ID: 1102257575

View in Genome Browser
Species Human (GRCh38)
Location 12:111425119-111425141
Sequence CCGACCTGCTGTGTGACCGC GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 454
Summary {0: 1, 1: 0, 2: 5, 3: 61, 4: 387}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1102257562_1102257575 19 Left 1102257562 12:111425077-111425099 CCACAGGTGAGCCTCACCTGCAG 0: 1
1: 0
2: 1
3: 46
4: 356
Right 1102257575 12:111425119-111425141 CCGACCTGCTGTGTGACCGCGGG 0: 1
1: 0
2: 5
3: 61
4: 387
1102257566_1102257575 3 Left 1102257566 12:111425093-111425115 CCTGCAGTTGGGCCCCAGCTCTG 0: 1
1: 0
2: 2
3: 38
4: 345
Right 1102257575 12:111425119-111425141 CCGACCTGCTGTGTGACCGCGGG 0: 1
1: 0
2: 5
3: 61
4: 387
1102257568_1102257575 -10 Left 1102257568 12:111425106-111425128 CCCAGCTCTGCCCCCGACCTGCT 0: 1
1: 3
2: 10
3: 101
4: 783
Right 1102257575 12:111425119-111425141 CCGACCTGCTGTGTGACCGCGGG 0: 1
1: 0
2: 5
3: 61
4: 387
1102257567_1102257575 -9 Left 1102257567 12:111425105-111425127 CCCCAGCTCTGCCCCCGACCTGC 0: 1
1: 3
2: 8
3: 69
4: 620
Right 1102257575 12:111425119-111425141 CCGACCTGCTGTGTGACCGCGGG 0: 1
1: 0
2: 5
3: 61
4: 387
1102257565_1102257575 8 Left 1102257565 12:111425088-111425110 CCTCACCTGCAGTTGGGCCCCAG 0: 1
1: 0
2: 1
3: 34
4: 296
Right 1102257575 12:111425119-111425141 CCGACCTGCTGTGTGACCGCGGG 0: 1
1: 0
2: 5
3: 61
4: 387
1102257561_1102257575 20 Left 1102257561 12:111425076-111425098 CCCACAGGTGAGCCTCACCTGCA 0: 1
1: 0
2: 0
3: 15
4: 205
Right 1102257575 12:111425119-111425141 CCGACCTGCTGTGTGACCGCGGG 0: 1
1: 0
2: 5
3: 61
4: 387

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1102257575 Original CRISPR CCGACCTGCTGTGTGACCGC GGG Intronic