ID: 1102256649

View in Genome Browser
Species Human (GRCh38)
Location 12:111418984-111419006
Sequence CAGAGTGTCCAGAGGGAACT AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 258
Summary {0: 1, 1: 0, 2: 6, 3: 25, 4: 226}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1102256637_1102256649 30 Left 1102256637 12:111418931-111418953 CCCTGGGGAGAGCGCGGGCTGGG 0: 1
1: 0
2: 1
3: 23
4: 287
Right 1102256649 12:111418984-111419006 CAGAGTGTCCAGAGGGAACTAGG 0: 1
1: 0
2: 6
3: 25
4: 226
1102256645_1102256649 -9 Left 1102256645 12:111418970-111418992 CCAGCTGGTGGCCACAGAGTGTC 0: 1
1: 0
2: 2
3: 32
4: 168
Right 1102256649 12:111418984-111419006 CAGAGTGTCCAGAGGGAACTAGG 0: 1
1: 0
2: 6
3: 25
4: 226
1102256639_1102256649 29 Left 1102256639 12:111418932-111418954 CCTGGGGAGAGCGCGGGCTGGGG 0: 1
1: 0
2: 5
3: 43
4: 524
Right 1102256649 12:111418984-111419006 CAGAGTGTCCAGAGGGAACTAGG 0: 1
1: 0
2: 6
3: 25
4: 226

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1102256649 Original CRISPR CAGAGTGTCCAGAGGGAACT AGG Intronic
902686234 1:18079491-18079513 CAGAGTATCCAGAGTGCACCTGG + Intergenic
903341229 1:22655774-22655796 CAGAGTGGCCACAGGGACCCAGG - Intronic
904079313 1:27862227-27862249 CAGAGTCCCCAGAGGCACCTTGG - Intergenic
904752041 1:32747027-32747049 CTGAGTGGCCAGAGGGAACTTGG - Intronic
904877797 1:33669954-33669976 CAGTATTTCCAGAGGGATCTTGG + Intronic
905033396 1:34902408-34902430 CAGAGTGGACAGAGGGATCCTGG + Intronic
906191346 1:43901371-43901393 CAGTCTGTCCAGTGGGAAGTAGG - Intronic
907279755 1:53339850-53339872 CAGAGTGGCCAGAAGGATCTGGG - Intergenic
907580972 1:55572480-55572502 TAGAGTTTTCAGAGGGAACATGG - Intergenic
908110023 1:60887477-60887499 CAGAGTCTCCAGAAGGATTTTGG + Intronic
908339061 1:63157838-63157860 CACAGTGCCCAGTGGGAAGTTGG + Intergenic
911438127 1:97888696-97888718 CAGAGAGACCAGAGAGAAGTGGG + Intronic
916446870 1:164880741-164880763 TAGTGTGTCTAGAGGGAAGTAGG + Intronic
916464471 1:165060454-165060476 AGCAGTGTCCAGAGAGAACTTGG - Intergenic
918245022 1:182651699-182651721 CACAGACTCTAGAGGGAACTCGG + Intronic
919962945 1:202490639-202490661 CAGCGTTGCCAGAGGGAAATGGG - Intronic
920180026 1:204126953-204126975 CAGAGAATCCAGAGGGCACAGGG - Exonic
920866629 1:209758815-209758837 CAAAGTGACCAGAGGGTTCTAGG + Exonic
921276548 1:213526254-213526276 CAGAGAGTCCAGAGGGTTGTTGG + Intergenic
921863693 1:220065908-220065930 CAGAGTGTCCAGAAGGGAAGTGG + Intronic
1063485244 10:6414148-6414170 CAGAGAGTCCAGAGGGTCCCAGG + Intergenic
1063976903 10:11424656-11424678 CATGACGTCCAGAGGGAACTGGG - Intergenic
1064522166 10:16214434-16214456 TAGAGCCTCCAGAGGGAACACGG + Intergenic
1066483853 10:35824792-35824814 CAAAGTTTCCAGAAGGAACTGGG + Intergenic
1068622767 10:59205223-59205245 TACAGTGTCCACAAGGAACTGGG - Intronic
1070509086 10:77143653-77143675 CAGAGTGTCTTGAGGACACTCGG + Intronic
1071969240 10:90886281-90886303 AAGAGAGTCAAGAGGGAACAGGG + Intronic
1072033802 10:91546056-91546078 CAGAGTAGCCAAAAGGAACTAGG - Intergenic
1072533153 10:96338691-96338713 CAGAGATTCCAGAGGGGATTTGG + Intergenic
1074434565 10:113422977-113422999 CAGAAAGTCCAGAGGTATCTGGG - Intergenic
1074735146 10:116423399-116423421 CAGAGTGAGCAGGGGGAAATCGG + Intergenic
1075943342 10:126410023-126410045 CAGAGTGCCCAGGTGGAATTAGG - Intergenic
1076901396 10:133340177-133340199 CAGAGTCTCCAGGTGGACCTTGG + Intronic
1077083800 11:737411-737433 CAGTGAGACCAGAGGGAACACGG - Intergenic
1077181761 11:1220120-1220142 CAGAGGGCCCATTGGGAACTGGG - Intergenic
1077716046 11:4581649-4581671 TAGAGTATCCAGAGGGAAAAGGG + Intergenic
1084045094 11:66563792-66563814 CAGGGTGAGCAGAGGGCACTGGG - Exonic
1087250013 11:95888455-95888477 GAGTCTATCCAGAGGGAACTTGG - Intronic
1088576730 11:111279443-111279465 CAGAGGCTCCAGAGGGAGCATGG - Intronic
1088844511 11:113653434-113653456 CAGAGTGTGCTGAGGGACTTGGG - Intergenic
1088847745 11:113682119-113682141 CAGAGTGACCAGGGGAAACTGGG + Intergenic
1089400382 11:118160985-118161007 TGGGGTGTCCAGTGGGAACTGGG + Intergenic
1090329102 11:125916182-125916204 GAGAGAGACCAGAGGGAAATCGG - Intronic
1092888494 12:12946942-12946964 CAGAATTTCGAGAGAGAACTTGG + Intronic
1095378919 12:41565772-41565794 CCCAGTGTCCTGAGGGAAATAGG - Intronic
1097055664 12:56247757-56247779 CAGTGTGGCCAGAGGCAGCTAGG + Exonic
1097908302 12:64943435-64943457 GAGAGTCTCCAGAAGGAACCAGG - Intergenic
1098939190 12:76515541-76515563 CAGAGTGTTGAGAGGGAACGTGG - Intronic
1100190115 12:92181252-92181274 TAGAGTTTGCAGAGGGAACATGG + Intergenic
1100420424 12:94426905-94426927 CAGAGCCTTCAGAGGGAACGTGG + Intronic
1100866875 12:98866609-98866631 TGAAGGGTCCAGAGGGAACTTGG - Intronic
1102256649 12:111418984-111419006 CAGAGTGTCCAGAGGGAACTAGG + Intronic
1102417853 12:112780033-112780055 CAGAGTCTTCAGAGCGAACACGG + Intronic
1102576904 12:113861357-113861379 CAGTGTGGGCAGAAGGAACTGGG - Intronic
1102922494 12:116802644-116802666 TAGAGTCTCCAGAGGGAATGTGG + Intronic
1103026713 12:117580079-117580101 CAGAGTGTCAAAAGGGAAATCGG + Intronic
1103706771 12:122879095-122879117 TAGAGCCTCCAGAGGGAACAGGG + Intronic
1104894080 12:132153414-132153436 CAGACTGTCAAAAGGAAACTGGG - Intergenic
1105883125 13:24620974-24620996 CAGTGTTTCCAGAGGGGATTAGG + Intergenic
1106015962 13:25869383-25869405 CAGAGAATCCAGAGGCAATTAGG - Intronic
1107668868 13:42722212-42722234 AAGAGTTAGCAGAGGGAACTCGG + Intergenic
1110383314 13:74879026-74879048 CAGAGTGTCCAAAGAGACCATGG - Intergenic
1111014724 13:82364496-82364518 CACAGTGTCCATAGAGAACTGGG + Intergenic
1111749165 13:92305896-92305918 TAGGGTGGCCAGAGGTAACTAGG + Intronic
1111769230 13:92575468-92575490 CAGAGCCTGCAGAGGGAACCTGG + Intronic
1112055100 13:95683636-95683658 CACAGTGCCCAGCCGGAACTGGG - Intronic
1116677841 14:47927849-47927871 GAAAGTGTCCAGAGGGAAGAAGG + Intergenic
1116683674 14:48010628-48010650 CAGAGTGTCCAGAATGATCTTGG + Intergenic
1119949849 14:78733530-78733552 CAGAGTGGTCAGAGGTAACAAGG + Intronic
1120546666 14:85820280-85820302 CAGAATGTCCAGTAGGAACACGG - Intergenic
1121709464 14:96026843-96026865 CTGAGGGTGCAGAGGGAACATGG + Intergenic
1122689927 14:103527455-103527477 CAGAGAGGCAAGAGGGAAGTCGG + Intergenic
1122839627 14:104450975-104450997 CACGGAGTCCAGAGGGAAATCGG + Intergenic
1202903380 14_GL000194v1_random:55623-55645 CAGATTGTCCTGTGTGAACTTGG + Intergenic
1124013633 15:25859262-25859284 CTGAGTGTCCAGCTGGAACAGGG - Intronic
1124801230 15:32834818-32834840 CAAGGTGATCAGAGGGAACTAGG - Intronic
1125214809 15:37259403-37259425 CAGAGTCTTTAGAAGGAACTCGG - Intergenic
1125236843 15:37524618-37524640 CAGAGGCTCCAGAGGGAGCATGG - Intergenic
1125748763 15:42014703-42014725 TAGAGTGACCAGAAGGACCTGGG - Intronic
1126433814 15:48614984-48615006 CAGAGTGTCCAGAAGTTCCTGGG + Intronic
1126764866 15:52001853-52001875 CAGAGGGTCAAGAGGAATCTGGG + Intronic
1129692005 15:77719075-77719097 CGGAGGGTCCAGAGAGAACTGGG + Intronic
1130061982 15:80576930-80576952 CGGAGTGTCCAGAGGGAAATGGG - Exonic
1131745568 15:95443486-95443508 CAGAGTGTGCAAAGAGGACTCGG + Intergenic
1131916728 15:97274097-97274119 CAGAATATCCAGAGGGATCACGG - Intergenic
1132012341 15:98287106-98287128 CTGAGAATCCAGAGGGAACTGGG - Intergenic
1132651279 16:1022444-1022466 CGGAGTGTCCAGACAGAGCTGGG + Intergenic
1135325636 16:21523745-21523767 CAATGTGTGCAGAGGGAACACGG + Intergenic
1135741501 16:24979313-24979335 TAGAATATCCAGAGGGACCTGGG - Intronic
1139918446 16:70442753-70442775 AAGAGGGTCCAGCGTGAACTTGG - Intergenic
1140693927 16:77513095-77513117 CAGGTTGTCCAGAGGTATCTTGG - Intergenic
1140997275 16:80273058-80273080 AAGAGCCTCCAGAGGGAGCTTGG + Intergenic
1141002179 16:80318533-80318555 TATAGTGTCCAGAGGGAGCCTGG + Intergenic
1141906899 16:87032913-87032935 CAAAGTGTCCGGACTGAACTGGG - Intergenic
1146186411 17:30727342-30727364 CAAAGGGGCCAGAGGGCACTTGG + Intergenic
1146708992 17:35024360-35024382 CAGAGTGTTAAGAGAGGACTGGG - Intronic
1147607787 17:41784268-41784290 CAGAGGCTCCAGAGGGAATGGGG + Intronic
1147844114 17:43392952-43392974 CTGAGAGGCCAGAGGGAATTCGG - Intergenic
1148240503 17:45996832-45996854 AAGAGGGTCCAGAGGGGACTGGG - Intronic
1148494799 17:48047389-48047411 CAGACTCTCCAGTGGGACCTCGG + Intergenic
1148768468 17:50053273-50053295 GGGAGTGTCCAGAGGGAATGTGG - Intergenic
1149485038 17:57036084-57036106 CAATTTGTCCAGAGGGCACTTGG - Intergenic
1150781623 17:68127615-68127637 CAGAGTATCAGGAGGGAACAGGG - Intergenic
1152128235 17:78460168-78460190 CAGAGTGTCCAGAGCCTCCTGGG + Exonic
1155560746 18:27073548-27073570 CAGTGTGACCAGAGGGAAGATGG + Intronic
1156411243 18:36829497-36829519 CAGGGTGGGCAGAGGGACCTCGG - Intronic
1157404707 18:47413329-47413351 CAGAATGTCCAGAGGCAATTAGG + Intergenic
1157410899 18:47462081-47462103 CAGAGTGTCCAGAAGGGCCTTGG + Intergenic
1157689340 18:49668401-49668423 CACAGTGACCAGGAGGAACTTGG - Intergenic
1158334678 18:56402902-56402924 CAGAGCCTTCAGAGGGAACATGG + Intergenic
1159438175 18:68445050-68445072 CAAAGTGATCAGAGAGAACTTGG + Intergenic
1160159607 18:76461244-76461266 CGGAGTGTCCAGGAGGAGCTTGG - Intronic
1161576451 19:5057156-5057178 CACAGTGTGCAGAGGGGGCTGGG - Intronic
1161622609 19:5306599-5306621 CGAAGTGTCCACAGGGAATTGGG - Intronic
1163422299 19:17220648-17220670 CAGAGTCTCCAGTGAGCACTGGG - Intergenic
1163437047 19:17302187-17302209 CAGGGTGTCCACAGGGAAGGTGG + Intronic
1163688250 19:18724556-18724578 CAGAGCCTCCAGAGGAAGCTCGG - Intronic
1163797032 19:19343689-19343711 CAGAGGGTGCAGTGGGGACTAGG + Intronic
1164871154 19:31644651-31644673 CAGTGTTTCCACAGAGAACTTGG - Intergenic
1166318997 19:42004901-42004923 CACAGTGGCCAGCCGGAACTGGG + Intronic
1167039347 19:47013423-47013445 CAGTGTGTCCTGAGGGCACTGGG + Intergenic
1167180741 19:47901535-47901557 CAGAGCCTCCAGAGGGAATGTGG + Intergenic
1168189784 19:54729670-54729692 CACAGGGCCCAGAGGGAAGTTGG - Exonic
1168449703 19:56456316-56456338 CAAAGTGTGCAAAGGGAAATGGG + Intronic
924974798 2:162725-162747 CAGAGTGGCCAGAGTGACATAGG - Intergenic
925387234 2:3470424-3470446 CAGAGAGTCCAGCAGGAACAGGG - Intronic
927463790 2:23322021-23322043 CAGAGTGTGCAGAGGGAGATGGG + Intergenic
929918857 2:46158066-46158088 CTGAGTGTACAGTGGGAACCAGG + Intronic
930229523 2:48828480-48828502 CAGAGTCTTGAGAGGGAACATGG + Intergenic
930436629 2:51352344-51352366 CAGAGAGTCCACATGGGACTGGG + Intergenic
933798517 2:85941276-85941298 CAGAGCCTCCAGAGGGAGCAAGG - Intergenic
934489666 2:94752724-94752746 CAGAGAGAGCAAAGGGAACTTGG - Intergenic
934503290 2:94874799-94874821 CAGATTGTCCTGCGTGAACTTGG - Exonic
935081507 2:99801609-99801631 CAGATTGTCCCGAAGGAAATGGG - Intronic
935679909 2:105627063-105627085 GAGAGCCTCCAGAGGGAACACGG - Intergenic
935681516 2:105642335-105642357 CAGAGGGTTGAGAGGAAACTGGG + Intergenic
937043958 2:118841372-118841394 CAGGGTGTCCTGAGGGCCCTGGG + Intergenic
937612209 2:123875759-123875781 TAGAGTGAGCAGAGGGATCTGGG + Intergenic
942511839 2:176710646-176710668 CAAAGTGTCCAGAGTTAACACGG - Intergenic
947868746 2:233420198-233420220 CAGACTCTGCTGAGGGAACTGGG - Intronic
948600389 2:239104600-239104622 CCGTCTGTCCAGAGGGAACTTGG - Intronic
949026927 2:241770664-241770686 CCCAGGGTCCAGAGGGCACTAGG - Intergenic
1169210545 20:3764085-3764107 CAGCTTGTCCCCAGGGAACTTGG + Intronic
1169242552 20:3996833-3996855 CAGAGTGGTAAGAGAGAACTAGG + Intronic
1170963825 20:21049075-21049097 TACAGTGGCCAGAGGGGACTGGG + Intergenic
1171063215 20:21986890-21986912 CAGAGACTCCAGAGAGAACACGG + Intergenic
1174666424 20:52262122-52262144 CAGAATTTACAGAGGGAAATTGG - Intergenic
1175247708 20:57591647-57591669 CAGAGGGGCCAGAGGGACATGGG + Intergenic
1175612279 20:60361664-60361686 CAGAGTGTCCTGAGTGGTCTAGG + Intergenic
1176430379 21:6571730-6571752 CAGAGCCTCCAGAGGGAACACGG - Intergenic
1176622745 21:9070391-9070413 CAGATTGTCCTGTGTGAACTTGG + Intergenic
1178051933 21:28757454-28757476 CAGAGGGTCCACTGGGATCTCGG - Intergenic
1179705773 21:43179192-43179214 CAGAGCCTCCAGAGGGAACACGG - Intergenic
1181616143 22:24055816-24055838 CTGAGTGCTCAGAGGGTACTGGG + Intronic
949421525 3:3871516-3871538 CAGAGATGCCAGAGGGAACATGG - Intronic
949663770 3:6313278-6313300 TAGAGCCTCCAGAGGGAACATGG - Intergenic
950068234 3:10130728-10130750 CATATTATCCAGAGGCAACTGGG - Intergenic
950841338 3:15970768-15970790 CAGAGTGTCCAAATGGGACATGG - Intergenic
953912263 3:46899093-46899115 TAGAGTGGCTAGAGGGTACTGGG - Intronic
954706185 3:52481794-52481816 CAGAGTGTCCCCAGGGCACAAGG - Intronic
955938225 3:64122833-64122855 AAGAGTTTCCAGGGGGAGCTGGG - Intronic
956593957 3:70946358-70946380 CAGCTTGATCAGAGGGAACTTGG - Intergenic
959817925 3:110697881-110697903 CTGAGTTTCCAGAGGGAGCATGG - Intergenic
966167932 3:177041917-177041939 CTGATTGTCCAGTGGGGACTGGG - Intronic
966341032 3:178924826-178924848 CAGAGTATTGAGAGGGAACATGG + Intergenic
966433939 3:179862063-179862085 CAGAGCCTTCAGAGGGAACGTGG - Intronic
967486404 3:190036728-190036750 CAGATTCTACAGAGGGAACTTGG - Intronic
968524247 4:1047915-1047937 CACAGTGTGCAGTGGGCACTCGG + Intergenic
968570571 4:1338346-1338368 CAGAGTGGCCACAGGGGGCTGGG + Intronic
969322286 4:6419748-6419770 CAGAGCTTCCAGAGGGAGCCAGG - Intronic
969421717 4:7101635-7101657 CATAGTGTCCAGAGGGCACTGGG + Intergenic
969517528 4:7655887-7655909 CACAGCGCCCAGAGGGAAATTGG + Intronic
970013415 4:11485626-11485648 CGGAGTCTCCAAAAGGAACTAGG - Intergenic
972842377 4:42946682-42946704 AAAAGAGGCCAGAGGGAACTGGG - Intronic
976775865 4:88705289-88705311 CAAAGTATCCAGATGGAACTGGG + Intronic
977313040 4:95410903-95410925 TAGAAGGTCCAGAGGGAACCAGG - Intronic
979439453 4:120734105-120734127 CAGAGTGTCCAGGAGGAAGGGGG + Intronic
979733460 4:124053116-124053138 CAGAGCTTCCAGAGGGAATGTGG - Intergenic
982098940 4:151949698-151949720 CAGAGCTTCCAGAAGGAACCAGG + Intergenic
982166273 4:152616372-152616394 CATAGTTTCCAAAGGGAAATGGG + Intergenic
985137484 4:186801781-186801803 AGGAGGGTCCAGAGGGAAGTTGG + Intergenic
986082456 5:4409163-4409185 TAGAGTGTCCAAAGGCAATTGGG + Intergenic
986324484 5:6661895-6661917 CATAGTGTCCAGTTGGAACCTGG + Intronic
986422906 5:7601939-7601961 TAGAGCCTCCAGAGGGAACATGG - Intronic
986564617 5:9099896-9099918 CAGAGTGTCGAGAGTGAAGCTGG - Intronic
989242381 5:39216081-39216103 TAGAGCCTCCAGAGGGAACATGG + Intronic
989326151 5:40197788-40197810 CAGAGTGCCCAGAGGGCCCAGGG - Intergenic
990979157 5:61586225-61586247 AAGAGCTTCCAGATGGAACTAGG - Intergenic
991093103 5:62711782-62711804 CAGAGTGTCCACAGGGAAGTGGG + Intergenic
997682902 5:135768648-135768670 CATAGTATCCAGGGGGAAATAGG + Intergenic
1000763918 5:165261389-165261411 CTGAGTTTTCAGAGGAAACTTGG + Intergenic
1001537446 5:172508228-172508250 CAGAGCCTCCAGAGGGAGCCTGG + Intergenic
1001600329 5:172924168-172924190 CAGAGAGGGCAGAGGGCACTGGG - Intronic
1001855982 5:175011270-175011292 CAGAGTGTGCACAGGGATGTTGG + Intergenic
1001994746 5:176147547-176147569 CAGAGTCCCAAGAAGGAACTCGG - Intergenic
1005462509 6:26082669-26082691 CAGAGGCTACAGAGGGATCTTGG - Intergenic
1005496285 6:26390925-26390947 CACAGGGACCATAGGGAACTGGG + Intronic
1006025590 6:31144866-31144888 CAAGGTGTCGAGAGGGAAATGGG - Exonic
1006562801 6:34928107-34928129 CAGAGTGTCCAGTGGGACTTGGG + Intronic
1006629238 6:35419324-35419346 CCGAGTGTCCAAAGGGCACTGGG + Intronic
1006807329 6:36797235-36797257 GACAGCGTCCAGTGGGAACTTGG + Intronic
1007925125 6:45644126-45644148 CAGAGTGCCCAGAGGCCCCTGGG + Intronic
1007935127 6:45726217-45726239 CAGAGTGCCCAGAGTGAGGTGGG + Intergenic
1008616432 6:53230895-53230917 CAGAGTGTCCTGATGCAGCTGGG - Intergenic
1009516566 6:64626686-64626708 TAGAGTTTTCAGAGGGAACATGG + Intronic
1010730195 6:79382758-79382780 AACAGTCTCCCGAGGGAACTAGG + Intergenic
1011390947 6:86852760-86852782 CACAGTTTCCAGATGGATCTAGG + Intergenic
1014085917 6:117343801-117343823 CTGAGTGTCCAGAAAGAATTGGG - Intronic
1017984329 6:159429901-159429923 GAGTGTGACCAGAGGGAAGTTGG - Intergenic
1018994296 6:168699449-168699471 CAGAGGAACCAGAGGGGACTGGG + Intergenic
1020086218 7:5312323-5312345 CAGAGTGTCCTCAGGCACCTGGG - Intronic
1021418327 7:20416285-20416307 CAGAGTGTGGAGTGGGAAATCGG + Intergenic
1024673401 7:51616880-51616902 CAGAGTGACCAGAGAGAACTGGG + Intergenic
1024793361 7:52992732-52992754 GAGAGTGTCCTGAGGGAGGTAGG + Intergenic
1025208087 7:57004749-57004771 CAGAGTGTCCTCAGGCACCTGGG + Intergenic
1025663865 7:63572126-63572148 CAGAGTGTCCTCAGGCACCTGGG - Intergenic
1026445404 7:70480479-70480501 CAAAATGTCAAGAGGGAAATGGG - Intronic
1029258081 7:99282991-99283013 CAGATTGTCCAGAGCAAAATGGG + Intergenic
1031228233 7:119069709-119069731 CAGTGTGCCCAGAGAGAATTTGG - Intergenic
1031387666 7:121172138-121172160 AACAGTGTACAGAGAGAACTGGG - Intronic
1032541392 7:132705886-132705908 CAGTGTGTCCAGAGGGCCTTGGG - Intronic
1034857241 7:154563322-154563344 CAGAGAGCTAAGAGGGAACTAGG + Intronic
1036641421 8:10586505-10586527 CAGATTGTACAGAGAGAAGTAGG + Intergenic
1037475321 8:19251465-19251487 CAGAGAGTGGAGAGGGAAGTGGG + Intergenic
1038701846 8:29856256-29856278 CAGAGCCTCCAGAGGGAGCACGG + Intergenic
1040478010 8:47797793-47797815 CACGGTGTCCAGAGGGGTCTGGG - Intronic
1042490770 8:69394806-69394828 CACAGTGTACAGAGAGAACTGGG - Intergenic
1043203338 8:77402178-77402200 CTGAATGTCCAGTGGGAACCTGG + Intergenic
1044515266 8:93130287-93130309 CAGTGTGTTCAGAGTGAAGTTGG - Intergenic
1047183705 8:122613464-122613486 CAGAGTTTCCAGAGAGAAGATGG - Intergenic
1047995844 8:130335005-130335027 CAGTGTGGCCAGAGAGAATTTGG - Intronic
1049377028 8:142294149-142294171 CAGAGTGGCCAGAGGGAAGGTGG + Intronic
1049907931 9:236118-236140 CAGAGTCTCCAGTGGTACCTTGG - Intronic
1053917932 9:42957817-42957839 CAGAGAGAGCAAAGGGAACTTGG + Intergenic
1056825737 9:89875170-89875192 CACTGTGTCCAGAGGGACATGGG + Intergenic
1057204661 9:93164091-93164113 CAGAGTGTCCAGGGAGAAGCTGG - Intergenic
1057694018 9:97310951-97310973 CAGAGTGTCTAGAGGGAGCTGGG - Intronic
1057736307 9:97664752-97664774 CAGCTAGTCCAGATGGAACTCGG + Intronic
1057791422 9:98127459-98127481 CAGAGTGGGCAGAGGGACCTGGG + Intronic
1057841400 9:98488109-98488131 TAGAGCCTCCAGAAGGAACTTGG + Intronic
1058618512 9:106860837-106860859 CCGAGTGCCCGGAGGGACCTAGG - Intergenic
1059395522 9:114031969-114031991 CAGGGTTTCCAGAGAGCACTTGG + Intronic
1061954301 9:133953631-133953653 CATGGTGGTCAGAGGGAACTGGG - Intronic
1062569103 9:137176315-137176337 AAGAGGGTTCAGAGGGAACGGGG + Intronic
1062607827 9:137355921-137355943 CAGCCTGTCCAGAGGGGCCTGGG + Intronic
1203745935 Un_GL000218v1:40819-40841 CAGATTGTCCTGTGTGAACTTGG + Intergenic
1203564177 Un_KI270744v1:78663-78685 CAGATTGTCCTGCGTGAACTTGG - Intergenic
1185506193 X:633548-633570 CAGGGTGTCTACAGGGAACGGGG - Intronic
1185577152 X:1183357-1183379 TAGAGCCTCCAGAGGGAACTGGG - Intergenic
1185798032 X:2983699-2983721 TAGAGTCTCCAGAGGGAATGTGG - Intergenic
1185822776 X:3220671-3220693 TAGAGCTTTCAGAGGGAACTGGG - Intergenic
1187148285 X:16657431-16657453 CAGGGTGACCAAAGTGAACTGGG + Intronic
1187848751 X:23569389-23569411 CAAGGTATCAAGAGGGAACTTGG - Intergenic
1188486400 X:30686974-30686996 CAACGTGTCTAGAGGGAACAGGG - Intronic
1196227575 X:113184665-113184687 AAGAGTGGCAAGAGGTAACTAGG + Intergenic
1197286672 X:124603120-124603142 CAGAGTCTCCAGAGGGAGTGTGG + Intronic
1201159259 Y:11155831-11155853 CAGATTGTCCTGTGTGAACTTGG + Intergenic
1201945335 Y:19504463-19504485 CAGACTTTCCAGAGGGAATCGGG + Intergenic