGATGGGGGAAGG + Intergenic
1171077462 20:22143093-22143115 GTGAAGGAGGAGAGGGAGGAAGG - Intergenic
1172009507 20:31838177-31838199 TTCCAGACAGAGAGTGAGGAGGG + Intergenic
1172192401 20:33069830-33069852 CGGCAGAAGGAGCTTGAGGACGG - Intronic
1172202397 20:33135714-33135736 ATGGGGAAGGGGAGTGAGGGGGG + Intergenic
1172578726 20:36030222-36030244 GTGCAGAAGGAGAGTCTGGGAGG + Intronic
1172696461 20:36826364-36826386 AGGGAGAAGGAGAGGGAGGGGGG - Intronic
1172870480 20:38132501-38132523 CTGCAGAAGGGGAGAAAGGAGGG + Intronic
1172884588 20:38222627-38222649 TTGCAGAGGGAGAGTGGGGATGG - Intronic
1172970585 20:38870520-38870542 ATGCAGAAGGATGGGGAGGCTGG + Intronic
1173664190 20:44753439-44753461 CTGGAGAAGGAGAGTGGAGATGG + Intronic
1173914801 20:46699016-46699038 ATTCACATGGAGAGTGAAGAAGG + Intergenic
1174115324 20:48222998-48223020 AAGCAGGAGGTCAGTGAGGAGGG + Intergenic
1174117593 20:48237925-48237947 CTGCAGCAGGGGAGTGAGGTGGG - Intergenic
1174163919 20:48571222-48571244 CTGCAGCAGGGGAGTGAGGTGGG + Intergenic
1174404417 20:50294254-50294276 AGGCTGAAGGGGTGTGAGGAGGG + Intergenic
1174516853 20:51099138-51099160 CTGCAGAAGGGGAGGGAGGAGGG + Intergenic
1174597601 20:51696499-51696521 AAGCAGAAAGCGAGAGAGGAGGG - Intronic
1174607190 20:51769168-51769190 ATAGAGAATGAGGGTGAGGATGG - Intergenic
1174950306 20:55035236-55035258 AAGCAGAAGGTGATTGTGGAAGG + Intergenic
1175319343 20:58074399-58074421 AAGCAGAAAGAGAGGGAGGAGGG + Intergenic
1176424140 21:6537509-6537531 ATTCATAGGGAGGGTGAGGAAGG + Intergenic
1176814231 21:13581156-13581178 ATTCAGAAAGGGAGTGAAGATGG + Intergenic
1176905618 21:14497030-14497052 GCCCAGATGGAGAGTGAGGAGGG - Intronic
1177447582 21:21217783-21217805 ATGCAGAAGGGGAGGGTGGAGGG + Intronic
1177861534 21:26460237-26460259 AAGAAAAAGGAGAGTGAAGATGG - Intergenic
1178016379 21:28351126-28351148 ATGCGGGAGGAGAGGGAGGAAGG - Intergenic
1178124950 21:29506212-29506234 GTGCAAAATGAAAGTGAGGAGGG + Intronic
1178282026 21:31291910-31291932 CTGAAGAAGGAGAGTCTGGAAGG - Intronic
1178423632 21:32461461-32461483 ATGCAGAAAAAGAGGCAGGAAGG - Intronic
1178822859 21:35991336-35991358 ACAGAGCAGGAGAGTGAGGAGGG + Intronic
1178881747 21:36455451-36455473 CTGTGGAAGGAGGGTGAGGATGG + Intergenic
1179364225 21:40740734-40740756 ACTCAGAAGGACAGGGAGGATGG + Intronic
1179699633 21:43145824-43145846 ATTCATAGGGAGGGTGAGGAAGG + Intergenic
1179900219 21:44388468-44388490 ATGGAGAAGGACAGTGATGATGG + Intronic
1179958691 21:44756047-44756069 ATGGAGAAGAAGAGGGAGGAGGG + Intergenic
1180147000 21:45927309-45927331 ATGTAGGGGGAGAGGGAGGAAGG - Intronic
1181284262 22:21740729-21740751 ATGGAGGAGGAGAGAGAGGAAGG - Intergenic
1181313002 22:21955650-21955672 GTGCAGAAGCATAGTAAGGAAGG + Intergenic
1181346109 22:22221722-22221744 GTGCAGAAGCATAGTAAGGAAGG + Intergenic
1181375580 22:22455208-22455230 AGGCAGAAAGAGAGAGAGGGAGG + Intergenic
1181538078 22:23557135-23557157 ATGCAGAAGGAGTTTCAAGAAGG + Intergenic
1181776101 22:25161113-25161135 AAGGAGAAGGAAAGTTAGGAAGG - Intronic
1181844741 22:25698124-25698146 AGGAGGAAGGAGAGGGAGGAAGG + Intronic
1181983213 22:26781320-26781342 AGGCAGAGGGAGGGAGAGGAAGG + Intergenic
1181995927 22:26882471-26882493 ATGGAGAAAGGGAGTGAGAAGGG - Intergenic
1182497376 22:30719188-30719210 AAAGAGAAGGGGAGTGAGGAGGG - Intronic
1182693282 22:32178188-32178210 ATGCCGATGGAGAGTGAGATTGG - Intergenic
1182706370 22:32283120-32283142 ATGCAGAAGGAGCAATAGGAGGG - Intergenic
1182806383 22:33074172-33074194 ATAAAGAAGAAGAGTGAGGAGGG - Intergenic
1182824429 22:33252352-33252374 ATGGAGAAGGAGAGTTAGGCTGG - Intronic
1183615707 22:38944075-38944097 GAGGAGAAGGAGAGGGAGGAAGG - Intergenic
1183671997 22:39278427-39278449 ATCCAGCAAGAGAGTGAGGCTGG + Intergenic
1184015665 22:41784093-41784115 ATGGAGGAGGCCAGTGAGGATGG + Intronic
1184099567 22:42335032-42335054 ATGCAGAACGAAAGTCAGGCTGG - Intronic
1184632017 22:45789058-45789080 ATGCAGATTGACAGTAAGGATGG + Intronic
1184928400 22:47660741-47660763 ATGAAGAAGGAGGAAGAGGAGGG - Intergenic
1184959351 22:47917854-47917876 GGGAAGAAGGAGAGGGAGGAGGG - Intergenic
1185276996 22:49954081-49954103 CCGCAGGAGGAGAGTGTGGAAGG + Intergenic
949367899 3:3302786-3302808 AGGCAGCAGGAGAGAGAAGAAGG - Intergenic
949592375 3:5507943-5507965 ATGGAAAAGGAGACTCAGGAAGG + Intergenic
949618771 3:5786513-5786535 AGGCAGGAGGAGAGAGAGGTTGG + Intergenic
949815206 3:8050882-8050904 ATGGTGAAGGAGGGTGGGGATGG + Intergenic
949934177 3:9103850-9103872 ATCCAGAAGCTGAGTGTGGAAGG - Intronic
950398873 3:12755007-12755029 AGGGGGAAGGAGAGAGAGGAAGG - Intronic
950675241 3:14550601-14550623 ATGCATGAGGAGATTGAGGCCGG - Intergenic
951811474 3:26705425-26705447 TTGCAGAGGGGGAGTTAGGAGGG + Intronic
952588356 3:34920506-34920528 ATTAAGAAGGAGAATGAGAATGG - Intergenic
953039016 3:39238257-39238279 AGGAAGAAGGAGATTGAGAAAGG - Intergenic
953386630 3:42509984-42510006 TTGAAGCAGGAGACTGAGGATGG - Intronic
953504668 3:43473320-43473342 ATCCAGGAGGAGAGTGTAGACGG - Intronic
953910719 3:46891584-46891606 AAGAAGAAGGATAGTGGGGAGGG + Intronic
953979225 3:47405395-47405417 AGGCAGGAGGAGAGTGTGGCTGG + Intronic
954030739 3:47818210-47818232 CTCCAGAAAGTGAGTGAGGAAGG + Intronic
954130579 3:48558715-48558737 CTGCAAAAGGAGGATGAGGAAGG - Intronic
954706177 3:52481781-52481803 GGGCACAAGGGGAGTGAGGAGGG - Intronic
955266820 3:57452065-57452087 AGGCAGAAAGAGACTGAGGCAGG - Intronic
955393429 3:58537359-58537381 ATGCAGGAAGAGAGGGAGGAAGG - Intergenic
955703123 3:61701913-61701935 AAGAGGAAGGAGAGGGAGGAAGG + Intronic
956015916 3:64882393-64882415 ATTCAGAAGGAGTGGGAGGAAGG - Intergenic
956309209 3:67860449-67860471 AGGCAGAAGGGGAGCGAGCAAGG + Intergenic
956624106 3:71249758-71249780 AGGGAGAGGGAAAGTGAGGAGGG + Intronic
957030704 3:75236881-75236903 ATGCAGCAGGAGATAGAGAAAGG - Intergenic
957261392 3:77906519-77906541 ATGGAGAAGGAGGCTGAAGAAGG + Intergenic
957593784 3:82233937-82233959 AGGGAGAAAGAGAGGGAGGAAGG + Intergenic
957693483 3:83601862-83601884 ATGCAGAATGAAAGTGAAAATGG - Intergenic
957953842 3:87158796-87158818 AAGAAGAAAGAGAGAGAGGAAGG + Intergenic
958055040 3:88399421-88399443 ATGCAGGAGCAGAGTGAGTGAGG - Intergenic
959365312 3:105450954-105450976 ATGTAGAGGGAGAATTAGGATGG + Intronic
959481516 3:106878448-106878470 AGGAAGAAGAAGAGGGAGGAAGG - Intergenic
959933928 3:112010857-112010879 AGGCAGATGGAAAGTGAGAATGG - Intronic
960709613 3:120514579-120514601 AAGAAGAAGGAGAGGGAGGGGGG - Intergenic
961488250 3:127232546-127232568 ATGCAGGATGAGATTGAGGAGGG - Intergenic
961612502 3:128152457-128152479 AAGGAGCAGGAGAGGGAGGATGG - Intronic
961725642 3:128927311-128927333 AGGCAGAAGGAAAGGAAGGAAGG + Intronic
961791691 3:129380982-129381004 TTTCAGAGGGAGAGTGGGGAGGG + Intergenic
961893962 3:130152139-130152161 ATGTTGAAGGATAGTGAGGGAGG + Intergenic
962535705 3:136327283-136327305 ATGCTGTAGGAAAGTGAGCAGGG - Intronic
962621665 3:137186310-137186332 AAGGAGAAGGAGAGGGAGGTAGG + Intergenic
962832746 3:139158678-139158700 ATGCAGCTGGAGGGTGAGGTTGG + Intronic
962930373 3:140030428-140030450 AGACAGAAGGAGAGTGGGTAGGG + Intronic
964108105 3:153060453-153060475 AAGAAGAAAGAGAGGGAGGAAGG + Intergenic
966754143 3:183352722-183352744 ATCCAGAAGGGAAGTGAGGAGGG - Intronic
966767432 3:183475938-183475960 AGACAGAAAGAGAGAGAGGAAGG - Intergenic
967318319 3:188171424-188171446 ATCCAGATGGAGAATGAGAAAGG - Intronic
967587783 3:191235655-191235677 ATGCAGAAGATGAGAGAGTAGGG - Intronic
968555809 4:1245911-1245933 GTGTTGAAGGAGAGTGAGGATGG - Intronic
968764206 4:2459614-2459636 ATGGAGCAGGAGGTTGAGGAGGG + Intronic
968889196 4:3358969-3358991 GTGTAGGAGGAGAGGGAGGAGGG - Intronic
968949976 4:3685465-3685487 AGGCAGCTGGAGAGTGAGGCTGG + Intergenic
969031472 4:4218471-4218493 ATGGAAAAGGAGAGGGAAGAAGG + Intronic
969113426 4:4857353-4857375 TTGCAGAAGGAGGGCGAGGGCGG + Intergenic
969176130 4:5400338-5400360 ATGCAGAAAGAATGTGGGGAAGG - Intronic
969471123 4:7389893-7389915 AGGCTGAAGGACAGTGAGCAGGG + Intronic
969823717 4:9740263-9740285 AAGCAGAAGGAGAAGAAGGAAGG - Intergenic
969963345 4:10969541-10969563 AAAGAGAAGGAGAGAGAGGAAGG - Intergenic
970490789 4:16571535-16571557 TTGCAGCATGATAGTGAGGAAGG + Intronic
970501222 4:16679294-16679316 AAGGAGGAGGAGAGGGAGGAAGG + Intronic
970806575 4:20042947-20042969 ATGCGGAAGGAAAGTGAGTCAGG - Intergenic
970882306 4:20946426-20946448 ATGCAGAAGACGAGTTAGCAAGG + Intronic
970947702 4:21714530-21714552 AGGAAGAAAGAGAGGGAGGAAGG + Intronic
971194725 4:24461769-24461791 AGGCAGAAGGAAAGTGTAGAAGG - Intergenic
971278127 4:25217195-25217217 AGGCAGAAGGAGAGAGAGAGTGG + Intronic
971305114 4:25473289-25473311 ATGAAGAAGGAGAAGGAGAAGGG + Intergenic
971353620 4:25874504-25874526 AAGCAGAAGGAAAATAAGGAGGG + Intronic
971595381 4:28520996-28521018 AGGTAGAAGGAGAGGAAGGAAGG - Intergenic
972067999 4:34976184-34976206 ATGGAAATGGAGACTGAGGAGGG + Intergenic
972234854 4:37120061-37120083 GTGAAAATGGAGAGTGAGGATGG - Intergenic
972794868 4:42405347-42405369 ATCCAGAAGAAGAGTGAGGCTGG + Intergenic
972952503 4:44344925-44344947 AAGCTGAAGAACAGTGAGGAGGG - Intronic
973619059 4:52709688-52709710 ATGGAGGAGGAGACTGAGAAAGG + Intergenic
973962683 4:56127522-56127544 AGGCAGAAGAAGAGAGAAGAAGG - Intergenic
974043197 4:56875684-56875706 ATGCCAATGGAGTGTGAGGAAGG - Intergenic
974093286 4:57334929-57334951 AGGCAGAAGGAGATTGTGCACGG + Intergenic
974369795 4:61000733-61000755 TTCCAGAAGAAGAGAGAGGAAGG + Intergenic
974841307 4:67302680-67302702 ATGGAGGTGGAGAGAGAGGAAGG + Intergenic
975012187 4:69370245-69370267 ATGGTGAAGGGGTGTGAGGATGG - Intronic
975263745 4:72336661-72336683 ATCCAGTTGGAGAGTGATGAGGG + Intronic
975329850 4:73100310-73100332 ATGCTGCAGCAGAGTGAGCAAGG + Intronic
975365937 4:73527562-73527584 AAACAGAAGGAGAGAGAGTAGGG + Intergenic
975825128 4:78311486-78311508 ATGCAGATGGAGAAAAAGGAGGG - Intronic
976007387 4:80446110-80446132 ATGAGGAAGAAGAGAGAGGAAGG + Intronic
976600039 4:86929638-86929660 ATCTAGAAGGAGAGTGTGGTAGG - Intronic
976718765 4:88150416-88150438 AGGCTGAAGCAGAGTGAGGGAGG + Intronic
976744241 4:88387818-88387840 ATTAAGAAGGAGTGTGAGAAAGG - Intronic
976858079 4:89628474-89628496 ATGAAGAGGGAGAGGTAGGAAGG - Intergenic
977153382 4:93542639-93542661 ATGCTGAAAAAGTGTGAGGAGGG + Intronic
977271101 4:94917970-94917992 CAGGAGAAAGAGAGTGAGGAGGG - Intronic
977790927 4:101102214-101102236 ATGAAGAAGGAAAGAAAGGAGGG + Intronic
978445167 4:108773221-108773243 ATGCATAAGGAGAGGTATGAGGG - Intergenic
978487807 4:109276012-109276034 ATGGAGGAGAAGAGTGAGCAGGG - Intronic
978611965 4:110551813-110551835 GTGCAGAAGGACCATGAGGAAGG - Intronic
978696201 4:111583594-111583616 AGAGAGAAAGAGAGTGAGGAGGG + Intergenic
978795125 4:112701185-112701207 AGCCAGAGGGAGAGAGAGGAGGG + Intergenic
978850028 4:113323845-113323867 ATGCAGAAGGAGATGGCGAAAGG - Intronic
978955182 4:114603531-114603553 AGGCAAGAGGAGAGTTAGGAGGG + Intronic
979040519 4:115786530-115786552 ATGGAGATGGATAGTGATGATGG - Intergenic
979048927 4:115904848-115904870 ATGTTGAAGGAGAATGAAGAGGG + Intergenic
979547294 4:121952061-121952083 AGGGAGAAGGAGAGGGAGGGCGG + Intergenic
981041637 4:140228244-140228266 ATGAAGAAGGAGGAGGAGGAGGG - Intergenic
981495758 4:145390544-145390566 ATGGAGAAGGGGAGAGAGGGAGG + Intergenic
982057081 4:151562273-151562295 ATGAAGAAGGAGGGGTAGGAAGG + Intronic
982209083 4:153020496-153020518 GTGCAGGAGGAGAGTGGGGAAGG - Intergenic
982225860 4:153165771-153165793 AAGGAAAAGGAGAGTGAGGATGG - Intronic
982306875 4:153941775-153941797 CTGCAGAAGGGGAGTGATCAGGG - Intergenic
982900916 4:161002527-161002549 ATCCAGGTGCAGAGTGAGGAGGG + Intergenic
983253169 4:165368009-165368031 GTGCATAAGGAGAGTCAGGCAGG - Intronic
983481010 4:168273962-168273984 GTGCTGAAGGAGAGCGACGACGG - Exonic
983886084 4:172982158-172982180 ATGCAGAAAGAAATTGAAGAAGG - Intronic
984006273 4:174313774-174313796 AGGGTGAAGGAGAGTAAGGAAGG + Intronic
984228146 4:177060748-177060770 AGGGAGAATGATAGTGAGGAGGG - Intergenic
984736478 4:183113268-183113290 ATGTAGAAACAGAGGGAGGAGGG + Intronic
984781212 4:183527405-183527427 AAGAAGAAAGAGAGAGAGGAAGG + Intergenic
984791297 4:183617298-183617320 AGACAGAAAGAGAGAGAGGAAGG - Intergenic
984822837 4:183898160-183898182 CTGGAGAAGGAGAGGGAGGGCGG - Intronic
984951271 4:185009490-185009512 AGGGAGAAGGCAAGTGAGGATGG + Intergenic
985102040 4:186468040-186468062 GGGAAGAAGGAGAGTGGGGAAGG - Intronic
985564966 5:611161-611183 ATGCAGGAGGAGTGTGCAGAGGG - Intergenic
985569514 5:637307-637329 ATGCAGAGGGAGGGTGCCGAGGG - Intronic
985808607 5:2067038-2067060 CTGCAGAAGGTGAGTGAGGTCGG + Intergenic
986089889 5:4493604-4493626 AGGCAGGAGGAGAGAGAGGAAGG - Intergenic
986229696 5:5852077-5852099 ATGCAGCAGGAGAATAAGGTAGG - Intergenic
986470375 5:8067830-8067852 ATGAAGTAGGAGAGAAAGGAGGG + Intergenic
986674860 5:10175042-10175064 ATACACAAGGACAGTGGGGAAGG + Intergenic
986703890 5:10439644-10439666 ATGGAAAAGGAGAGAGAGCAGGG - Exonic
986995780 5:13605526-13605548 AAGAAGAATGAGAGTAAGGAGGG + Intergenic
987149095 5:15020849-15020871 AAGGAGAAGCAGAGAGAGGAGGG + Intergenic
987298259 5:16573655-16573677 AGGCACAGGGAGAGGGAGGATGG + Intronic
988202550 5:28086230-28086252 ATTCAGAAGAAGAGAGAGAAAGG + Intergenic
988949760 5:36244284-36244306 ATGCAGAAGTAGTCTCAGGAAGG - Intergenic
989203882 5:38792594-38792616 GTGAGGAAAGAGAGTGAGGATGG - Intergenic
989428437 5:41323785-41323807 ATGTAGAAGGAGAGGAAGAAAGG + Intronic
990123430 5:52484364-52484386 AAGAAGAAGGAGAATGAGGAGGG + Intergenic
990330754 5:54723195-54723217 ATGCAAAAGGAAAGGAAGGAAGG + Intergenic
990703588 5:58501803-58501825 ATGCACAAGAAGAGTGATGCTGG - Intergenic
992197830 5:74357259-74357281 CCTCAGAAGCAGAGTGAGGAGGG - Intergenic
992560245 5:77944886-77944908 AAGAAGAAAGAGAGAGAGGAAGG + Intergenic
993139127 5:84008146-84008168 TTGCAGGAGTAAAGTGAGGATGG + Intronic
993426131 5:87766175-87766197 AGGCAGAAGGAAAGGGAGAAGGG + Intergenic
993628135 5:90250842-90250864 ATGAAGAAGGAGAGGGATAAGGG + Intergenic
994641855 5:102420876-102420898 ATGCAGAAGGTGAGTGATTTCGG + Intronic
995848809 5:116522989-116523011 ATTCATCAGGAGAGCGAGGAGGG + Intronic
996148120 5:120000005-120000027 AGGGAGAAGGAGATAGAGGAAGG + Intergenic
996367776 5:122721206-122721228 ATGGAGAAGGAAAGGAAGGAAGG + Intergenic
997415669 5:133726479-133726501 CTTCTGGAGGAGAGTGAGGATGG - Intergenic
998540843 5:142980050-142980072 AGGGAGAAGGGGAGCGAGGAAGG - Intronic
998558089 5:143145401-143145423 ATAAAGAGAGAGAGTGAGGACGG - Intronic
999082155 5:148854956-148854978 CTGCAGATAGAGTGTGAGGAAGG + Intergenic
999152720 5:149436988-149437010 ATGCAGGAGGACAGTGGGGCTGG + Intergenic
999742406 5:154566254-154566276 AGGCAGGAGGAGTGTGAGGTAGG + Intergenic
1000456131 5:161451690-161451712 ATGAAGAATGATGGTGAGGAGGG + Intronic
1001303147 5:170552595-170552617 AGGGAGAAGGGGAGTGAGGGTGG + Intronic
1001655564 5:173346191-173346213 AAGCAGAAGGGGAGTGAAGGGGG + Intergenic
1001917181 5:175571590-175571612 ATGCAGGAGCAGGGAGAGGAAGG - Intergenic
1002099519 5:176850516-176850538 AGGCAGAAGGAGAGTCGGGATGG + Intronic
1002696109 5:181092274-181092296 ATGGAGAAGGAGATAGACGAGGG + Intergenic
1002803396 6:548724-548746 ATACAGAAAGGGAGAGAGGAAGG + Intronic
1002839812 6:896153-896175 ATGCAGAGGGAGGGAGATGAGGG - Intergenic
1002878883 6:1234806-1234828 ACCCAGATGGAGAGTGAGGGAGG + Intergenic
1003138586 6:3453440-3453462 ATGCAGAAGGCGAGAGAGGCTGG + Intronic
1003190134 6:3867273-3867295 ACGCACAAGGCGAGTGATGAGGG + Intergenic
1003215650 6:4107713-4107735 CTGGAGAAGGATAGTGACGATGG - Intronic
1003282961 6:4710282-4710304 CTGCAGAAAGAGAAAGAGGAAGG + Intronic
1003509929 6:6771287-6771309 AAGAAGAAGGAGAAGGAGGAAGG + Intergenic
1003509940 6:6771330-6771352 AAGAAGAAGGAGAAGGAGGAAGG + Intergenic
1003509951 6:6771373-6771395 AAGAAGAAGGAGAAGGAGGAAGG + Intergenic
1003708784 6:8565616-8565638 AGGCAGGTGGAGATTGAGGAGGG + Intergenic
1004027520 6:11833603-11833625 GTGAAGAATCAGAGTGAGGAAGG + Intergenic
1004255498 6:14059817-14059839 ATGCACAAGGGGTGTGAGGAGGG + Intergenic
1004357905 6:14945947-14945969 ATGCAACAGGAGAGAGAGAAGGG + Intergenic
1004813067 6:19281074-19281096 AATCAAAGGGAGAGTGAGGAAGG + Intergenic
1006030885 6:31175780-31175802 CTGCAGAAGGAGAGAAGGGAAGG - Intronic
1006089496 6:31620239-31620261 AGGGAGAAAGAGAGAGAGGACGG - Intergenic
1006245221 6:32728033-32728055 AGGGAGAAAGAGAGGGAGGATGG - Intergenic
1006278707 6:33029016-33029038 ATGGAGAAGGAGAGAGGGGGAGG - Intergenic
1006474599 6:34246062-34246084 ATGCTGCAGCAGAGTGAGCAAGG + Exonic
1006491108 6:34389300-34389322 AGGCAGCAGGAGAGAGAGAAGGG - Intronic
1006509394 6:34513716-34513738 TTCCAGAATGAGAGTGAGGGAGG + Intronic
1006563194 6:34931532-34931554 AAGCAGAAGGGGAGAGAGTAGGG - Intronic
1006735653 6:36270716-36270738 AGACAGAAGGAGCGTGAGGGAGG + Intronic
1007380655 6:41488303-41488325 AGCCAGAAGGAGACTGAGGAGGG - Intergenic
1007392432 6:41557692-41557714 ATGCCAAAAGAGAGTGAGAATGG + Intronic
1007514374 6:42399706-42399728 ATGGGGAAGGAGAGGGAGTAGGG + Intronic
1007615516 6:43177617-43177639 ATTAAGAAGGAGAGAGAGGCCGG + Intronic
1007618356 6:43196035-43196057 ATGTGAAAGCAGAGTGAGGAGGG - Intronic
1007707560 6:43799999-43800021 ATGGAGATGGTGAGAGAGGAAGG + Intergenic
1007762097 6:44139224-44139246 ATGGAGAAGGGGAGGGATGAAGG - Intronic
1008326394 6:50187350-50187372 AGGCAGAATGACAATGAGGATGG - Intergenic
1008537595 6:52518577-52518599 AGGCAGGAGAAGAGAGAGGAAGG + Intronic
1008705775 6:54157353-54157375 CTGCAGGAGCAGAGTGAAGAGGG - Intronic
1008921738 6:56850098-56850120 ATGGAGACTGAGAGTGAGCAGGG - Intronic
1009315954 6:62222203-62222225 ATGGAAAAAGAGAGTGAGGGAGG + Intronic
1010024919 6:71204132-71204154 AGGAAGAAAGAGAGTGGGGAAGG + Intergenic
1010181909 6:73096394-73096416 AAGCAGAATGAGAGAGAGCATGG + Intronic
1010949977 6:82024116-82024138 ATGCAAATGGAGAGTGGTGATGG - Intergenic
1011423829 6:87203925-87203947 AAGCCTAAGCAGAGTGAGGAGGG + Intronic
1011642649 6:89430533-89430555 AGGCAGAAGGAGGGTGAGCTAGG + Intergenic
1011902389 6:92314925-92314947 AGAGAGAAAGAGAGTGAGGAGGG - Intergenic
1012806168 6:103896025-103896047 AGGCAGAAGAAGAGAGAGAATGG + Intergenic
1013207825 6:107960060-107960082 GTGCAGAAAAAAAGTGAGGAGGG - Intergenic
1013296712 6:108764307-108764329 ATTCACAAGGAGAGGAAGGACGG - Intergenic
1013710508 6:112891901-112891923 AGGAGGCAGGAGAGTGAGGAAGG - Intergenic
1015261370 6:131241280-131241302 ATGGAGAAGGAGAAGGAGGAGGG + Intronic
1015326877 6:131933478-131933500 ATTAAGAAGGAGAATGAGGGTGG + Intergenic
1015426216 6:133070875-133070897 ATGCAGAGTGAGAGTGAAGTAGG - Intergenic
1015519124 6:134114122-134114144 ATGCTGCAGCAGAGTGAGGAGGG - Intergenic
1015809084 6:137143225-137143247 GTGCTGGAGAAGAGTGAGGAAGG + Intergenic
1015990606 6:138937624-138937646 ATGCAGAAGGAGATGGAGACAGG + Intronic
1016695750 6:146992942-146992964 CTGCTGATGAAGAGTGAGGAAGG - Intergenic
1016714551 6:147209782-147209804 ATTCAGAATGACAGGGAGGAAGG + Intronic
1016792364 6:148079160-148079182 AGGTAGAAGGGGAGTGAGGAAGG + Intergenic
1016792366 6:148079173-148079195 GTGAGGAAGGAGAGTGAAGAGGG + Intergenic
1017035368 6:150262422-150262444 ATGAAGAAGGAGGGTGGGGAAGG - Intergenic
1017041816 6:150314259-150314281 CTGCAGAAGGGGAGAGGGGAGGG + Intergenic
1017625625 6:156345515-156345537 AAGGAGAGGGAGAGAGAGGAAGG + Intergenic
1017669517 6:156756648-156756670 AAGGAGAAGGAGAGGAAGGAAGG + Intergenic
1018260812 6:161969055-161969077 ATGCTGAAAGAGAGGCAGGAGGG + Intronic
1018385638 6:163300477-163300499 CTGCAGGAAGAGAGTGAGGGCGG - Intronic
1018431266 6:163724573-163724595 CTCCAAATGGAGAGTGAGGATGG + Intergenic
1019118823 6:169787021-169787043 AGGAAGAAGGAGAGGAAGGAAGG - Intergenic
1019158112 6:170052502-170052524 AGACAGAAGGAGAGAGAGGGAGG - Intergenic
1019332331 7:466591-466613 AGGGTGAAGGAGAGTGAGGGAGG - Intergenic
1019495487 7:1337766-1337788 AGAAAGAAGGAGAGAGAGGAGGG - Intergenic
1019718642 7:2555008-2555030 AGCCAGTAGGAGGGTGAGGAGGG + Intronic
1019759297 7:2797609-2797631 ATGCTGCAGGAGAGAGATGAAGG - Intronic
1020011358 7:4807556-4807578 AGAGAGAAGGAGAGGGAGGAGGG - Intronic
1020011369 7:4807594-4807616 AGAGAGAAGGAGAGGGAGGAGGG - Intronic
1020011402 7:4807704-4807726 GGGGAGAAGGAGAGGGAGGAGGG - Intronic
1020115322 7:5473000-5473022 CTGCAGCAGGGGAGAGAGGATGG - Intronic
1020660457 7:10974665-10974687 GTGCAGAAGCAGGGTGGGGAGGG - Intronic
1021280259 7:18708282-18708304 ATGGAGAAAAAGAGGGAGGAAGG + Intronic
1021364052 7:19753964-19753986 ATGCACAAGGAAGGTGAAGAGGG - Intronic
1022094910 7:27133235-27133257 TTGCAAAGGGAGATTGAGGAAGG - Intronic
1022108832 7:27215376-27215398 AAGGAGGAGGAGAGTGAAGAAGG - Intergenic
1022140735 7:27491423-27491445 TTGGAGAAGGAGAGGAAGGAGGG + Intergenic
1022332811 7:29396678-29396700 ATGCAGCAGGAGAGTGGGAGGGG - Intronic
1022471784 7:30686059-30686081 ATGAAGCAGGAGGGTGAGGATGG - Intronic
1022566893 7:31412877-31412899 ATGAAGAAGGAGGGAAAGGAAGG + Intergenic
1022636599 7:32142178-32142200 AGGCAGAAGGAGAAGGGGGAAGG + Intronic
1022857519 7:34329946-34329968 AGGCTGAAGGAGAGAGAAGAAGG + Intergenic
1023013575 7:35944027-35944049 CTGCAGAAGGGGCCTGAGGAGGG + Intergenic
1023595204 7:41822417-41822439 AGGGAGGAGGAGAGGGAGGAAGG + Intergenic
1023641638 7:42264885-42264907 GTGCAGGAGGAGAGTGAGAAAGG + Intergenic
1023711943 7:43004221-43004243 ATGCAGATGGATAGTGGTGATGG - Intergenic
1023836289 7:44069825-44069847 AGGGAGAAGGAGAGATAGGAGGG + Intergenic
1024047530 7:45595371-45595393 AGGCAGAAGGAGAGGGAGAACGG - Intronic
1024077553 7:45829807-45829829 CTGCAGAAGGGGCCTGAGGAGGG - Intergenic
1024130130 7:46343052-46343074 CTGCTGAAGAAGAATGAGGAAGG - Intergenic
1024147563 7:46532881-46532903 CTCCAGAAAGAGAGTGTGGAGGG - Intergenic
1024207934 7:47179765-47179787 GTGCAGAAGGAGAAAGAGAAGGG + Intergenic
1024217119 7:47256928-47256950 ATGGAGACGGTGAGGGAGGAGGG + Intergenic
1024603403 7:51006561-51006583 AGGCAGGAGAAGAGAGAGGATGG + Intergenic
1025126857 7:56351605-56351627 CTGCAGAAGGGGCCTGAGGAGGG + Intergenic
1025673199 7:63627374-63627396 AGGTAGAAGGGGAGGGAGGAGGG + Intergenic
1026529522 7:71185046-71185068 AAGCAGAAGGAGGAGGAGGAGGG - Intronic
1026834829 7:73631738-73631760 AGGGAGAAGGGGAGAGAGGAAGG - Intergenic
1027386353 7:77662993-77663015 GGGAAGAAGGAGAGAGAGGAAGG + Intergenic
1027748310 7:82107427-82107449 AGGGAGAAGCAGAGAGAGGAAGG - Intronic
1028686478 7:93594709-93594731 ATGCAGAACGTGGATGAGGAGGG + Intronic
1029310958 7:99663804-99663826 ATAAAGAAGGAGATTGGGGAAGG - Intronic
1029856755 7:103525131-103525153 AGGCAGAAAGAGAGAGAGGAAGG - Intronic
1029956686 7:104647772-104647794 AGGAAGAAGGAGAAAGAGGAAGG + Intronic
1029966397 7:104745245-104745267 AGGAAGAAGGAGAAAGAGGAAGG - Intronic
1030114018 7:106049683-106049705 ATGCAGAATGGGAGACAGGAGGG + Intergenic
1030160360 7:106502159-106502181 CTGCAGAAGCAGAGTCAGGAGGG - Intergenic
1030176852 7:106662573-106662595 ATGCATAAGTAGAATGACGAAGG + Intergenic
1031395597 7:121269997-121270019 AGGGAGAAGGAGAGAGAGGCGGG + Intronic
1031732992 7:125320864-125320886 ATAGAGAAAGAGAGTGAGGAGGG - Intergenic
1031766714 7:125787266-125787288 ATGGAGGAGGAGTGAGAGGAAGG + Intergenic
1032197191 7:129796285-129796307 ACGCAGAGGGAGGCTGAGGAGGG - Intergenic
1032576375 7:133059411-133059433 ATGGAGGAGGAAAGTGAGGAGGG + Intronic
1033279435 7:139995374-139995396 ATGCAGGAGGGGTGTGCGGAGGG + Intronic
1033588145 7:142789379-142789401 ATGCAGAAGTGGAGTTAGAATGG - Intergenic
1033615764 7:143012755-143012777 AGGAAGAAGGAGAGGGAGAATGG + Intergenic
1033895237 7:146061061-146061083 ATGGAGAAAGACAGTGAAGATGG + Intergenic
1034256032 7:149725093-149725115 AGACAGGAGGGGAGTGAGGAGGG - Intronic
1034354421 7:150441866-150441888 AAGCAGAAGGAGAAGGAGAAGGG - Intergenic
1034679203 7:152915798-152915820 AAGGAGAAGGAGGGTGAGAAGGG - Intergenic
1034821928 7:154223841-154223863 AGGCAGGAGGGGAGTGAGCATGG + Intronic
1034889501 7:154827613-154827635 AAGCCCAAGCAGAGTGAGGAGGG + Intronic
1035032214 7:155868870-155868892 TGGCAGAAGGAGAGCCAGGAGGG + Intergenic
1035603100 8:910083-910105 CTGCAGATGGAGGGTGGGGACGG + Intergenic
1035971872 8:4258294-4258316 AGGGAGAAAGAGAGTGAGGGAGG + Intronic
1037053796 8:14410217-14410239 AGGCAGAAGGAAAGGGAGGAGGG - Intronic
1037494735 8:19427878-19427900 GTGCACAAGGCAAGTGAGGAAGG + Intronic
1037583608 8:20261540-20261562 ATGCAGAAGGGGGCTGGGGATGG - Intronic
1037648576 8:20816245-20816267 AGGCAGAGGGAGTGTGAGGGAGG - Intergenic
1037816182 8:22113385-22113407 AAGAAGAAGGACAGAGAGGAGGG + Intergenic
1037818779 8:22125611-22125633 AGGCAGCTGGAGAGGGAGGAGGG - Exonic
1037992912 8:23333306-23333328 ATCCCCCAGGAGAGTGAGGAAGG - Intronic
1038138243 8:24814068-24814090 AAGTAGAAGGAGAGACAGGAAGG - Intergenic
1038212650 8:25533858-25533880 ATGCAGAATGGGACTGAGGGAGG - Intergenic
1038269862 8:26066342-26066364 AGGCATCAGGAGAGAGAGGAAGG - Intergenic
1038677302 8:29634992-29635014 GTCCAGAAGGAGAGAGAGAATGG + Intergenic
1039091599 8:33835539-33835561 AGGCTGAAGGAGAGGCAGGAAGG + Intergenic
1039339163 8:36627986-36628008 ATTCAGAGGGAGAGTGCTGAAGG + Intergenic
1039412691 8:37368535-37368557 AGGAAGAATGAGAGGGAGGAAGG + Intergenic
1039674505 8:39646885-39646907 AAGTAGAAGGAGAATGAAGAGGG + Intronic
1039781297 8:40788950-40788972 CTACAGAAAGAGAGAGAGGAAGG + Intronic
1040391578 8:46954948-46954970 CTGCAGGAGGAGGGTGAGGCCGG + Intergenic
1040399681 8:47036296-47036318 ATGAAGAATGAGAGTGAGGTGGG + Intergenic
1042552353 8:70005213-70005235 AGGAAGAAAGAGAGAGAGGAAGG + Intergenic
1042942189 8:74118755-74118777 AAGGAGAAGGAGAAGGAGGAGGG - Intergenic
1043924968 8:86026470-86026492 GTGCAGAAGGAGAGTGAGTGGGG - Intronic
1043930569 8:86086114-86086136 GAGCAGAAAGAGAGGGAGGAGGG + Intronic
1044035582 8:87299250-87299272 ATGTGGAAGGAGAGGAAGGAAGG - Intronic
1044822166 8:96161710-96161732 ATGCAGAAGGAACTTGGGGAAGG - Intergenic
1045113857 8:98960800-98960822 ATGTAGAAAGACAGAGAGGAAGG - Intergenic
1045174018 8:99700738-99700760 GGGCAGAAGGATTGTGAGGAGGG + Intronic
1046015600 8:108601126-108601148 AAGAAGAAGGAGAAGGAGGAGGG + Intergenic
1046058544 8:109108253-109108275 ATGGAGAAGGAGAGAGGTGATGG - Intronic
1046240278 8:111481120-111481142 ATGCAGAGAGAGAGAGAGCATGG - Intergenic
1046522505 8:115343447-115343469 TTGCAGAAGGAAAATGGGGAAGG - Intergenic
1046547905 8:115674597-115674619 AGGGAGAAGGAGGGAGAGGAAGG - Intronic
1046760716 8:118017217-118017239 ATGTATAAGGAGAATGAGGTAGG - Intronic
1046918919 8:119706859-119706881 AAGAAGAAAGAGAGAGAGGAAGG - Intergenic
1047448752 8:124943643-124943665 AAGCAGAAAGAGAGAGAGAAAGG - Intergenic
1048039210 8:130709173-130709195 ATGGAGAATTAGAATGAGGAGGG + Intergenic
1048156192 8:131955777-131955799 TTGCAGAAGGAGAAGAAGGAGGG - Exonic
1048317697 8:133374527-133374549 GAGCAGAAGGAGAGTGAGAGCGG - Intergenic
1048317703 8:133374578-133374600 GAGCAGAAGGAGAGTGAGAGCGG - Intergenic
1048427127 8:134333099-134333121 ATGCAGATGAAGAGTCAGGAAGG + Intergenic
1048842285 8:138576679-138576701 ATGCAGAAAGAGAGGGGAGAGGG + Intergenic
1048852224 8:138656186-138656208 AAACAGAAGGAGAGTAGGGATGG - Intronic
1048938572 8:139377225-139377247 AGGCTGGATGAGAGTGAGGAGGG - Intergenic
1048941464 8:139404138-139404160 GTGCAGAAGCAGAGTGATGTGGG + Intergenic
1049057979 8:140254177-140254199 CTGCAGGAGCAGAGTCAGGAGGG - Intronic
1050405926 9:5308746-5308768 TTGCAGGAGCAGAGTGAGGGAGG - Intergenic
1050839584 9:10131131-10131153 AGGAATAAAGAGAGTGAGGATGG + Intronic
1052053347 9:23874732-23874754 AGGCAGCAGGAGAGAGAGAAGGG - Intergenic
1052406837 9:28072033-28072055 ATGTAGAAGGAGGATGAAGATGG - Intronic
1052778258 9:32754854-32754876 GTGGAGGAGGAGAGTGAGGTGGG - Intergenic
1053290868 9:36878983-36879005 ATGCAGAAGGAAAGAATGGAGGG + Intronic
1053575094 9:39351539-39351561 ATGATTAAGGTGAGTGAGGAAGG + Intergenic
1053839600 9:42179474-42179496 ATGATTAAGGTGAGTGAGGAAGG + Intergenic
1054096659 9:60910222-60910244 ATGATTAAGGTGAGTGAGGAAGG + Intergenic
1054118062 9:61185848-61185870 ATGATTAAGGTGAGTGAGGAAGG + Intergenic
1054589693 9:66996716-66996738 ATGATTAAGGTGAGTGAGGAAGG - Intergenic
1055297821 9:74852446-74852468 AGGGAGAGGGAGAGGGAGGAGGG - Intronic
1055481984 9:76717686-76717708 ATGCAGAAGGTGTGTGTGGCTGG - Intronic
1055518138 9:77053765-77053787 ATGGAGATGGAGAGGGAGTAGGG - Intergenic
1056285093 9:85079547-85079569 AGGCAGTAGGGGAGGGAGGATGG - Intergenic
1056295242 9:85186516-85186538 CTGCAGACGGAGAGTGAAGCAGG - Intergenic
1056463057 9:86826647-86826669 GGGCAGAAGAAGAGAGAGGAAGG - Intergenic
1056548887 9:87635385-87635407 AAGCAGAATGCGAGTGAGGTGGG + Intronic
1056755365 9:89378698-89378720 ACGCAGATGGAGACTGAGGCCGG - Exonic
1057108743 9:92446843-92446865 AAACAGAAAGAGAGTGAGGGAGG + Intronic
1057185543 9:93055642-93055664 ATGGAGAAGGAGGGTGAGGAAGG + Intergenic
1057241044 9:93409556-93409578 CAGCAGGAGGAAAGTGAGGATGG - Intergenic
1057242782 9:93426873-93426895 GTGCAGGAGGAGAGTGAGGATGG + Intergenic
1057447141 9:95124546-95124568 AACTAGAAGGGGAGTGAGGAAGG - Intronic
1057767992 9:97940365-97940387 ATCTAGAAGCAGAGTGTGGAGGG + Intronic
1057870238 9:98711156-98711178 ATGCTGATGGAGAGTGAGATTGG - Intergenic
1058532998 9:105925328-105925350 ATGGAGAAGGAGAGAAAGGTGGG + Intergenic
1058593457 9:106589503-106589525 AAGAAGAAGAAGAATGAGGAGGG + Intergenic
1058667896 9:107337209-107337231 ATGCACCAGGACAGAGAGGAGGG - Intergenic
1058805744 9:108589800-108589822 ATGGAGAACAAGAGTGAAGAAGG + Intergenic
1058987907 9:110225797-110225819 AGAGAGAAGGAGAGTGAGGAGGG - Intergenic
1059051869 9:110935179-110935201 ATGAAGATGGAAAGTGTGGATGG + Intronic
1059205191 9:112457893-112457915 ATGCAGAGGGCTAGTAAGGATGG - Intronic
1059371521 9:113843400-113843422 ATGCGGAAGGAGAGGGAGGAAGG - Intergenic
1059694317 9:116716237-116716259 AGGAAGACGGAGAGTGGGGATGG + Intronic
1059696755 9:116737046-116737068 ATGCAGAAAGACAGAGAAGATGG + Intronic
1059743039 9:117171681-117171703 AGGCAGTAGGAGAGAGAAGAAGG - Intronic
1060010671 9:120040612-120040634 AGGCATAAGGAAAGTGAGGCTGG - Intergenic
1060373506 9:123097802-123097824 ATGCAGAAGAAGAGAAAAGACGG + Exonic
1060419928 9:123461125-123461147 ATGAAGAAGGTGAGGAAGGAAGG - Intronic
1060864401 9:126983687-126983709 ATGAGGGAGGAGAGGGAGGATGG - Intronic
1061787095 9:133036041-133036063 TTGCAGAAGGAGGGTCAGGAAGG - Intronic
1061937366 9:133865348-133865370 ATGCAGAGGGAAAGTGCAGAAGG - Intronic
1061952628 9:133944805-133944827 ATGCAGGAGGAGCGTGGGGCCGG + Intronic
1062092580 9:134686221-134686243 AAGGAGAAGGAGAAGGAGGAAGG - Intronic
1062638357 9:137503420-137503442 AGAAAGAAGGAGAATGAGGAGGG + Intronic
1062638406 9:137503569-137503591 AAGGAGAAGGAGAAGGAGGAGGG + Intronic
1185432778 X:19150-19172 GAGCAGACGGAGAGTGACGAAGG + Intergenic
1185449548 X:275191-275213 AGGAAGAAGGAGGGAGAGGATGG + Intergenic
1186069960 X:5808802-5808824 AAGCAGCAGGAGAGGGAGGGAGG - Intergenic
1186250419 X:7660162-7660184 AAGCAGGGGGAGAGGGAGGAAGG + Intergenic
1186342321 X:8657833-8657855 AGGAAGAAGGGGAGTGAGGCAGG + Intronic
1186508383 X:10111741-10111763 GTGCAGAGAGAGAGTGAGGTTGG + Intronic
1186808942 X:13167954-13167976 ATGCAGAAGGACATTCAGAACGG - Intergenic
1187699042 X:21947187-21947209 ATGCTGAAGGAGCGGGAGGAAGG - Intronic
1188039769 X:25358216-25358238 ATGAAGAGGCAGAGTGAGCAAGG - Intergenic
1188314824 X:28660065-28660087 AAGCAGAAGCAGAGTGAGGATGG + Intronic
1188666702 X:32831581-32831603 GAGCAGAAGGAGAGAGAGAAGGG + Intronic
1189178736 X:38983117-38983139 AAGGAGGAGGAGAGTGAAGAGGG + Intergenic
1189237833 X:39501872-39501894 AGGCAGAAGGGGAGTGTGGTGGG + Intergenic
1189249981 X:39593277-39593299 ATGCTGGTGGAGAGTGAGAAAGG - Intergenic
1190546250 X:51530872-51530894 ATGGAGGAGGAGAGTGTGGGGGG - Intergenic
1190725349 X:53186739-53186761 ATCCTGAAGGACAGTGAGAAGGG + Intergenic
1190739468 X:53279881-53279903 AGGAAGATGGAGAGAGAGGAAGG + Intronic
1191675226 X:63785681-63785703 ATGCAGAGGGAGGGTGGGGGAGG - Intergenic
1192534767 X:71917836-71917858 ATTCAGGAGGAGAGGGAGCAAGG + Intergenic
1192831538 X:74755710-74755732 CTGCAAAAGGAGTGTGATGAGGG - Intronic
1193448037 X:81629295-81629317 AGAAAGAAAGAGAGTGAGGAAGG - Intergenic
1193568750 X:83114459-83114481 ATTCAGTGGGAGAGAGAGGAAGG + Intergenic
1193593863 X:83422202-83422224 TTGGAGAAGGAGAGAGAGAAGGG - Intergenic
1194988728 X:100521349-100521371 AAGAAGAGGGAGAGTGAGGGAGG + Intergenic
1195658786 X:107358661-107358683 GTGAAGAAGGAGAGGGAGGGAGG + Intergenic
1195943051 X:110180842-110180864 ATGGAGAAGGGAAGTGTGGAAGG - Intronic
1196039828 X:111190194-111190216 AAACACAAGCAGAGTGAGGAGGG + Intronic
1196439536 X:115705761-115705783 AGGGAGAGGGAGAGAGAGGAAGG - Intergenic
1198338035 X:135687697-135687719 AAGCAGAAGGAGAGGAATGATGG + Intergenic
1199101082 X:143801317-143801339 ATGCAGAAGAAAAGAGAAGAAGG + Intergenic
1199316528 X:146385254-146385276 ATGAAGATGGAGAGAGAGGAAGG + Intergenic
1199319853 X:146425529-146425551 ATGGAGAAAGAGAGTGAGATAGG + Intergenic
1199675146 X:150182322-150182344 AGCCAGAGGCAGAGTGAGGAAGG + Intergenic
1199745891 X:150771768-150771790 AAGCAAAAGGAAAGTGAGGAAGG + Intronic
1200799959 Y:7377495-7377517 GTGCAGAAGGAGACAGATGAAGG - Intergenic
1201146272 Y:11067047-11067069 GTACAGAGGGAGAGGGAGGAAGG + Intergenic
1201593641 Y:15641935-15641957 ATTGAGATGGAGAGTGGGGAGGG + Intergenic
1201894870 Y:18982535-18982557 ATGCAGTAGGAGAGCAGGGATGG - Intergenic