ID: 1102253984

View in Genome Browser
Species Human (GRCh38)
Location 12:111405812-111405834
Sequence TCCGACTCGCGCGCGGCCTG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 47
Summary {0: 1, 1: 0, 2: 0, 3: 1, 4: 45}

Found 10 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1102253974_1102253984 6 Left 1102253974 12:111405783-111405805 CCCTCATGGCCCGCCCCTCCAGC 0: 1
1: 1
2: 0
3: 29
4: 337
Right 1102253984 12:111405812-111405834 TCCGACTCGCGCGCGGCCTGAGG 0: 1
1: 0
2: 0
3: 1
4: 45
1102253970_1102253984 21 Left 1102253970 12:111405768-111405790 CCAGTCCGGGCTCCGCCCTCATG 0: 1
1: 0
2: 0
3: 10
4: 118
Right 1102253984 12:111405812-111405834 TCCGACTCGCGCGCGGCCTGAGG 0: 1
1: 0
2: 0
3: 1
4: 45
1102253977_1102253984 -4 Left 1102253977 12:111405793-111405815 CCGCCCCTCCAGCCGAATCTCCG 0: 1
1: 0
2: 0
3: 9
4: 138
Right 1102253984 12:111405812-111405834 TCCGACTCGCGCGCGGCCTGAGG 0: 1
1: 0
2: 0
3: 1
4: 45
1102253972_1102253984 16 Left 1102253972 12:111405773-111405795 CCGGGCTCCGCCCTCATGGCCCG 0: 1
1: 0
2: 3
3: 14
4: 225
Right 1102253984 12:111405812-111405834 TCCGACTCGCGCGCGGCCTGAGG 0: 1
1: 0
2: 0
3: 1
4: 45
1102253973_1102253984 9 Left 1102253973 12:111405780-111405802 CCGCCCTCATGGCCCGCCCCTCC 0: 1
1: 0
2: 3
3: 76
4: 578
Right 1102253984 12:111405812-111405834 TCCGACTCGCGCGCGGCCTGAGG 0: 1
1: 0
2: 0
3: 1
4: 45
1102253976_1102253984 -3 Left 1102253976 12:111405792-111405814 CCCGCCCCTCCAGCCGAATCTCC 0: 1
1: 0
2: 1
3: 32
4: 357
Right 1102253984 12:111405812-111405834 TCCGACTCGCGCGCGGCCTGAGG 0: 1
1: 0
2: 0
3: 1
4: 45
1102253978_1102253984 -7 Left 1102253978 12:111405796-111405818 CCCCTCCAGCCGAATCTCCGACT 0: 1
1: 0
2: 0
3: 8
4: 94
Right 1102253984 12:111405812-111405834 TCCGACTCGCGCGCGGCCTGAGG 0: 1
1: 0
2: 0
3: 1
4: 45
1102253980_1102253984 -9 Left 1102253980 12:111405798-111405820 CCTCCAGCCGAATCTCCGACTCG 0: 1
1: 0
2: 0
3: 0
4: 33
Right 1102253984 12:111405812-111405834 TCCGACTCGCGCGCGGCCTGAGG 0: 1
1: 0
2: 0
3: 1
4: 45
1102253975_1102253984 5 Left 1102253975 12:111405784-111405806 CCTCATGGCCCGCCCCTCCAGCC 0: 1
1: 0
2: 5
3: 51
4: 491
Right 1102253984 12:111405812-111405834 TCCGACTCGCGCGCGGCCTGAGG 0: 1
1: 0
2: 0
3: 1
4: 45
1102253979_1102253984 -8 Left 1102253979 12:111405797-111405819 CCCTCCAGCCGAATCTCCGACTC 0: 1
1: 0
2: 0
3: 8
4: 65
Right 1102253984 12:111405812-111405834 TCCGACTCGCGCGCGGCCTGAGG 0: 1
1: 0
2: 0
3: 1
4: 45

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1102253984 Original CRISPR TCCGACTCGCGCGCGGCCTG AGG Intergenic