ID: 1102252518

View in Genome Browser
Species Human (GRCh38)
Location 12:111397162-111397184
Sequence GTCCCAGGCATCAGGCCCTG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1102252518_1102252522 -7 Left 1102252518 12:111397162-111397184 CCTCAGGGCCTGATGCCTGGGAC No data
Right 1102252522 12:111397178-111397200 CTGGGACTGCGGCCAAGTCCCGG No data
1102252518_1102252531 28 Left 1102252518 12:111397162-111397184 CCTCAGGGCCTGATGCCTGGGAC No data
Right 1102252531 12:111397213-111397235 GCGTGCCCCACGTTGATCCCGGG No data
1102252518_1102252523 0 Left 1102252518 12:111397162-111397184 CCTCAGGGCCTGATGCCTGGGAC No data
Right 1102252523 12:111397185-111397207 TGCGGCCAAGTCCCGGCCCCAGG No data
1102252518_1102252530 27 Left 1102252518 12:111397162-111397184 CCTCAGGGCCTGATGCCTGGGAC No data
Right 1102252530 12:111397212-111397234 CGCGTGCCCCACGTTGATCCCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1102252518 Original CRISPR GTCCCAGGCATCAGGCCCTG AGG (reversed) Intergenic
No off target data available for this crispr