ID: 1102246351

View in Genome Browser
Species Human (GRCh38)
Location 12:111358802-111358824
Sequence GTTCTGGGTAACCAACTGCA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 97
Summary {0: 1, 1: 0, 2: 0, 3: 6, 4: 90}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1102246351_1102246361 27 Left 1102246351 12:111358802-111358824 CCCTGCAGTTGGTTACCCAGAAC 0: 1
1: 0
2: 0
3: 6
4: 90
Right 1102246361 12:111358852-111358874 ATGGAGCACTTTCTTTAGAGTGG 0: 1
1: 0
2: 1
3: 18
4: 141
1102246351_1102246359 8 Left 1102246351 12:111358802-111358824 CCCTGCAGTTGGTTACCCAGAAC 0: 1
1: 0
2: 0
3: 6
4: 90
Right 1102246359 12:111358833-111358855 AGTGTGCGCCAAACTCAGTATGG 0: 1
1: 0
2: 0
3: 0
4: 43

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1102246351 Original CRISPR GTTCTGGGTAACCAACTGCA GGG (reversed) Intergenic
903920193 1:26794523-26794545 CTTCTGAGTAACCAGCTGCCAGG - Exonic
904058398 1:27687133-27687155 GTTCTTGGTTACCACCTTCATGG + Intergenic
906748165 1:48235928-48235950 GTTCAGGGTAACCCAGGGCAGGG - Intronic
911118622 1:94272444-94272466 CTTCTGGATAACCAGGTGCAAGG + Intronic
911551906 1:99292668-99292690 GTTTTAGGTAACCAACTGGATGG + Intronic
912771259 1:112465919-112465941 GTTCTGGGTACACTACAGCAAGG + Intergenic
917957813 1:180118095-180118117 ATTCTGGTGAAACAACTGCATGG + Intergenic
919310000 1:195895100-195895122 ATTCTGGATAACCAGCTGGAGGG + Intergenic
921376780 1:214482728-214482750 ATTTTTGGTAAACAACTGCATGG + Intronic
924080768 1:240395269-240395291 CTCCTGGGTGACCAAGTGCATGG - Intronic
1064288419 10:14012465-14012487 GTTCTTGGTCACGAACAGCAGGG + Intronic
1067461911 10:46464651-46464673 GCTCTGGGTGACCATCAGCAAGG + Intronic
1067625284 10:47919947-47919969 GCTCTGGGTGACCATCAGCAAGG - Intergenic
1076291911 10:129351981-129352003 GCTCTGGGTCTCCCACTGCAGGG + Intergenic
1077223129 11:1426135-1426157 GCTCTGGGCACCCAGCTGCATGG + Intronic
1078157957 11:8814975-8814997 GTTCTGGGAAACAAACCACAGGG - Intronic
1078305899 11:10186062-10186084 GTTCTGGGTAACAAATAGCCTGG - Intronic
1084210167 11:67617115-67617137 TTTCTGGGTCACCCCCTGCAGGG + Intergenic
1091101674 11:132880351-132880373 CTTCTGGGTCACAAACTCCACGG + Intronic
1096868571 12:54579178-54579200 GGTCTGGGAAACCAAGGGCAGGG - Exonic
1097147572 12:56952178-56952200 GTCGTTGGTGACCAACTGCATGG - Exonic
1099834065 12:87885004-87885026 GTTTTTGCTTACCAACTGCATGG - Intergenic
1100560241 12:95741105-95741127 TTTCAGTGTAACCCACTGCAGGG + Intronic
1102246351 12:111358802-111358824 GTTCTGGGTAACCAACTGCAGGG - Intergenic
1107575873 13:41721537-41721559 GTTTGGGGTTATCAACTGCATGG + Exonic
1110105625 13:71672317-71672339 GTTTTGGGACACAAACTGCAAGG + Intronic
1111406913 13:87819291-87819313 GTCCTGTGTAACAAAGTGCAAGG + Intergenic
1120219953 14:81720625-81720647 GTTCAGAGCAACCAACTGCCAGG - Intergenic
1124664771 15:31582860-31582882 GTGCTTGGTGACCAACTGGAGGG + Intronic
1140732218 16:77866840-77866862 GTTGTGTGTACCTAACTGCAAGG + Intronic
1145085563 17:19936274-19936296 GTTCTGGGTTACCTTCTCCATGG + Exonic
1147381292 17:40057750-40057772 GTTCTGGGTACCCAAAGGGAAGG + Intronic
1152670337 17:81600413-81600435 GTTCTGTGTACCAATCTGCAGGG + Exonic
1157998885 18:52593149-52593171 GTTTTGGATAACACACTGCAGGG - Intronic
1159429184 18:68328842-68328864 GTTCTGTGATAACAACTGCAAGG - Intergenic
928927081 2:36590918-36590940 GTTCAGAGTAAGCAAGTGCAAGG + Exonic
933816177 2:86070378-86070400 GTTCTAGTTAACTAAATGCAAGG + Intronic
935947662 2:108300914-108300936 TTTCTGGGAAAACAACTGCAAGG + Exonic
936032220 2:109081594-109081616 GTCCTGGGGAACCAACCCCATGG + Intergenic
938443502 2:131356585-131356607 ATTCTGAGCAACCTACTGCAAGG - Intergenic
948453636 2:238093862-238093884 GTTCTGGGTCACCAGCTCCGCGG - Exonic
1170734392 20:19001597-19001619 CCTATGGCTAACCAACTGCATGG + Intergenic
1175791911 20:61745200-61745222 GTTCTGGGAAACCCACGGAAAGG - Intronic
1180700998 22:17781415-17781437 TTCCTGGGGAACTAACTGCAGGG - Intergenic
1181084111 22:20431502-20431524 GTTCTGGGGCCCCGACTGCAAGG - Exonic
1181388091 22:22558998-22559020 GTTCTGGGAAACCGACTCCCGGG - Intronic
1183069307 22:35385206-35385228 CCTCTGCGTAACCAACTACAGGG - Intronic
1183417185 22:37689154-37689176 GTTGTGGGTACCCCACTGCTGGG + Intronic
1183503051 22:38192712-38192734 GATCTGCTTAAGCAACTGCATGG - Intronic
950499337 3:13353943-13353965 GTCCTGGGACACCAGCTGCATGG + Exonic
950798745 3:15532222-15532244 GATCTGGGTAAGCAGCTGCTAGG + Intergenic
953662971 3:44904442-44904464 GTTATGGGTTACCAACTTCTGGG + Intronic
957527866 3:81400344-81400366 GTTCTGTGTAACCCACTGTGAGG - Intergenic
959601033 3:108185951-108185973 GTTCTGGGTGACCAGGGGCATGG - Intronic
961703613 3:128766374-128766396 GTCCTGGGTAACCACCGTCATGG + Intronic
967118986 3:186365931-186365953 GTTCAGGGTCACCAACCGCAAGG + Intergenic
968955403 4:3716452-3716474 GTCCTGGGTTCCCAGCTGCACGG - Intergenic
975041496 4:69749720-69749742 TTTCTGGGAAAACAATTGCAAGG - Exonic
977472270 4:97455852-97455874 GTTGTGGGGCTCCAACTGCATGG - Intronic
980605946 4:135089390-135089412 TTTCTGGATAAGCAACTACAGGG + Intergenic
981449789 4:144883440-144883462 CTGCTGGGTTACCAACTGCTGGG + Intergenic
984034705 4:174650772-174650794 ATTCTGGGTACTCAGCTGCAGGG - Intronic
990507139 5:56456010-56456032 GTTCTGTGTAGGCAACTTCATGG - Intergenic
995792993 5:115913547-115913569 ATTTTTGGTAAACAACTGCATGG - Exonic
997284158 5:132666456-132666478 GTTGTGTGTGAACAACTGCAAGG + Intergenic
998177109 5:139908627-139908649 GCTCTGGATACCCAACTGCAAGG - Intronic
1001112461 5:168908635-168908657 AATCAGGGTAACAAACTGCAAGG + Intronic
1003363974 6:5455196-5455218 CTGCTTGGTAACCATCTGCAGGG - Intronic
1005422583 6:25668155-25668177 GTTCTGTGTTACCAATTGCAAGG - Intronic
1010118653 6:72346211-72346233 ATTCTGGGGAACCAAATACAAGG + Intronic
1010909942 6:81541505-81541527 GTTCTGGGAAACCAACTTCCTGG + Intronic
1013742723 6:113306880-113306902 GTTTTGAGTGATCAACTGCAAGG + Intergenic
1015985138 6:138877008-138877030 GTCCTGTGTAACCCACGGCATGG + Intronic
1016592173 6:145757986-145758008 GTTGTGGATAACAAATTGCATGG - Intergenic
1020025673 7:4898213-4898235 GTTCTGGGTAACCAGATTCTTGG + Intergenic
1021990068 7:26132536-26132558 GTTTTGGGCAACCAAGTTCATGG - Intergenic
1022776263 7:33530942-33530964 GATCTGAAGAACCAACTGCAGGG + Intronic
1023190096 7:37570948-37570970 GTTCTGGATAAACTACTGGAGGG + Intergenic
1024438968 7:49392953-49392975 GTCCTGGGTAACCCACTTAAAGG - Intergenic
1027675911 7:81158304-81158326 GCTTTGGGTAACAAACAGCATGG + Intergenic
1027714501 7:81653111-81653133 GTTCTCAGTAAGCAACTGGATGG - Intergenic
1031607916 7:123791948-123791970 CATCTGTGAAACCAACTGCAAGG + Intergenic
1034202411 7:149290754-149290776 GTTCTGAGCAACCAGCTCCAGGG - Intronic
1036155163 8:6334924-6334946 GTTCAGTGAAACCAACAGCAGGG + Intergenic
1042377539 8:68071664-68071686 GTTCTGGGAAATCTACTGAACGG + Intronic
1045992032 8:108319232-108319254 GTTGTTGGTAACCATTTGCATGG + Intronic
1049861410 8:144901594-144901616 TTTCTCGGTGACCGACTGCAGGG + Intronic
1061145221 9:128793728-128793750 GTTCTGTCTAACCAAGTGCCGGG - Intronic
1061257366 9:129460480-129460502 GCTCTGAGTAATCAGCTGCACGG - Intergenic
1061476201 9:130868368-130868390 TTTCTGGTTAACCAAATGCTAGG - Intronic
1062060517 9:134493020-134493042 GTCCTGGGTCACCAACTCCCTGG - Intergenic
1186151380 X:6678053-6678075 GTTCATGGGAAACAACTGCAAGG + Intergenic
1189266322 X:39719557-39719579 GCTCTGGGTGACCAACTAGAAGG + Intergenic
1189331835 X:40148912-40148934 TTTCTGGGTGAGCATCTGCATGG + Intronic
1192541267 X:71975230-71975252 GTTCAGGGTAAGAAACTGAAAGG - Intergenic
1196604151 X:117636915-117636937 GTTCAGTGTAATCCACTGCAAGG + Intergenic
1198764534 X:140067285-140067307 GTTCTCTCTAACCAGCTGCAAGG + Intergenic