ID: 1102254356

View in Genome Browser
Species Human (GRCh38)
Location 12:111407083-111407105
Sequence GGGGACTGCATTTGAGGAAC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 189
Summary {0: 1, 1: 0, 2: 4, 3: 14, 4: 170}

Found 13 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1102254333_1102254356 28 Left 1102254333 12:111407032-111407054 CCCTTCCCTCCCTTCCCTCCCTC 0: 10
1: 110
2: 600
3: 2495
4: 10198
Right 1102254356 12:111407083-111407105 GGGGACTGCATTTGAGGAACTGG 0: 1
1: 0
2: 4
3: 14
4: 170
1102254339_1102254356 19 Left 1102254339 12:111407041-111407063 CCCTTCCCTCCCTCCGGCCAGGG 0: 1
1: 1
2: 6
3: 51
4: 586
Right 1102254356 12:111407083-111407105 GGGGACTGCATTTGAGGAACTGG 0: 1
1: 0
2: 4
3: 14
4: 170
1102254332_1102254356 29 Left 1102254332 12:111407031-111407053 CCCCTTCCCTCCCTTCCCTCCCT 0: 4
1: 43
2: 305
3: 1834
4: 8908
Right 1102254356 12:111407083-111407105 GGGGACTGCATTTGAGGAACTGG 0: 1
1: 0
2: 4
3: 14
4: 170
1102254349_1102254356 2 Left 1102254349 12:111407058-111407080 CCAGGGGAGCTTTGTTTTGAGGG 0: 1
1: 0
2: 1
3: 10
4: 136
Right 1102254356 12:111407083-111407105 GGGGACTGCATTTGAGGAACTGG 0: 1
1: 0
2: 4
3: 14
4: 170
1102254346_1102254356 9 Left 1102254346 12:111407051-111407073 CCTCCGGCCAGGGGAGCTTTGTT 0: 1
1: 0
2: 0
3: 5
4: 97
Right 1102254356 12:111407083-111407105 GGGGACTGCATTTGAGGAACTGG 0: 1
1: 0
2: 4
3: 14
4: 170
1102254337_1102254356 22 Left 1102254337 12:111407038-111407060 CCTCCCTTCCCTCCCTCCGGCCA 0: 1
1: 0
2: 11
3: 304
4: 4508
Right 1102254356 12:111407083-111407105 GGGGACTGCATTTGAGGAACTGG 0: 1
1: 0
2: 4
3: 14
4: 170
1102254336_1102254356 23 Left 1102254336 12:111407037-111407059 CCCTCCCTTCCCTCCCTCCGGCC 0: 1
1: 2
2: 144
3: 1093
4: 6381
Right 1102254356 12:111407083-111407105 GGGGACTGCATTTGAGGAACTGG 0: 1
1: 0
2: 4
3: 14
4: 170
1102254344_1102254356 13 Left 1102254344 12:111407047-111407069 CCTCCCTCCGGCCAGGGGAGCTT 0: 1
1: 0
2: 1
3: 26
4: 177
Right 1102254356 12:111407083-111407105 GGGGACTGCATTTGAGGAACTGG 0: 1
1: 0
2: 4
3: 14
4: 170
1102254341_1102254356 18 Left 1102254341 12:111407042-111407064 CCTTCCCTCCCTCCGGCCAGGGG 0: 1
1: 1
2: 5
3: 75
4: 566
Right 1102254356 12:111407083-111407105 GGGGACTGCATTTGAGGAACTGG 0: 1
1: 0
2: 4
3: 14
4: 170
1102254347_1102254356 6 Left 1102254347 12:111407054-111407076 CCGGCCAGGGGAGCTTTGTTTTG 0: 1
1: 0
2: 0
3: 15
4: 165
Right 1102254356 12:111407083-111407105 GGGGACTGCATTTGAGGAACTGG 0: 1
1: 0
2: 4
3: 14
4: 170
1102254345_1102254356 10 Left 1102254345 12:111407050-111407072 CCCTCCGGCCAGGGGAGCTTTGT 0: 1
1: 0
2: 0
3: 7
4: 94
Right 1102254356 12:111407083-111407105 GGGGACTGCATTTGAGGAACTGG 0: 1
1: 0
2: 4
3: 14
4: 170
1102254343_1102254356 14 Left 1102254343 12:111407046-111407068 CCCTCCCTCCGGCCAGGGGAGCT 0: 1
1: 1
2: 0
3: 27
4: 239
Right 1102254356 12:111407083-111407105 GGGGACTGCATTTGAGGAACTGG 0: 1
1: 0
2: 4
3: 14
4: 170
1102254334_1102254356 27 Left 1102254334 12:111407033-111407055 CCTTCCCTCCCTTCCCTCCCTCC 0: 82
1: 544
2: 3492
3: 10902
4: 25412
Right 1102254356 12:111407083-111407105 GGGGACTGCATTTGAGGAACTGG 0: 1
1: 0
2: 4
3: 14
4: 170

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1102254356 Original CRISPR GGGGACTGCATTTGAGGAAC TGG Intronic
900300768 1:1976041-1976063 AGGCACTGCCTTTGAGGAACAGG - Intronic
900751266 1:4399317-4399339 TGGGAATGCATTTGAGGAGCTGG + Intergenic
900856151 1:5186145-5186167 GAAGACTGGATTTGAGGAAAAGG + Intergenic
904650948 1:32005535-32005557 AGGGACTGGATTGGAGGAAGGGG + Intergenic
905338548 1:37262226-37262248 GGGGACTGTATTTCAGGAGGGGG - Intergenic
908225204 1:62049208-62049230 GGGGAGTGGAATTGGGGAACGGG - Intronic
910896118 1:92071235-92071257 GGGGGCAGGATTTAAGGAACTGG - Intergenic
912902910 1:113671978-113672000 GGGGACGGTATTTGAGGAACAGG - Intronic
917605692 1:176626687-176626709 AGGGAGTGCATTTGAGGGATGGG + Intronic
919506832 1:198409527-198409549 TGGAACTGCATGTGAGGAAAGGG + Intergenic
921453369 1:215336917-215336939 GGGGAATGAATTTGTGGAAAAGG - Intergenic
921963884 1:221067020-221067042 GGGGAGTGAAGTTGAGGCACTGG - Intergenic
923038275 1:230300778-230300800 GGGGAATGCATTTTCTGAACAGG - Intergenic
923966433 1:239145421-239145443 AGGGACTGCATTTGGAAAACAGG + Intergenic
1062956990 10:1546975-1546997 GAGCACTGCATGTTAGGAACAGG + Intronic
1066165797 10:32787738-32787760 GGAGACTGCATTTGCAGAGCTGG - Intronic
1067967836 10:50933916-50933938 GGCTAGTACATTTGAGGAACTGG - Intergenic
1068800354 10:61133263-61133285 AGGTACTGCTTTTGAAGAACAGG - Intergenic
1074862385 10:117520672-117520694 AGGGACTTCATTTGAGGAACAGG - Intergenic
1076144446 10:128106055-128106077 GGGGACTCCAGTGGAGAAACTGG - Exonic
1076245191 10:128941806-128941828 GGGGACTTCTTTTCAGGCACTGG + Intergenic
1076413289 10:130266695-130266717 GGCTGGTGCATTTGAGGAACTGG - Intergenic
1076804139 10:132846825-132846847 GGGGACTCCATTAGAGAAGCAGG - Intronic
1077483137 11:2825932-2825954 GGGGACAGGATCTGAGGAAGGGG - Intronic
1080855541 11:36108710-36108732 GCGTGATGCATTTGAGGAACTGG + Intronic
1084957879 11:72701123-72701145 GGGGAATGCATTTCAGGCAGAGG + Intronic
1086864945 11:91969707-91969729 GGGCACTGTATCTGAGGAAGTGG - Intergenic
1088863391 11:113822726-113822748 CAGGACAGTATTTGAGGAACTGG + Intronic
1089123625 11:116160666-116160688 GGCTGCTGCATTTGAGGAACTGG - Intergenic
1091106147 11:132921452-132921474 GGGGACTACATTTGTGGCATGGG + Intronic
1091132492 11:133158224-133158246 GAGGACTTCATTTCAGGAATCGG - Intronic
1097143147 12:56920255-56920277 GGGGAATGAATTGGAAGAACTGG - Intergenic
1097552592 12:61094251-61094273 CCAAACTGCATTTGAGGAACTGG - Intergenic
1099534559 12:83828080-83828102 GGGCACTGTTTTTGAGGAAATGG + Intergenic
1101178953 12:102189448-102189470 GGCCACTGCATTTGAAGAACGGG + Intronic
1102254356 12:111407083-111407105 GGGGACTGCATTTGAGGAACTGG + Intronic
1103527498 12:121578327-121578349 GGGGCCTGCCAGTGAGGAACTGG - Intronic
1103740205 12:123086027-123086049 GGGAAGTGCATTTCAGGAAAAGG - Intronic
1103863169 12:124030150-124030172 GGAGGCTGCATCTGAAGAACGGG + Intronic
1105824546 13:24110380-24110402 GGGGACTGCATTTTAGGACTAGG + Intronic
1105910801 13:24864228-24864250 GGGGACTGCATTGGCAGAAGAGG + Intronic
1112314529 13:98349836-98349858 TGGGACTGCTTTTGAGGGGCAGG + Intronic
1116691046 14:48105990-48106012 GGGGACTGCTTTTCATGAAAAGG + Intergenic
1117668565 14:58082222-58082244 GATGACTGTATTTGAGGAAAAGG - Intronic
1118459785 14:65977327-65977349 GGGGTCTGCATTTGACCAAATGG + Intronic
1121757975 14:96419122-96419144 GGAGACTGAATATGAGGGACAGG + Intronic
1122689220 14:103523545-103523567 GGGGACTGCCTTTGGGGGTCGGG - Intergenic
1122919626 14:104874666-104874688 GAGGACTGCAGTGGAGGACCGGG - Intronic
1122919641 14:104874716-104874738 GGGTACTGCAGTGGAGGACCAGG - Intronic
1202865381 14_GL000225v1_random:113964-113986 GGGGTGTGCATTTGAGGGGCTGG + Intergenic
1126988690 15:54345081-54345103 GGGGACAGCATTAGAGTAAGAGG - Intronic
1128862995 15:71090491-71090513 GGGGACAGCATTCTAGGAAGTGG - Intergenic
1129412540 15:75358131-75358153 GGAGACTGCTTGTGTGGAACAGG - Intronic
1129654919 15:77517702-77517724 GGCGACGGCATTTGAGGCCCAGG + Intergenic
1130920817 15:88343079-88343101 GGGTTTTGCATTTGAAGAACTGG - Intergenic
1131260716 15:90886142-90886164 GGGCTCTGCACTTGAGGAAGGGG - Intronic
1132009495 15:98263240-98263262 GGTGACTTCCTTTGAGGAAGGGG + Intergenic
1132107545 15:99074234-99074256 GGGGACTGCAGCTGATAAACAGG + Intergenic
1132878304 16:2149859-2149881 GGGGGCTGCAGGTGAGGAGCAGG - Intronic
1134308632 16:13056392-13056414 GGGAAGTGGATTTGAGGAGCAGG - Intronic
1135377812 16:21964588-21964610 GGGAACAGCATTTTAGGCACAGG - Intronic
1137684687 16:50378621-50378643 GGGGACATCATTTGAGCACCTGG - Intergenic
1146948464 17:36890010-36890032 GGGGATTGCATCTGAGGAGGGGG - Intergenic
1147439012 17:40436201-40436223 GGGGACTGCAAGAGAGGAAAGGG - Intergenic
1148113778 17:45162613-45162635 GGGGCCTGCATTTGAGAATAAGG + Exonic
1155082758 18:22427167-22427189 GGAAACTGCATCTGAGGAATGGG - Intergenic
1156895110 18:42237121-42237143 GGGGCTTGCACTTGAGGAAGAGG - Intergenic
1157415225 18:47496766-47496788 GGGAACTGCATTAGAAGGACAGG - Intergenic
1157511527 18:48278853-48278875 GGGGACAGCCTGTGAGGAGCTGG - Intronic
1158961867 18:62594503-62594525 GTGAACTACATTTGAGGAGCAGG - Intergenic
1159051716 18:63426642-63426664 GGGGGCTGCACTGCAGGAACTGG - Intergenic
1160965878 19:1746716-1746738 GTGGAGGGTATTTGAGGAACCGG - Intergenic
1163150378 19:15409315-15409337 AGGGACTACATTTGATGAAAAGG + Intronic
1164733009 19:30520071-30520093 GGGGTTTGCATTTCAGGAAGAGG + Intronic
1165327330 19:35121764-35121786 GGGGGCTGCATTTGAGCAGAGGG - Intronic
1167703754 19:51066129-51066151 TGGGACTGGGGTTGAGGAACAGG - Intergenic
925062606 2:904953-904975 GGGGAGAGCATGAGAGGAACAGG + Intergenic
925144425 2:1571452-1571474 GATGACTGCATTTGGGGAAAGGG - Intergenic
927155654 2:20219807-20219829 GGGGACAGCCCATGAGGAACTGG - Intronic
929024160 2:37583243-37583265 GGGGACTGCATTTGACAATCAGG - Intergenic
929961762 2:46502524-46502546 GGAGACTGCTTTTGAGGACAAGG - Intronic
932133203 2:69205714-69205736 GGAAACTGCATTTGAGTCACAGG + Intronic
935590968 2:104845121-104845143 GGGGACTGCACTACAGGGACCGG - Intergenic
937378007 2:121351054-121351076 GGGCAGTGCACTTGAGGAGCAGG + Intronic
945196556 2:207242477-207242499 GGGGTCAGCACTGGAGGAACAGG + Intergenic
946947301 2:224834212-224834234 GAGGACTGTACATGAGGAACTGG - Exonic
1172184646 20:33023743-33023765 GGAGACTGCATGTAGGGAACTGG - Intergenic
1172464525 20:35146397-35146419 GGGGAGTGTATTTCAGGCACGGG + Intronic
1173539928 20:43843633-43843655 GGGGACTGCCTTGGAGGATGTGG + Intergenic
1173992959 20:47317232-47317254 GGGGACTGCCTTTGAGAGAACGG - Intronic
1174157623 20:48526827-48526849 GGGGACAGATTTTGAAGAACAGG + Intergenic
1174303193 20:49596624-49596646 GGGGAAAGCAAGTGAGGAACAGG + Intergenic
1175039926 20:56039117-56039139 GGTGACTGCATTTAGGGGACCGG - Intergenic
1175293389 20:57893102-57893124 GGGGGCTGCATTTCAGTCACCGG + Intergenic
1176163851 20:63662735-63662757 GGGGACTGCAGGGGAGGACCTGG + Intronic
1178678501 21:34651826-34651848 GGGTCCTGCATCTGAGCAACTGG + Intergenic
1180757318 22:18171016-18171038 GGGGACAGTCTCTGAGGAACAGG - Intronic
1181074461 22:20366449-20366471 GGGGACAGTCTCTGAGGAACAGG + Intronic
1181129299 22:20720986-20721008 TGTGACTGCATGTGAGGAAGGGG - Intronic
1182952897 22:34394307-34394329 GAGGACTACATTTGGGGAAGAGG + Intergenic
1184392851 22:44214954-44214976 GGGGACTGGGTTTGAGGACCAGG - Intronic
1184922641 22:47616367-47616389 GGGGACAGTTTTTGAGGAACGGG + Intergenic
1185238499 22:49728081-49728103 GGGGACTGCATGTTTGGAATAGG + Intergenic
950196765 3:11014880-11014902 GGGGACTGCATGCGAGGGGCTGG + Intronic
950358574 3:12433599-12433621 GGAAACTTCATTTGGGGAACAGG + Intronic
950557631 3:13704962-13704984 GGGACCTTCATGTGAGGAACTGG + Intergenic
951501239 3:23389849-23389871 GGGAACTGCAACTGAGGCACTGG - Intronic
951852889 3:27162718-27162740 AGGGACTTCACTGGAGGAACAGG - Intronic
952854597 3:37758876-37758898 GGGGAAAGCATTTGAAGATCAGG - Intronic
954078272 3:48196934-48196956 GGGGGCTGCATTGGATGAAATGG - Intergenic
955930846 3:64055359-64055381 GGTGACAGCATTTCAGGAGCAGG + Intergenic
956688157 3:71851355-71851377 GAGGACTTCATTTGAGCATCTGG + Intergenic
959106416 3:102069940-102069962 GGGGACTGGGATTGTGGAACTGG + Intergenic
960143210 3:114171460-114171482 GGTGACTGGATTTGAGTGACGGG - Intronic
960158344 3:114321069-114321091 GTGGACAGCATTTGAGAAACTGG + Intergenic
961009357 3:123425597-123425619 GGGGACTGCTCTAGAGGATCTGG - Intronic
961535841 3:127570007-127570029 GGGGACTGCATTTGGAGATTTGG + Intergenic
961721003 3:128895958-128895980 GGGGACTGTCTTTGTGGCACTGG + Intronic
966118338 3:176492060-176492082 GGGTAATGCATTTGATGAAATGG - Intergenic
967047736 3:185753251-185753273 GGGAACTGTACTTGCGGAACGGG + Intronic
967259524 3:187628289-187628311 GGGGACTGTGGTTGAGGATCAGG - Intergenic
979078890 4:116309782-116309804 GGGTGCTGCATTTGAGGACATGG + Intergenic
979572237 4:122241214-122241236 GGGCACTGCATTTCAGGCAGAGG + Intronic
980550634 4:134329082-134329104 GGGGACAGCATGTGAGGGCCTGG - Intergenic
982110988 4:152053948-152053970 TGGCACTGACTTTGAGGAACTGG - Intergenic
982661734 4:158215292-158215314 GGGGGCTGCATTTGGGCAACAGG + Exonic
989070580 5:37506822-37506844 GGGGGCTGCTGTTCAGGAACAGG + Intronic
989637889 5:43556459-43556481 GGGGAATGCTTTCGGGGAACCGG + Intronic
991410423 5:66340127-66340149 GGTGTCTGTATTTTAGGAACTGG - Intergenic
995332830 5:110964830-110964852 TGGGACTCCATTTGAAGCACAGG - Intergenic
996088429 5:119327081-119327103 AAGGACTGCATTTGTGGAAAGGG + Intronic
999420902 5:151441659-151441681 GGGGAGTGAATTTGGGGAAAGGG + Intronic
1001708126 5:173756836-173756858 GGGGGCTGCAGTGGAGGAAGGGG - Intergenic
1003648249 6:7934337-7934359 GCGGACAGCATTTGAGCCACAGG + Intronic
1008292452 6:49733940-49733962 GGGGACTGTATTTAAAAAACAGG - Intronic
1010456600 6:76063705-76063727 GGGGAATGCCTGTGAGGAATTGG - Intronic
1011480365 6:87787715-87787737 GGGGCCTGCCTTTGAGGAACAGG + Intergenic
1011746766 6:90413892-90413914 GGGGAGAGCATGTGAGGAAGAGG + Intergenic
1014974223 6:127859132-127859154 GGAGAGTGCATTTGAGTAAAGGG - Intronic
1019395583 7:816339-816361 GGGGACTGCATTCGGGGGAAAGG - Intergenic
1021586729 7:22216450-22216472 GGGGACAGCATTTCAGGCAGAGG - Intronic
1024777501 7:52804634-52804656 GAAGACAGCATTTGAGGAATTGG + Intergenic
1024976903 7:55121895-55121917 GGGAACTGCCTTTGAAGAACAGG - Intronic
1026822405 7:73558094-73558116 GGGGATTCCAGGTGAGGAACAGG - Intergenic
1026963022 7:74421487-74421509 GGGGACCGCAGATGAAGAACTGG - Intergenic
1028487269 7:91373639-91373661 GTTGACTGCATCTGAGAAACAGG - Intergenic
1029117472 7:98244728-98244750 GGGGAAGGCATTTGAAGAGCTGG + Intronic
1030687610 7:112503160-112503182 GTGTAGTGAATTTGAGGAACTGG + Intergenic
1031050043 7:116935764-116935786 GGTGACACCATTTTAGGAACGGG - Intergenic
1033604209 7:142913849-142913871 GAGGACTGAATTTGAGCTACTGG + Intronic
1033741013 7:144275993-144276015 GGGGGGTGCATTTGAGAAATGGG - Intergenic
1033752893 7:144373621-144373643 GGGGGGTGCATTTGAGAAATGGG + Intronic
1034063740 7:148117301-148117323 GGGGACTGCAGGTGAGGCTCTGG - Intronic
1034634670 7:152557710-152557732 GGGGTAAGCATTTGAGAAACAGG - Intergenic
1035083342 7:156235696-156235718 AGGGAATGCATTTGAGGAAGCGG - Intergenic
1035223285 7:157419199-157419221 AGGGACTGCAGTTGTGGGACTGG + Intergenic
1035426993 7:158784625-158784647 GGGGACTGCAGTTGAGTCTCAGG - Intronic
1035662065 8:1355831-1355853 GGGGACTAGCTTTGAGGGACTGG - Intergenic
1037086155 8:14853357-14853379 GGGAACTGCATTTGGTGGACTGG - Intronic
1037905854 8:22715720-22715742 GGGGACTGGGTTTCAGGAGCTGG - Intronic
1038557174 8:28530696-28530718 GGGGAGTGAATAAGAGGAACAGG - Intronic
1045295791 8:100870718-100870740 GGGGACAGTATTTGAAGACCTGG + Intergenic
1045887518 8:107116400-107116422 GGGGACAACACATGAGGAACAGG + Intergenic
1047303630 8:123635847-123635869 GGGGAATGCATATGGGGAAGGGG - Intergenic
1048318108 8:133376883-133376905 GGGGTTTGCATTTGAGGTTCTGG + Intergenic
1049042509 8:140123386-140123408 GAGGTCTGCATTTGAGCAAGAGG - Intronic
1049302378 8:141878480-141878502 GGGGGATGCATTTGAAGAAGGGG - Intergenic
1049403330 8:142440623-142440645 GGGGACTGCCTTGGAGGCTCAGG + Intergenic
1052740909 9:32392387-32392409 AGGGTCTGCATTAGAGGAATTGG + Intronic
1053300677 9:36947130-36947152 AGGGACATCATTTTAGGAACAGG - Intronic
1055839190 9:80482265-80482287 AGGGACTGCAGCTGAGGAATAGG + Intergenic
1056933423 9:90897478-90897500 GGTGACTGCATCTGAGAAAGAGG + Exonic
1057524937 9:95790421-95790443 GGCTACTGCATCTGAGGATCTGG - Intergenic
1057895502 9:98905500-98905522 GGGCACTCCATTTGAGGAAAAGG - Intergenic
1058003569 9:99892177-99892199 GTGGAATACATTTAAGGAACTGG - Intergenic
1058758271 9:108104189-108104211 GGGGACTGCATTTGGGGCACAGG + Intergenic
1058894204 9:109385856-109385878 GGGGACTGGAAATGAGAAACAGG - Intronic
1060303631 9:122391552-122391574 GGAGGATGGATTTGAGGAACTGG + Intronic
1061480190 9:130894031-130894053 GGGGACTGCAGGAGAAGAACCGG - Intergenic
1062064607 9:134519545-134519567 GGGTACCACACTTGAGGAACTGG + Intergenic
1062230038 9:135476945-135476967 GAGGCCTTCATTGGAGGAACAGG - Intergenic
1062358830 9:136177926-136177948 GGGGACAGCACTGGGGGAACTGG + Intergenic
1062358843 9:136177971-136177993 GGGGACAGCACTGGGGGAACTGG + Intergenic
1062358855 9:136178016-136178038 GGGGACAGCACTGGGGGAACTGG + Intergenic
1203738961 Un_GL000216v2:162200-162222 GGGGTGTGCATTTGAGGGGCTGG - Intergenic
1189751560 X:44227867-44227889 GGTGACTGCATTTCAGGCAGAGG + Intronic
1193454183 X:81709181-81709203 GGGATCTCCATTTGAGGAAAGGG - Intergenic
1197727740 X:129787683-129787705 GGGGACCAAACTTGAGGAACTGG + Intronic
1197894450 X:131296406-131296428 GGAGACTGAATTAGAGGAACAGG - Intronic