ID: 1102248355

View in Genome Browser
Species Human (GRCh38)
Location 12:111369042-111369064
Sequence GGCGCAGCCGCGGGAGAGCG CGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 288
Summary {0: 1, 1: 0, 2: 0, 3: 30, 4: 257}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1102248341_1102248355 29 Left 1102248341 12:111368990-111369012 CCCGGTGGCGGCGACGGCGGCGG 0: 1
1: 3
2: 104
3: 203
4: 592
Right 1102248355 12:111369042-111369064 GGCGCAGCCGCGGGAGAGCGCGG 0: 1
1: 0
2: 0
3: 30
4: 257
1102248350_1102248355 -7 Left 1102248350 12:111369026-111369048 CCTGGGCGGCCGGGCCGGCGCAG 0: 1
1: 0
2: 4
3: 57
4: 413
Right 1102248355 12:111369042-111369064 GGCGCAGCCGCGGGAGAGCGCGG 0: 1
1: 0
2: 0
3: 30
4: 257
1102248343_1102248355 28 Left 1102248343 12:111368991-111369013 CCGGTGGCGGCGACGGCGGCGGC 0: 2
1: 9
2: 109
3: 233
4: 643
Right 1102248355 12:111369042-111369064 GGCGCAGCCGCGGGAGAGCGCGG 0: 1
1: 0
2: 0
3: 30
4: 257

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1102248355 Original CRISPR GGCGCAGCCGCGGGAGAGCG CGG Exonic
900512741 1:3068228-3068250 GGCGCGGCGGCAGGAGAGCGCGG + Intergenic
901250044 1:7771245-7771267 GGCGGAGCCGGGGGAGTGGGCGG - Intergenic
903055467 1:20633430-20633452 GGCGCAGGCGCTGGTGGGCGGGG - Intergenic
903925131 1:26826618-26826640 GGCGCTGCGGCGGGAGGCCGCGG + Intergenic
905166129 1:36084329-36084351 GGCGGAGGGGCGGGAGGGCGTGG + Intronic
905906140 1:41619692-41619714 GGCTCAGCAGAGGGAGAGCCAGG + Intronic
906202674 1:43970208-43970230 GGCGCTGCAGCGAGAGACCGGGG + Exonic
907199486 1:52714192-52714214 GGCGCAGCCATGGGAGTGGGTGG + Intergenic
915446788 1:155978620-155978642 GGCGGAGCGGAGGGAGGGCGGGG + Intronic
916033019 1:160894927-160894949 GGAGCGGCCGCGGGAGACTGGGG - Intergenic
918045926 1:180941070-180941092 GGGGCAGCCGAGGGGGAGCCGGG - Exonic
920803162 1:209208094-209208116 GCTGCAGCCGCGGGAAAGCCCGG - Intergenic
920845421 1:209589378-209589400 GGCACAGCAGCAGGAGAGGGTGG - Intronic
921074156 1:211686226-211686248 GGAGCAGCAGCAGGAGAGTGCGG - Intergenic
922175964 1:223197912-223197934 GGCGCAGCCGCGGTGGAGAAGGG - Intergenic
922196508 1:223364269-223364291 GGCGCCTCCGCGGGGGCGCGCGG - Intergenic
922528582 1:226325594-226325616 GGAGCAGCCTGGGGAGAGCATGG - Intergenic
922574162 1:226651264-226651286 GGCGAGGCCTCGGGAGAGCGTGG + Intronic
924436546 1:244048565-244048587 GGCGCCGCCGCGTGCGTGCGTGG + Intergenic
924436784 1:244049185-244049207 GGCGCAGCTGCGGGAGGCCCGGG + Intronic
1062843866 10:689944-689966 CGCGCAGGAGCGGGAGCGCGCGG + Intergenic
1063593011 10:7410387-7410409 GGAGGAGACGCGGGAGCGCGGGG + Intronic
1069769517 10:70888466-70888488 GGGGCAGCCGCGGGCGAGGTGGG - Intronic
1069818275 10:71212416-71212438 GGCGCGGCCGCGGCAGAGCTGGG - Intergenic
1070152118 10:73811493-73811515 GGCGGAGCCCGGGGACAGCGGGG - Exonic
1070570705 10:77637912-77637934 AGCGCAGCCCGGGGCGAGCGGGG - Intronic
1071086676 10:81874767-81874789 GGAGCAGCCGCCGAAGATCGCGG + Intergenic
1071527417 10:86366523-86366545 GGCGCAGGGGCGGGCGCGCGGGG - Intergenic
1072107886 10:92291290-92291312 GGCGGAGGCGGCGGAGAGCGAGG - Exonic
1073152705 10:101322686-101322708 AGCGGAGCCGCTGGTGAGCGGGG + Intergenic
1073412166 10:103351089-103351111 GGCGAGGCGGCGGGAGAGCGCGG + Exonic
1075397098 10:122135208-122135230 GGCAGAGCTGCGGGAGAGCCAGG + Intronic
1076052589 10:127347405-127347427 GGCTCAGCCGTGGGAGACAGAGG + Intronic
1076116950 10:127907396-127907418 GCCGCTGCCGCGGGAGGGAGGGG + Intronic
1076354066 10:129839710-129839732 GGCCCAGCCTCGGGACAACGAGG + Intronic
1076721664 10:132395964-132395986 CGCGCGGCCGCCGGAGGGCGAGG + Intergenic
1077337219 11:2010791-2010813 GGCCCAGCCGCGGGTGACTGTGG - Intergenic
1077578651 11:3403056-3403078 GGGGCAGCCTGGGGACAGCGGGG + Intergenic
1078066265 11:8081282-8081304 GGCGAAGCTCCGGGAGTGCGCGG - Intronic
1079223936 11:18588807-18588829 GGCGCAGCCGCGGCTGAGCCCGG - Intergenic
1081573639 11:44306368-44306390 GGCCAAGCCGAGGGAGTGCGGGG - Intronic
1083628056 11:64082115-64082137 GGCGCAGCCACAGGAGGGCCTGG - Intronic
1083767691 11:64849725-64849747 GCTGCAGCCGCTGCAGAGCGTGG - Intergenic
1084310211 11:68312483-68312505 GGGGCGCCCGCGGGAGGGCGCGG + Intergenic
1084385441 11:68840877-68840899 GGCGGGGCCGCGGGAGGGTGGGG - Intronic
1084758380 11:71252734-71252756 GCCGCAGCCGCGGGCGGGAGCGG - Intergenic
1086107000 11:83157329-83157351 GCCGGAGCCGCGAGAGAGCCGGG + Exonic
1086597453 11:88590535-88590557 GGTGCAGACGTGGGAGAGGGGGG - Intronic
1088457733 11:110050253-110050275 GGAGCAGCCGGGAGAGAGCTGGG - Intergenic
1089949245 11:122510038-122510060 GGGGCAGTCGCAGGAGAGCCCGG - Intergenic
1090238252 11:125165033-125165055 GGGGAAGCGCCGGGAGAGCGCGG + Intronic
1202820203 11_KI270721v1_random:65973-65995 GGCCCAGCCGCGGGTGACTGTGG - Intergenic
1091393255 12:138719-138741 GGGGCGGGCGCCGGAGAGCGCGG + Exonic
1092194423 12:6540704-6540726 GGCGGGGCCGCGGGATGGCGAGG + Intronic
1092743207 12:11649779-11649801 GGGAGAGCCGCGGGAGGGCGGGG + Intergenic
1096495493 12:52037258-52037280 GGCGCGGCTGCAGGAGCGCGAGG + Intronic
1096529374 12:52233539-52233561 GGCGCACCCGCTGGAGGGAGGGG - Exonic
1096551862 12:52378301-52378323 GACCCCGCCGCGGGAGAGGGTGG + Exonic
1098595762 12:72272291-72272313 GGCGCAGGGGAGGGAGAGCCGGG + Intronic
1100632216 12:96400268-96400290 GGAGCAGCCGGGCGCGAGCGCGG + Exonic
1102248355 12:111369042-111369064 GGCGCAGCCGCGGGAGAGCGCGG + Exonic
1103209283 12:119154696-119154718 GGCGGAGCTGGGGGAGAGAGTGG + Intronic
1103348349 12:120265745-120265767 GGCGCGGGCGCGGGCGCGCGCGG - Exonic
1103433020 12:120904094-120904116 GCCGCCGCCGCGGGTGAGGGAGG - Exonic
1103856347 12:123973172-123973194 GGGGAAGCCCCGGGGGAGCGGGG - Exonic
1103954247 12:124567581-124567603 GCCGCGGCCGCCGGGGAGCGCGG - Intronic
1104841717 12:131828898-131828920 GCCGCAGCCGCAGGAGCCCGTGG + Intronic
1105409595 13:20160889-20160911 GTCGCCGCCGCGGCAGAGCGGGG - Exonic
1105578837 13:21675318-21675340 GCGGCAGCAGCGGGAGACCGCGG - Intronic
1106517117 13:30465261-30465283 GGCGCCGCGGCGGGCGAGGGCGG - Intronic
1107603985 13:42040682-42040704 GGCGCGGGGGCGGGAGAGCGCGG + Intronic
1108529077 13:51312124-51312146 GGAGCAGCCCAGGGAGAGCATGG - Intergenic
1113120279 13:106917660-106917682 GGCGCAGCCCGGGGAGACCTTGG + Intergenic
1113201226 13:107868340-107868362 TCCGCAGCCGCGGGCGAGCTGGG + Intergenic
1113655062 13:112062891-112062913 GGCGCAGAGGCGGCAGAGAGCGG + Intergenic
1113753382 13:112791725-112791747 GGCCCAGCCGAGGGGGAGAGAGG - Intronic
1115752337 14:36505508-36505530 GGCGGAGCCGCGGCTGGGCGGGG + Intronic
1119004188 14:70908499-70908521 TGCGGAGCCCCGGGAGCGCGGGG + Intronic
1122081506 14:99270681-99270703 GGCGCGGGCGGAGGAGAGCGGGG - Intronic
1122275219 14:100587459-100587481 GGCTCAGCCGCGGCTGCGCGGGG - Intergenic
1122697482 14:103563039-103563061 GGCGAAGGCGCGGCAGAGAGGGG - Exonic
1123041112 14:105490589-105490611 AGCGCTGCCGCGGGCGGGCGAGG + Intronic
1123710015 15:22980256-22980278 AGGGCAGGCGCGGGCGAGCGGGG + Intronic
1125728842 15:41881879-41881901 GGCCCAGCCGCGGTGGAGCAAGG + Intronic
1125767923 15:42147384-42147406 AGCACAGCCACGGGAGAGAGGGG + Intronic
1126490333 15:49229746-49229768 GGCCCAGCTGCGGGGGAGAGTGG + Intronic
1127588126 15:60397579-60397601 GGCGCCGCCGAGGCAGGGCGTGG - Intronic
1127867468 15:63043680-63043702 GGGGCAGCGGCGGGCGGGCGCGG - Intronic
1128068183 15:64776730-64776752 GGCAGAGCCGCGGGAGAACTGGG + Intergenic
1128104035 15:65029667-65029689 GGTGCAGCCTGGGGAGGGCGGGG + Intergenic
1128309655 15:66622246-66622268 GCCGCGGCCGCGGGAGATAGAGG - Intronic
1128312131 15:66637388-66637410 GGAGCAGCCTTGGGAGAGAGAGG + Intronic
1128582400 15:68818954-68818976 GGGGCGGCCGCGGGAGAGGAGGG - Intronic
1129189031 15:73927040-73927062 GGCGCAGCCACGGGAGCCCCCGG + Exonic
1132326328 15:100973422-100973444 GGCACCGCAGCGGGACAGCGTGG + Intronic
1132533707 16:466950-466972 GCTGCAGCCGAGGGAGAGCACGG + Intronic
1132724481 16:1333025-1333047 AGCGCAGCGGAGGAAGAGCGGGG + Intergenic
1132741332 16:1414752-1414774 GGCGTGGCCGCGGGGGCGCGCGG - Intergenic
1132841412 16:1980021-1980043 GGCGCAGGCCCAGGAGAGCCTGG - Exonic
1132972602 16:2696213-2696235 GGCGCAGCTGCCGGACAGGGAGG + Intronic
1132978370 16:2721475-2721497 GGCGGAGACGCGGGAGGGCGGGG - Intergenic
1133006253 16:2883329-2883351 GGCGCTGTCGCCGGAGAGGGAGG + Exonic
1133011067 16:2912117-2912139 GGCGCTGTCGCGGGAGAGGGAGG + Exonic
1133347259 16:5079206-5079228 GGGGCAGCCTGGGGACAGCGGGG + Intronic
1133802031 16:9092019-9092041 GGCGAGGCCGCGGGAGGCCGCGG + Exonic
1134070051 16:11255352-11255374 GGCACGGCCGCGGGCGCGCGGGG + Exonic
1134761806 16:16721093-16721115 GGTGATGCCGGGGGAGAGCGTGG + Intergenic
1134984252 16:18638077-18638099 GGTGATGCCGGGGGAGAGCGTGG - Intergenic
1135040539 16:19114212-19114234 CGCGCAGCCGGGGCAGGGCGCGG + Intronic
1137665221 16:50245909-50245931 GGCGCTGCCGCGGGAGGGAGCGG - Intergenic
1138265476 16:55656850-55656872 CGCGCAGCCCCGGGAGACCTGGG + Exonic
1138651643 16:58464321-58464343 AGCGGAGCGGCAGGAGAGCGCGG - Exonic
1141675502 16:85515318-85515340 GGAGGAGCCTCAGGAGAGCGTGG - Intergenic
1141727471 16:85799407-85799429 GGCGCGGCCGCGGGCTGGCGGGG + Exonic
1142273453 16:89103234-89103256 GCCGCAGCCGCAGGAGCTCGCGG - Intronic
1142695155 17:1629213-1629235 GGGGCGGCCGCGGGAGAGCCCGG - Intergenic
1142810531 17:2393701-2393723 GGTGCAGCCGCGGGAGGGAAGGG - Intronic
1147145470 17:38482170-38482192 GGCCCAGCAGGGGGAGACCGAGG + Intronic
1147684001 17:42276259-42276281 GGAGCAGCCGCGGGCGCCCGAGG - Exonic
1148388643 17:47254242-47254264 CGCGCAGCCCCGGGTGAGCGCGG - Intronic
1148547377 17:48528681-48528703 GGGGCAGCCCAGGGAGAGCCAGG - Exonic
1148726502 17:49795038-49795060 GGTGCAGCCGTGAGAGAGTGAGG + Intronic
1149610483 17:57955195-57955217 GCGGGAGCCGCGGGAGCGCGGGG + Intronic
1152039363 17:77892992-77893014 GGAGCGGCTGCGGGAGAGCCTGG - Intergenic
1152175156 17:78782340-78782362 GGCGCAGGCGCGGGCGGGCGGGG - Intergenic
1152744272 17:82031859-82031881 GGCGCAGCCGGGGCGGGGCGGGG + Intronic
1152821311 17:82439210-82439232 GAGGCAGCCGAGGGAGAGGGTGG + Intronic
1152834250 17:82519461-82519483 GGCGCGGGCGCGGGAGCTCGGGG - Intergenic
1152924222 17:83080065-83080087 GGCGCGGCCGGGGGCGGGCGCGG + Intronic
1153565541 18:6414516-6414538 GGCGCGGCCGCCGCAGAGCCCGG - Intronic
1153997281 18:10454067-10454089 CGCGCAGCCATGGGAGAGAGGGG - Intergenic
1153997424 18:10454508-10454530 GCCGCCGCCGGGGGGGAGCGCGG - Intergenic
1155284098 18:24271452-24271474 GGTGCAGCCGCGGGCGCGTGGGG - Intronic
1156219968 18:35041374-35041396 GGCGGGGCCGCAGGAGGGCGGGG + Exonic
1157599644 18:48886051-48886073 CGGGCAGCCGCGGGGGAGCGTGG + Intergenic
1157804528 18:50648342-50648364 GGGGCAGCCTCTGGAGAGTGGGG + Intronic
1160918890 19:1510629-1510651 GGCGCTGCCTCCGGTGAGCGGGG - Exonic
1162420982 19:10565957-10565979 GTCGCAGCTGCGGGTGAACGCGG - Exonic
1164648139 19:29873751-29873773 GGCGCGGGCGCGGGGGCGCGGGG - Intergenic
1165419982 19:35717881-35717903 AGCGCCGCCGCGGGAGACCGGGG - Intergenic
1166746752 19:45145421-45145443 GGTGCTGGCGCGGGAGAGGGAGG + Exonic
1167379104 19:49128405-49128427 GGAGCAGCTGCTGGAGAGGGAGG + Exonic
1167793144 19:51692849-51692871 GGCGCAGCCTGGGGAAAGCTAGG - Intergenic
1167795185 19:51704196-51704218 GGCGCGGCCGCGTGAGTGAGCGG + Intergenic
1167994908 19:53394634-53394656 GGCGCGGGCGCGGGAGACTGAGG - Intronic
1168272807 19:55259044-55259066 AACACAGCCGCGGGAGGGCGGGG - Intergenic
1168404950 19:56105872-56105894 GGCGCGGCCGGGGGAATGCGCGG - Intronic
1168538522 19:57191701-57191723 GGCGCCGCCCCTGGAGACCGCGG - Exonic
926154862 2:10448181-10448203 GTCGCAGCCGCAGGAGCGCTCGG + Exonic
927881381 2:26692520-26692542 GGGGCGGCCGCGAGAGAGCCCGG - Intergenic
928278046 2:29920456-29920478 GGCGTAGACACGGAAGAGCGAGG + Exonic
928983204 2:37156872-37156894 GGGGCAGCCGAGGGAGCGCGGGG - Intronic
929460828 2:42101296-42101318 GGCGCGGCGGAGGGTGAGCGGGG - Intergenic
929979169 2:46662934-46662956 GCCGCAGCCTCAGGAGAGCCAGG + Intergenic
934562321 2:95319792-95319814 GGCGCAGCGGAGGGAGAGAGAGG - Intronic
934636186 2:95991974-95991996 GGAGGTGCCGCGGGAGGGCGGGG + Intergenic
934763630 2:96869109-96869131 AGCCCCGGCGCGGGAGAGCGGGG + Intronic
934797463 2:97113452-97113474 GGAGGTGCCGCGGGAGGGCGGGG - Intergenic
934835948 2:97589987-97590009 GGAGGTGCCGCGGGAGGGCGGGG + Intergenic
935692592 2:105744792-105744814 GGCGCGGCCGGGGAGGAGCGCGG + Intergenic
938296431 2:130182226-130182248 GGCGCAGCCGCTAGGGGGCGCGG + Exonic
938919854 2:135985414-135985436 GGAGAAGCCGCGGGAGATCATGG - Exonic
940650540 2:156436284-156436306 GGAGCAGGCGCGGGAGCGGGAGG + Intronic
942678276 2:178450982-178451004 GGCCCCGCCGCTGGAGCGCGAGG - Exonic
944070037 2:195657703-195657725 GTCGCAGGCGCGGGCGGGCGAGG + Intronic
948046921 2:234952091-234952113 GGCCCAGCCGGGGGCGCGCGCGG - Intronic
948206969 2:236167633-236167655 GGAGAAGCCGCCGGGGAGCGTGG + Exonic
948420800 2:237859190-237859212 GGTGCAGGCGCTGGGGAGCGTGG - Intronic
948468582 2:238163741-238163763 GGTGCGGCAGCGGGAGCGCGCGG + Exonic
948933716 2:241149265-241149287 GGCGCAGGGGCGGGAGACCCGGG + Intronic
1168795950 20:610301-610323 GGCGGGGCCGTGGGAGCGCGCGG - Exonic
1168802760 20:653544-653566 GGCGGGGGCGGGGGAGAGCGCGG + Intronic
1169132551 20:3173594-3173616 GCCGCAGCCGCTGGTGGGCGGGG - Intergenic
1171452814 20:25247985-25248007 GGCGGGGCCTCGGGAGGGCGGGG - Intergenic
1174157786 20:48528032-48528054 GGAGGAGCCGCAGGAGAGCAGGG - Intergenic
1174346818 20:49936418-49936440 GGCGCAACAGCGGGACTGCGGGG + Exonic
1175415485 20:58797860-58797882 GGAGGAGCCGCTGGAGAGGGTGG + Intergenic
1178707648 21:34888849-34888871 GGCGCGGCGGCGGGGGCGCGCGG - Intronic
1178992254 21:37366318-37366340 GGCGCCGACGCGGAAGCGCGGGG + Intronic
1179224978 21:39445423-39445445 GGCGCGGCCCCGGGAGCGCTAGG + Intronic
1179893364 21:44348963-44348985 GGCGCAGCTGCGGGTGTGTGGGG + Intergenic
1180899732 22:19361554-19361576 GGCACATCTGAGGGAGAGCGTGG + Intronic
1181010372 22:20036862-20036884 GGCGCAGCAGATGCAGAGCGAGG - Exonic
1181272312 22:21666305-21666327 GCCGCGGCCCCGGGAGAGCGCGG - Intronic
1181595646 22:23912880-23912902 GGCCCAGCCTGGGGAGAGCTAGG - Intergenic
1183486198 22:38088942-38088964 GGCGCTGCCGCTGTAGAGCGAGG + Exonic
1183516980 22:38272572-38272594 GGGGCGGCCCCGGGAGAGGGAGG - Intronic
1183577395 22:38700750-38700772 GGCGCGGGCCCGGGAGCGCGAGG - Intronic
1183665144 22:39242562-39242584 GGGGCGGCCGCGGAAGGGCGGGG + Intronic
1183830776 22:40417459-40417481 GGGGCAGGCGCTGGAGAGCCAGG + Exonic
1184153073 22:42649523-42649545 AGCACAGCGGCGGGAGAGCTCGG - Intronic
1184472259 22:44702544-44702566 GCCGCCGCCGCGGACGAGCGGGG + Exonic
1185255207 22:49827769-49827791 GGCGCGGGCGCGGGAGCGGGCGG + Intergenic
953326034 3:42013464-42013486 GGGGCAGCCGCGGGCGAGGAAGG + Intergenic
954367789 3:50155437-50155459 GGCGCAGCGGCGAGAGGTCGCGG + Exonic
954540776 3:51391784-51391806 GGCGCGGCCGCGGATGAGCCGGG - Exonic
954632282 3:52054121-52054143 GGCGCAGCCGAGGTAGAGGTAGG + Exonic
958814597 3:98901655-98901677 GCCGGAGCCGCGGGTGAGCGCGG - Exonic
960747801 3:120908760-120908782 GGCGAACAGGCGGGAGAGCGCGG + Intronic
961754916 3:129121830-129121852 GGCGGAGCCGGGGGCGGGCGGGG - Intronic
962919087 3:139935215-139935237 GGCGCAGCGGCGGGAACCCGAGG + Exonic
966516880 3:180829192-180829214 GGAGGAGCCGCTGGAGAGGGGGG - Intronic
966868558 3:184276013-184276035 GGGGCGGCCGCGGCCGAGCGGGG + Intronic
968225613 3:196970112-196970134 GGCGGCGGCGCGGGAGTGCGAGG - Intergenic
968448437 4:663940-663962 GGCGCAGCGGCGGCACAGCCCGG + Intronic
968563187 4:1295769-1295791 GGCACAGGCGCGGGTGAGGGGGG - Intronic
969930883 4:10629505-10629527 GGCACAGCTGGGGCAGAGCGAGG + Intronic
972335891 4:38106962-38106984 GGGGCAGCAGAGGGAGAGGGTGG - Intronic
973330512 4:48906713-48906735 GGTGCAGTCACGGGGGAGCGAGG - Exonic
976088426 4:81429920-81429942 GGCGCAGTCGGAGGAGAGCCTGG + Intronic
977932188 4:102761041-102761063 GGCGCAGCCGCGGGCGGGAGGGG + Intergenic
982745673 4:159102915-159102937 GGCGCGGCCGCTGGCGGGCGGGG + Intergenic
984928380 4:184826091-184826113 GGCGGGGCCGCGGGAGGGCGGGG - Intronic
985472418 5:54065-54087 GGCGCTGCGGGAGGAGAGCGCGG + Intergenic
986859026 5:11904522-11904544 GCGGCAGCCGCGGGAGAGAGGGG + Intergenic
995623896 5:114056195-114056217 GGCGCGGGCGCGGGCGAGCCAGG - Intergenic
996082158 5:119268564-119268586 GGCCCAGGCGCAGGAGAGCGCGG - Intergenic
997454680 5:134007773-134007795 GGAGCAGCCGCTGCAGAGGGTGG + Intergenic
997521282 5:134525893-134525915 GGGGCCGGCGCGGGAGGGCGGGG - Intronic
998200223 5:140113307-140113329 GGGGGAGCGGCGGGAGAGAGAGG + Intronic
1000209874 5:159099175-159099197 GGCAGAGCGGCTGGAGAGCGCGG + Intronic
1002028366 5:176410983-176411005 GGCTGAGCTGCGGGAGAGAGTGG - Intronic
1002160686 5:177312408-177312430 GGATCAGCGGCGGGAGAGGGCGG - Intronic
1002512705 5:179733145-179733167 CGCGCTGCCGCGGCACAGCGCGG + Exonic
1002590901 5:180291478-180291500 GGCAAAACCGCGGCAGAGCGAGG + Intronic
1002898813 6:1393924-1393946 GGAGCCGCCCCGGGAGAGCAGGG + Intronic
1009320866 6:62286459-62286481 GGCGCAGAGGAGAGAGAGCGCGG + Intergenic
1010625625 6:78133956-78133978 GGCGCAGCTGAGGGAGAAGGAGG - Intergenic
1011684649 6:89814735-89814757 GGAGCAGCCGCTGGACAGCAAGG + Intronic
1012245748 6:96924380-96924402 GACGCAGGTGCCGGAGAGCGAGG + Intergenic
1012399991 6:98835061-98835083 GCCGCCGCCGTGGGACAGCGCGG - Exonic
1014098154 6:117482510-117482532 GGCGAAGCCGGAGGCGAGCGAGG - Intronic
1015127120 6:129767440-129767462 GGCGCAGCAGCGGGGGTCCGAGG - Intergenic
1016965829 6:149717972-149717994 GGGGCTGCCGCGGGCCAGCGCGG + Exonic
1016982231 6:149864073-149864095 GGCGGGGACGCGGGCGAGCGCGG + Intergenic
1017913995 6:158818496-158818518 GGCGCAGGCCCGGGAGAGAGAGG + Intronic
1018652901 6:166006140-166006162 GCAGCAGCCGCGGGCGGGCGGGG - Intergenic
1018669478 6:166167335-166167357 TGCCCAGGCGCTGGAGAGCGCGG + Intronic
1018945741 6:168345910-168345932 GGGGCAGCCGGGGGACAGCTGGG + Intergenic
1019298328 7:290553-290575 GGCGCAGAGGCGGAGGAGCGAGG - Intergenic
1019538265 7:1539900-1539922 GGGTCAGCGGCGGGAGAACGTGG - Intronic
1020125160 7:5529493-5529515 GGGGCAGCCCCGGGAGCGGGCGG - Intronic
1021868182 7:24979573-24979595 GGCGCAGGTGCGGGAGGACGCGG - Intronic
1023049140 7:36236150-36236172 GGCGGAGCCGAGAGTGAGCGAGG - Intronic
1023995736 7:45157953-45157975 GGCGCAGGTGCGGGAAGGCGCGG - Intronic
1026867305 7:73831686-73831708 GGCCCAGCCGACGTAGAGCGAGG - Exonic
1026941261 7:74289374-74289396 GGGGCGGGCGCGGGAGGGCGGGG - Intergenic
1029290642 7:99499921-99499943 GGCGAAGCCGCGGGATAGTTGGG + Exonic
1030138932 7:106285334-106285356 GGCACGGGCGCGGGAGGGCGGGG + Intronic
1031043553 7:116862926-116862948 GGCGCGGGCGCGGGGGAGGGCGG + Intronic
1031604214 7:123748984-123749006 AGCGCAGTCGCCGGAGTGCGAGG - Exonic
1031689092 7:124765889-124765911 CGCGCAGCGGCTGGAGCGCGGGG - Intergenic
1032298799 7:130668403-130668425 GGCGCCGGGGCGGGAGCGCGCGG + Intronic
1033477179 7:141702164-141702186 GGCGGAGCCGCGGGCGCGAGGGG + Intergenic
1035109704 7:156470925-156470947 GGAGCAGGAGCAGGAGAGCGGGG - Intergenic
1035458287 7:159023617-159023639 GGCGCAGCCAGGGGCGGGCGTGG - Intergenic
1035458306 7:159023682-159023704 GGCGCAGCCAGGGGCGGGCGTGG - Intergenic
1035552915 8:544312-544334 GGCGCAGTCCCAGGAGAGCGGGG - Intronic
1035698013 8:1614944-1614966 TGGGCAGCCGCGAGTGAGCGCGG - Intronic
1037825227 8:22156587-22156609 GGCCCAGCCGCGGGAGCGGTGGG - Exonic
1039921455 8:41896775-41896797 GCCGCCGCCGCAGGAGAGGGAGG - Intergenic
1041303598 8:56437979-56438001 GCCCCAGCACCGGGAGAGCGCGG + Intronic
1042903018 8:73746929-73746951 GGCGCGAGCGCGGGAGGGCGCGG - Exonic
1045571368 8:103371773-103371795 GGCGCAGCTCCGGCAGAGGGAGG + Exonic
1049607138 8:143534944-143534966 GGGGCTGCCGCGGGAGGGCAGGG - Intronic
1049658960 8:143811255-143811277 GGCGCTGCCGCCCGAGATCGGGG - Exonic
1049761236 8:144332830-144332852 GGCGCAGAGGCGGGAGAAGGAGG + Exonic
1049850526 8:144827788-144827810 CGCGCCGCCGCGGGGGAGGGTGG - Intronic
1050325028 9:4490413-4490435 GGCCCAGGCGCCGCAGAGCGCGG + Intergenic
1054456838 9:65435966-65435988 AGAGCAGGCGCGGGAGAGCACGG - Intergenic
1057466369 9:95317728-95317750 CGCGACGCCGCGGGAGCGCGCGG - Intergenic
1057490659 9:95517089-95517111 GGAGAAGCCGCGGGAGCGCGCGG - Intergenic
1057806118 9:98221048-98221070 GGAGCAGGAGCGGGAGAGCCTGG - Exonic
1057905177 9:98977477-98977499 GGCGCAGCCGCGAGTGAGCATGG + Intronic
1057921908 9:99104907-99104929 GGCCCAGCCCCCGGGGAGCGTGG + Intronic
1059304088 9:113340281-113340303 GGCGGAGGCGCGGGAGGGCTCGG - Exonic
1060897269 9:127225637-127225659 GCCGAAGCCGCGGGCGTGCGGGG - Intronic
1061287245 9:129631075-129631097 GGAGCAGCCGTGGGACAGCATGG - Intronic
1062083237 9:134635547-134635569 GGCGCAGCCAAGGGACAGCCAGG + Intergenic
1062544112 9:137054065-137054087 GGCGGGGCCGCGGGACCGCGGGG + Intergenic
1185469374 X:373580-373602 GTCGCAGCCGCGGGCCAGTGAGG + Intronic
1186496299 X:10015070-10015092 GGCGGAGCAGCGGGAGTGGGTGG + Intergenic
1186590489 X:10925196-10925218 GGCTCAGCCGCGGGAGAAAATGG - Intergenic
1187698073 X:21940772-21940794 GGAGCAGCCGCGGGAGACTGGGG - Exonic
1190274554 X:48891649-48891671 GGCGCAGCCTCGGAGGAGCCGGG + Intergenic
1192034206 X:67545760-67545782 GCAGCAGCAGCGGGAGAGCGAGG + Exonic
1198637003 X:138711747-138711769 GGCTCAGCCCCGGGAGGGAGGGG - Intronic
1199600770 X:149540087-149540109 GGAGCAGCCGCGGGAGAAGCGGG - Intergenic