ID: 1102252464

View in Genome Browser
Species Human (GRCh38)
Location 12:111396961-111396983
Sequence GAGGCATCCAACCTGGAGCC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1102252454_1102252464 24 Left 1102252454 12:111396914-111396936 CCCCAAACCCGTGTACTCAACGT No data
Right 1102252464 12:111396961-111396983 GAGGCATCCAACCTGGAGCCTGG No data
1102252458_1102252464 17 Left 1102252458 12:111396921-111396943 CCCGTGTACTCAACGTTGATGGC No data
Right 1102252464 12:111396961-111396983 GAGGCATCCAACCTGGAGCCTGG No data
1102252455_1102252464 23 Left 1102252455 12:111396915-111396937 CCCAAACCCGTGTACTCAACGTT No data
Right 1102252464 12:111396961-111396983 GAGGCATCCAACCTGGAGCCTGG No data
1102252459_1102252464 16 Left 1102252459 12:111396922-111396944 CCGTGTACTCAACGTTGATGGCT No data
Right 1102252464 12:111396961-111396983 GAGGCATCCAACCTGGAGCCTGG No data
1102252456_1102252464 22 Left 1102252456 12:111396916-111396938 CCAAACCCGTGTACTCAACGTTG No data
Right 1102252464 12:111396961-111396983 GAGGCATCCAACCTGGAGCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1102252464 Original CRISPR GAGGCATCCAACCTGGAGCC TGG Intergenic
No off target data available for this crispr