ID: 1102254707

View in Genome Browser
Species Human (GRCh38)
Location 12:111408773-111408795
Sequence CATGAACACCAGCCCTCAGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 268
Summary {0: 1, 1: 0, 2: 13, 3: 19, 4: 235}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1102254707_1102254714 6 Left 1102254707 12:111408773-111408795 CCTTCTGAGGGCTGGTGTTCATG 0: 1
1: 0
2: 13
3: 19
4: 235
Right 1102254714 12:111408802-111408824 TCCCATTGCTGGGGATCCTTGGG 0: 1
1: 1
2: 1
3: 10
4: 147
1102254707_1102254710 -5 Left 1102254707 12:111408773-111408795 CCTTCTGAGGGCTGGTGTTCATG 0: 1
1: 0
2: 13
3: 19
4: 235
Right 1102254710 12:111408791-111408813 TCATGAGGGTCTCCCATTGCTGG 0: 1
1: 0
2: 0
3: 14
4: 82
1102254707_1102254718 29 Left 1102254707 12:111408773-111408795 CCTTCTGAGGGCTGGTGTTCATG 0: 1
1: 0
2: 13
3: 19
4: 235
Right 1102254718 12:111408825-111408847 TTGATCACTTAAGCTCTCTGAGG 0: 1
1: 0
2: 0
3: 24
4: 244
1102254707_1102254711 -4 Left 1102254707 12:111408773-111408795 CCTTCTGAGGGCTGGTGTTCATG 0: 1
1: 0
2: 13
3: 19
4: 235
Right 1102254711 12:111408792-111408814 CATGAGGGTCTCCCATTGCTGGG 0: 1
1: 0
2: 1
3: 11
4: 142
1102254707_1102254712 -3 Left 1102254707 12:111408773-111408795 CCTTCTGAGGGCTGGTGTTCATG 0: 1
1: 0
2: 13
3: 19
4: 235
Right 1102254712 12:111408793-111408815 ATGAGGGTCTCCCATTGCTGGGG 0: 1
1: 0
2: 1
3: 30
4: 437
1102254707_1102254713 5 Left 1102254707 12:111408773-111408795 CCTTCTGAGGGCTGGTGTTCATG 0: 1
1: 0
2: 13
3: 19
4: 235
Right 1102254713 12:111408801-111408823 CTCCCATTGCTGGGGATCCTTGG 0: 1
1: 0
2: 2
3: 22
4: 176

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1102254707 Original CRISPR CATGAACACCAGCCCTCAGA AGG (reversed) Intronic
900368701 1:2322024-2322046 CAGACACACCAGCCTTCAGAGGG - Intronic
900813613 1:4826643-4826665 GGTGAACACCAACCCTCACAGGG - Intergenic
900813635 1:4826738-4826760 GGTGAACACCAACCCTCACAGGG - Intergenic
902902906 1:19532498-19532520 GATGAACACCAGACCTCAGCGGG + Intergenic
905720370 1:40195052-40195074 CTTGAACTCCTGACCTCAGATGG + Intronic
906787775 1:48630844-48630866 CATGTGCACCTGCCCTGAGAGGG - Intronic
907764020 1:57390339-57390361 TATTAACACCTGCCCTCATAGGG + Intronic
909036831 1:70602942-70602964 CATGGTCCCCAGCCCACAGAAGG - Intergenic
911453303 1:98093367-98093389 CTTGAACTCCTGACCTCAGATGG - Intergenic
912251860 1:108020231-108020253 CATGAGCATGAGCCCACAGATGG + Intergenic
915590091 1:156865758-156865780 GCTGAACTCCTGCCCTCAGAAGG - Intronic
917049243 1:170900333-170900355 CTTGAACTCCTGACCTCAGATGG - Intergenic
917978430 1:180254664-180254686 CATGAAGCCCACCCCGCAGAGGG - Intronic
919402633 1:197138515-197138537 CTTGAACTCCTGACCTCAGATGG + Intronic
920378634 1:205522972-205522994 GGTGAACACCCACCCTCAGAGGG + Intronic
922451008 1:225737349-225737371 CCTGGACACCAGGCCCCAGAGGG - Intergenic
924264070 1:242263085-242263107 CCTGCACACCACCCGTCAGAAGG + Intronic
924589044 1:245386019-245386041 CTTGAACTCCTGACCTCAGATGG - Intronic
1063019052 10:2107813-2107835 CTTGAACACCTGACTTCAGATGG - Intergenic
1063452615 10:6161153-6161175 CTTGAACTCCTGACCTCAGATGG + Intronic
1064346483 10:14537268-14537290 CATGGACACCAGCTCCAAGATGG - Intronic
1066720727 10:38335379-38335401 CCTGCACACCACCCGTCAGAAGG - Intergenic
1067384890 10:45809918-45809940 CATTAAATCCAGGCCTCAGATGG - Intergenic
1067509785 10:46885214-46885236 CATGAACAAAGGCCCTGAGATGG + Intergenic
1067652469 10:48166644-48166666 CATGAACAAAGGCCCTGAGATGG - Intronic
1067729648 10:48800950-48800972 CTTGAACTCCTGACCTCAGATGG + Intronic
1069625522 10:69865503-69865525 CATGAAGACCATCCCTAACAGGG + Intronic
1070070804 10:73087483-73087505 CTTGAACTCCTGACCTCAGATGG + Intronic
1072999061 10:100272280-100272302 CTTGAACTCCTGACCTCAGATGG + Intergenic
1073582432 10:104680908-104680930 CCAGACCACCAGCCTTCAGAAGG + Intronic
1073787702 10:106908504-106908526 CATCCACACCAGCCCAGAGAGGG - Intronic
1077049253 11:559399-559421 CATGGATACCAGCACCCAGAAGG + Intronic
1077784894 11:5373428-5373450 GATGAACCCCATACCTCAGATGG - Intronic
1077910189 11:6566444-6566466 CCTCAGCACCAGCCCTAAGAGGG + Intronic
1078626895 11:12966214-12966236 AATGAACCTCACCCCTCAGATGG - Intergenic
1079588820 11:22157671-22157693 CACTAATACCAGTCCTCAGAAGG + Intergenic
1080394135 11:31874572-31874594 AATGAAGATCAGCCCTGAGATGG + Intronic
1080401275 11:31938186-31938208 CTTGAACTCCTGACCTCAGATGG - Intronic
1080719910 11:34838625-34838647 CATTAATCCCAGCCCTGAGATGG - Intergenic
1083277060 11:61602883-61602905 CAGGAGCCCCAGGCCTCAGATGG + Intergenic
1083724586 11:64621586-64621608 CATGGAGCCCACCCCTCAGAGGG + Intronic
1084702920 11:70799176-70799198 CTTGAACTCCTGACCTCAGAGGG - Intronic
1085148078 11:74221997-74222019 GATGAAAACCAGAGCTCAGAGGG + Intronic
1085484737 11:76852531-76852553 CTTGAACTCCTGACCTCAGATGG + Intergenic
1085687507 11:78637532-78637554 CATGAACTCCTGACCTCAGGTGG - Intergenic
1086299380 11:85409265-85409287 CATGTAAACCAGGACTCAGAAGG - Intronic
1092394278 12:8111397-8111419 CTTGAACTCCTGACCTCAGATGG + Intergenic
1093472965 12:19524369-19524391 CTTGAACACCTGACCTCAGGTGG + Intronic
1095374184 12:41506599-41506621 TATGAATGCCAGCACTCAGACGG + Exonic
1101644595 12:106619055-106619077 CATTAAAACCAGAGCTCAGAAGG - Intronic
1102254707 12:111408773-111408795 CATGAACACCAGCCCTCAGAAGG - Intronic
1103237640 12:119386593-119386615 TATGCCCAGCAGCCCTCAGACGG - Intronic
1105750958 13:23421183-23421205 AATGACCACCAGGCCTCAGGTGG - Intronic
1106062103 13:26303519-26303541 CATGAACTCCTGACCTCAGGTGG + Intronic
1107294369 13:38894145-38894167 CATAAACCCCAGACCTCAGCTGG + Intergenic
1112532423 13:100217852-100217874 CTTGAACTCCTGACCTCAGATGG - Intronic
1112840958 13:103577360-103577382 CATTGACGCCAGCCCTCAGAAGG + Intergenic
1113617738 13:111693034-111693056 CACAAACACCTGCCCCCAGAGGG + Intergenic
1113623269 13:111778295-111778317 CATAAACACCAGCCCCCAGAGGG + Intergenic
1114031785 14:18585426-18585448 CAAGAACACCAGTCCTCAGGTGG - Intergenic
1114032200 14:18587430-18587452 AATTAATACCAGGCCTCAGATGG + Intergenic
1114076557 14:19164455-19164477 CAAGAACACCAGTCCTCAGGTGG - Intergenic
1114076979 14:19166460-19166482 AATTAATACCAGGCCTCAGATGG + Intergenic
1114085181 14:19233108-19233130 AATTAATACCAGGCCTCAGATGG - Intergenic
1114085607 14:19235113-19235135 CAAGAACACCAGTCCTCAGGTGG + Intergenic
1114577214 14:23725975-23725997 CATAAACACCAGCCCTGTGTGGG - Intergenic
1116618645 14:47171745-47171767 GATGAACACAATACCTCAGATGG - Intronic
1118618167 14:67590062-67590084 CATGAGCCCCAGCGTTCAGAAGG - Exonic
1122227332 14:100287342-100287364 CCTGAGCACCAGCCCTCACGGGG + Intergenic
1202896748 14_GL000194v1_random:14816-14838 AATTAATACCAGGCCTCAGATGG - Intergenic
1202897160 14_GL000194v1_random:16827-16849 CATGAACACCAGTCCTCAGGTGG + Intergenic
1202884728 14_KI270722v1_random:94386-94408 CATGAACTCCTGACCTCAGGTGG + Intergenic
1124430071 15:29599414-29599436 CTCAACCACCAGCCCTCAGAAGG - Intergenic
1124693140 15:31842511-31842533 CATTGAAACCAGCCATCAGAGGG - Intronic
1124900584 15:33818902-33818924 CTCGAACTCCTGCCCTCAGATGG - Intronic
1127514373 15:59677317-59677339 CATGAGCCCCAGCGTTCAGAAGG + Intronic
1127812816 15:62579270-62579292 TATGAAAACCAGCCTTCACATGG + Intronic
1129976911 15:79830375-79830397 CATCAACATCAGCCACCAGAAGG - Intergenic
1130634670 15:85606319-85606341 CTTGAACACCTGACCTCAGGTGG + Intronic
1131196947 15:90363340-90363362 CATGAGCCACAGCACTCAGATGG - Intronic
1132520335 16:384297-384319 CAAGTTCACCAGCCCTCAGCTGG - Intronic
1132975013 16:2706765-2706787 AACAACCACCAGCCCTCAGAGGG - Intronic
1133331390 16:4976801-4976823 CAGGAACACAAGGCCACAGAAGG - Intronic
1134258979 16:12635416-12635438 CTTGAACTCCTGACCTCAGATGG - Intergenic
1134610014 16:15600496-15600518 CATGAAAACCAGCCCTCGGAGGG - Exonic
1134887312 16:17805068-17805090 AATGAAAACCAGCCCCCAGAGGG + Intergenic
1135612322 16:23879221-23879243 CATGAAAACCAGCTCTCAGCAGG - Intronic
1136060400 16:27722478-27722500 CATGAAAAACAGCCCAGAGAAGG - Intronic
1140953057 16:79837714-79837736 CATGGTCCCCACCCCTCAGAGGG + Intergenic
1141295587 16:82765516-82765538 CATCAACGCCAGCCCTAGGAAGG - Intronic
1141755407 16:85987652-85987674 CTGGAGCAGCAGCCCTCAGATGG + Intergenic
1142385927 16:89764669-89764691 CAAGAACAGCAGCACTTAGATGG - Intronic
1142593408 17:1017820-1017842 CTTGAACTCCAGACCTCAGGTGG + Intronic
1142645587 17:1312209-1312231 CTTGAACTCCTGACCTCAGATGG + Intergenic
1143745605 17:8991938-8991960 TCTGACCACCAGCACTCAGAGGG + Intergenic
1144210305 17:13008830-13008852 CAGTGACAGCAGCCCTCAGAAGG + Intronic
1145303300 17:21655185-21655207 AATCAACACCAGGCCCCAGATGG - Intergenic
1145346738 17:22046655-22046677 AATCAACACCAGGCCCCAGATGG + Intergenic
1145346862 17:22047213-22047235 GAGGAACACCAGGCCTCAGGTGG - Intergenic
1146846927 17:36187997-36188019 CAGGAGCACCAGCCCTCACCTGG + Intronic
1147202220 17:38810377-38810399 CATGAACACCTGCCCTGTGCTGG - Intronic
1147947725 17:44089523-44089545 CTTGAACTCCTGACCTCAGATGG - Intronic
1148181345 17:45607271-45607293 CTTGAACACCTGACCTCAAATGG + Intergenic
1149396263 17:56248158-56248180 CATGATTACCATCCCACAGATGG + Intronic
1152584425 17:81182643-81182665 AATGAGCACCTGCTCTCAGAGGG + Intergenic
1152650314 17:81489467-81489489 GAAGAAGAGCAGCCCTCAGAGGG - Intergenic
1155977124 18:32143042-32143064 CTTGAACTCCTGACCTCAGATGG + Intronic
1156347351 18:36269712-36269734 CATGGACAGCAGGCTTCAGAAGG - Exonic
1157223048 18:45840689-45840711 CTTCAACACCAGCCTTCACATGG - Intronic
1162185655 19:8902948-8902970 CATGAACACAAGCTCACTGAGGG + Intronic
1162186028 19:8905762-8905784 CATGAACACAAGCTCACTGAGGG + Intronic
1162186390 19:8908381-8908403 CATGAACACAAGCTCACTGAGGG + Intronic
1163903108 19:20125253-20125275 CATGAGCACCACCCTTCACACGG - Intronic
1164038727 19:21475493-21475515 CTTGAACTCCTGACCTCAGATGG + Intronic
1164963231 19:32455177-32455199 CTTGAACACCTGGTCTCAGATGG + Intronic
1166115391 19:40650409-40650431 CATGAACACGTGCCCTCTGTTGG - Intergenic
1167582832 19:50356552-50356574 CTTGAACTCCAGACCTCAGGTGG - Intronic
1168401062 19:56086661-56086683 CATGAACAACAGCGCTCACCTGG + Intergenic
1202660134 1_KI270708v1_random:61419-61441 CATGAACTCCTGACCTCAGGTGG + Intergenic
925406770 2:3610760-3610782 CCTGAGAACCACCCCTCAGAGGG + Intronic
926941959 2:18147684-18147706 TAAGCACAACAGCCCTCAGAGGG - Intronic
929364945 2:41142804-41142826 CATCAAAAGCAGCCCTCAGAGGG - Intergenic
930717344 2:54605233-54605255 AATGAAAACCAGCCACCAGATGG + Intronic
931084434 2:58813825-58813847 CCTTAACTCCAGCCCTCACAGGG + Intergenic
937535304 2:122879147-122879169 CATCAGCACCAGACCACAGATGG - Intergenic
938491151 2:131761971-131761993 CATGAACACCAGTCCTCAGGTGG - Intronic
938491473 2:131763437-131763459 GATGAACACCAGGCCCCAGGTGG - Intronic
938491586 2:131763970-131763992 AATTAATACCAGGCCTCAGATGG + Intronic
938495981 2:131798372-131798394 AATTAATACCAGGCCTCAGATGG - Intronic
938496413 2:131800366-131800388 CATGAACACCAGTCCTCAGGTGG + Intronic
939807117 2:146787955-146787977 AGTGAGCACCAGCCCTCACAAGG + Intergenic
939829355 2:147053747-147053769 CCTGAACACCAGGCTCCAGAAGG + Intergenic
940452853 2:153861793-153861815 CATGAACTCCAGACCTCAGGTGG + Intergenic
941724946 2:168850691-168850713 CTTGAACTCCTGACCTCAGATGG - Intronic
942580010 2:177407999-177408021 CTTGAACACCTGGCCTCAGGTGG + Intronic
946692798 2:222321294-222321316 TCTGAACACCACCCCTCAGTTGG - Intergenic
1169060820 20:2659360-2659382 GATGAAGAACAGCCCTGAGAGGG + Intronic
1170075827 20:12417701-12417723 CATGAGCACCAGCCCACACTGGG - Intergenic
1170695656 20:18655988-18656010 CTTGAACTCCCGACCTCAGATGG + Intronic
1171520298 20:25770555-25770577 CAAGGACACCAGGCCTCAGGTGG + Intronic
1171520817 20:25772876-25772898 AATCAACACCAGGCCCCAGATGG - Intronic
1171556105 20:26083615-26083637 AATCAACACCAGGCCCCAGATGG + Intergenic
1171556621 20:26085938-26085960 CAAGGACACCAGGCCTCAGGTGG - Intergenic
1174414396 20:50357536-50357558 AATGATCACCAGCCTTCTGAGGG + Intergenic
1175538965 20:59736416-59736438 CATGCACACCTGTCCACAGAGGG - Intronic
1175701697 20:61142809-61142831 CATGAAAACCAGCCACCAGAGGG - Intergenic
1176234089 20:64046145-64046167 CATGAGTGCCACCCCTCAGATGG - Intronic
1176616435 21:9030812-9030834 AATTAATACCAGGCCTCAGATGG - Intergenic
1176616845 21:9032816-9032838 CATGAACACCAGTCCTCAGGTGG + Intergenic
1176654679 21:9577981-9578003 AATCAACACCAGGCCCCAGATGG - Intergenic
1176708287 21:10130831-10130853 CATGAACACCAGTCCTCAGGTGG - Intergenic
1176708692 21:10132818-10132840 AATTAATACCAGGCCTCAGATGG + Intergenic
1177028675 21:15954538-15954560 CATGAACCCAAGCCTTCAGTCGG - Intergenic
1177156138 21:17503324-17503346 CTTGAACTCCTGACCTCAGATGG - Intergenic
1180292366 22:10858080-10858102 CAAGAACACCAGTCCTCAGGTGG - Intergenic
1180292790 22:10860085-10860107 AATTAATACCAGGCCTCAGATGG + Intergenic
1180327618 22:11445008-11445030 CATGAACTCCTGACCTCAGGTGG + Intergenic
1180418221 22:12789184-12789206 CATGAACTCCTGACCTCAGGTGG - Intergenic
1180455899 22:15512483-15512505 CAAGAACACCAGTCCTCAGGTGG - Intergenic
1180456314 22:15514487-15514509 AATTAATACCAGGCCTCAGATGG + Intergenic
1180495172 22:15887502-15887524 CAAGAACACCAGTCCTCAGGTGG - Intergenic
1180495597 22:15889507-15889529 AATTAATACCAGGCCTCAGATGG + Intergenic
1180940554 22:19657568-19657590 CATGAACACCAGGTCCCAGGTGG - Intergenic
1181421048 22:22799370-22799392 CATGAAAATTAGACCTCAGATGG + Intronic
1182704951 22:32271199-32271221 CAAGAACACCAGCCGCCAGTCGG - Intergenic
1183245565 22:36690728-36690750 CATGAACTCCAGGCCTCACTGGG + Intronic
1183296721 22:37034111-37034133 GATAAAGACCAGCCCTGAGAGGG + Intergenic
1184516349 22:44965127-44965149 CTTGAACAGCAGCCCGAAGACGG + Intronic
949897725 3:8781219-8781241 CAAGAAAAGCAGCTCTCAGAGGG + Intronic
950620434 3:14201270-14201292 CGTAAAAACCAGCCCACAGATGG - Intergenic
950985131 3:17355339-17355361 AATGAACACCAACTCTCAGGAGG + Intronic
952284381 3:31954177-31954199 CATTAACACCAGTCCCAAGAGGG + Intronic
952829506 3:37552793-37552815 CTTGAACTCCCGACCTCAGATGG - Intronic
954008203 3:47610182-47610204 CAGGCACACCAGCACTCAGGAGG - Exonic
954237930 3:49271302-49271324 CATGGACAAGAGCCCTCAGAAGG - Exonic
954318516 3:49814566-49814588 CTTGAACTCCAGACCTCAGGTGG - Intergenic
955270252 3:57490867-57490889 CTTGAACTCCTGCCCTCAGGTGG - Intronic
956649919 3:71495149-71495171 CAAGTGCACCAGCCCTGAGATGG - Intronic
958455090 3:94320675-94320697 CATGATCTCCAGCCTACAGAGGG - Intergenic
961156799 3:124686526-124686548 CATGAACAAAAGCCCTGAGGTGG + Intronic
961312942 3:126015408-126015430 CCGGAACAGCAGACCTCAGAGGG - Intronic
962223407 3:133583779-133583801 CTTGAACACCTGACCTCAGGTGG + Intronic
965982473 3:174710471-174710493 CTTGAACTCCAGACCTCAGGTGG + Intronic
967010936 3:185432886-185432908 CAGCAACACCAGCCCTCAGTAGG - Intronic
970214706 4:13746495-13746517 CATGAGCACTAACCTTCAGAAGG - Intergenic
971277517 4:25212083-25212105 CATACACACAAGCCCTAAGATGG + Intronic
972517790 4:39825303-39825325 CATGACCACAAGTCCTCTGATGG - Exonic
974142015 4:57899695-57899717 GATGAACCCCATACCTCAGAAGG - Intergenic
976113216 4:81699104-81699126 CATCAACACCTCCCCTCACAGGG + Intronic
976267151 4:83195207-83195229 GCTGAACACCAGCCCTTTGAAGG + Intergenic
976802365 4:89006946-89006968 TATGAACCCCAGACCTCAGCTGG - Intronic
976998095 4:91461573-91461595 CCTGACCACCAGCCCTCATTTGG + Intronic
978211565 4:106143693-106143715 CATGAACTCCTGACCTCAGGTGG - Intronic
979183218 4:117756267-117756289 CTTTTACACCAGCCATCAGAGGG + Intergenic
980962214 4:139486527-139486549 CTTGAACTCCAGACCTCAGGTGG - Intergenic
984294785 4:177840624-177840646 CATGAACACCAGGTTTCAAAGGG + Intronic
985556509 5:561271-561293 CATGAGCATAAGTCCTCAGAGGG + Intergenic
989612809 5:43311849-43311871 CAGTAACCCCAGCACTCAGAAGG - Intronic
994604371 5:101948456-101948478 CATGGAAAGCAGCCATCAGAAGG - Intergenic
995165883 5:109041128-109041150 CATGAACACAAACCCTTAGGGGG - Intronic
997243752 5:132328473-132328495 CATGAACTCAAGCTCTCAGAGGG + Intronic
997836133 5:137194818-137194840 CATAAGCACCAGCCCTGAGCCGG + Intronic
997850855 5:137331575-137331597 CATGAATAAAAGCCCCCAGAGGG - Intronic
998598643 5:143561419-143561441 CATAATCACCAGCCCAGAGAAGG - Intergenic
1000524041 5:162332992-162333014 CATGAAAACCTGCACTCAGATGG + Intergenic
1003457916 6:6300658-6300680 GATGAACCCCATACCTCAGATGG + Intronic
1003750696 6:9051973-9051995 CGTCAAGACAAGCCCTCAGAAGG - Intergenic
1004006140 6:11638786-11638808 CATGAACACCATCACAGAGATGG - Intergenic
1004997041 6:21203595-21203617 CTTGAACTCCAGGCCTCAAACGG + Intronic
1005286434 6:24332469-24332491 CATGTGTAACAGCCCTCAGATGG + Intronic
1007180697 6:39927288-39927310 GATGGACACCAGCCCAGAGAGGG + Intronic
1009353268 6:62708302-62708324 AATGGACACCAACCCACAGAGGG - Intergenic
1009412764 6:63385272-63385294 CATGGAAACCAGTTCTCAGATGG - Intergenic
1010576307 6:77535596-77535618 AAGGAACACCAGCCTTTAGAGGG - Intergenic
1011587868 6:88946291-88946313 CATGAACAACACCCATAAGATGG + Intronic
1012861394 6:104564115-104564137 CCTGTACAGCAGCCCTCAAAGGG - Intergenic
1017994408 6:159520148-159520170 CAAGAACTCCAGCACTCAAATGG - Intergenic
1018442583 6:163826479-163826501 CATGTACAAAAGCCCTAAGATGG - Intergenic
1019359051 7:595392-595414 CGTGAACACCCGGCCCCAGAGGG - Intronic
1021061386 7:16117227-16117249 CATGAAAACCAGCTCACAGTGGG - Intronic
1021807611 7:24372862-24372884 CATGAACACCTTCCCTGAGAAGG + Intergenic
1024145897 7:46515964-46515986 CAGAAACACCAACCCTGAGAGGG - Intergenic
1025256082 7:57384679-57384701 AATGATCACCAGCCTTCTGAGGG - Intergenic
1029135512 7:98367841-98367863 CTTGAACTCCCGACCTCAGATGG + Intronic
1030668374 7:112307129-112307151 CATGAACAAAAGCCCTTTGATGG - Intronic
1036438398 8:8757631-8757653 CTTGAACTCCTGACCTCAGAGGG + Intergenic
1037992671 8:23331814-23331836 CTTGAACTCCTGACCTCAGATGG - Intronic
1038532685 8:28331354-28331376 CAGGAACACCAGCCCTCTCTCGG + Intronic
1038949457 8:32398628-32398650 CTTGAACCCCTGACCTCAGATGG + Intronic
1039038471 8:33384598-33384620 CTTGAACACCTGACCTCAGGTGG - Intronic
1043343117 8:79266169-79266191 CAGGAACACAAGCACTCAGGTGG + Intergenic
1048294697 8:133205740-133205762 GATGAGCCCCAGCCCCCAGAAGG + Intronic
1049265609 8:141666349-141666371 CAAGAGCCCCAGCCCTGAGAGGG - Intergenic
1049774273 8:144397378-144397400 CAGGAACACCAGCCGCCAGTCGG + Exonic
1050590044 9:7151089-7151111 CTTGAACTCCTGCCCTCAAAAGG - Intergenic
1051890895 9:21941770-21941792 CATGAATGTCAGCCCTAAGAGGG - Intronic
1052725235 9:32221252-32221274 TATGAATACCATTCCTCAGAGGG + Intergenic
1053298772 9:36934016-36934038 CATCTTCACCAGCCCACAGAGGG - Intronic
1053645250 9:40116345-40116367 CATGAACACCAGTCCTCAGGTGG - Intergenic
1053645668 9:40118315-40118337 AATTAATACCAGGCCTCAGATGG + Intergenic
1053760041 9:41345194-41345216 AATTAATACCAGGCCTCAGATGG - Intergenic
1053760465 9:41347183-41347205 CATGAACACCAGTCCTCAGGTGG + Intergenic
1054326272 9:63714245-63714267 CATGAACACCAGTCCTCAGGTGG - Intergenic
1054326683 9:63716216-63716238 AATTAATACCAGGCCTCAGATGG + Intergenic
1054538903 9:66257657-66257679 AATTAATACCAGGCCTCAGATGG - Intergenic
1054539322 9:66259626-66259648 CATGAACACCAGTCCTCAGGTGG + Intergenic
1056950964 9:91040459-91040481 CTTGAACAGCAGCGTTCAGAAGG - Intergenic
1058746727 9:107998903-107998925 TGTGAACACCAGCAGTCAGAAGG + Intergenic
1061147165 9:128806721-128806743 CTTGAACTCCAGACCTCAGGTGG - Intronic
1202793048 9_KI270719v1_random:99800-99822 CATGAACACCAGTCCTCAGGTGG - Intergenic
1202793453 9_KI270719v1_random:101787-101809 AATTAATACCAGGCCTCAGATGG + Intergenic
1203632399 Un_KI270750v1:81439-81461 AATCAACACCAGGCCCCAGATGG - Intergenic
1192552175 X:72063135-72063157 TCTTAACACCAGCTCTCAGAAGG + Intergenic
1193819228 X:86142265-86142287 CATGAGCATTAGCACTCAGATGG + Intergenic
1194853177 X:98893974-98893996 AATGAACCCCAGCTCACAGAAGG - Intergenic
1195370739 X:104169785-104169807 CTTGAACTCCAGACCTCAGGTGG + Intronic
1196519161 X:116652832-116652854 CTTGAACACCTGACCTCAGGTGG - Intergenic
1196866605 X:120076757-120076779 CAGCAACACCAGGCCCCAGATGG + Intronic
1196876494 X:120159524-120159546 CAGCAACACCAGGCCCCAGATGG - Intronic
1197645819 X:129015503-129015525 CATAAACACCAGCACTCTCAAGG + Intergenic
1197778349 X:130135737-130135759 CATGCACATAAGCCTTCAGATGG - Intronic
1198095677 X:133377522-133377544 CATGAACACCATCCATCAGTTGG + Intronic
1199309189 X:146302871-146302893 CTTGAACACCTCCCCTGAGAGGG - Intergenic
1200616587 Y:5387243-5387265 CTTGAACTCCTGACCTCAGATGG + Intronic
1201149812 Y:11089537-11089559 AATTAATACCAGGCCTCAGAAGG - Intergenic
1201150245 Y:11091667-11091689 CATGAACACCAGTCCTCAGGTGG + Intergenic
1202352331 Y:24007559-24007581 CTTGAACTCCTGACCTCAGATGG - Intergenic
1202518449 Y:25662556-25662578 CTTGAACTCCTGACCTCAGATGG + Intergenic