ID: 1102259333

View in Genome Browser
Species Human (GRCh38)
Location 12:111434911-111434933
Sequence CTCCAGCCACGGCACAGCAC CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 773
Summary {0: 1, 1: 0, 2: 6, 3: 190, 4: 576}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1102259333_1102259340 5 Left 1102259333 12:111434911-111434933 CCGGTGCTGTGCCGTGGCTGGAG 0: 1
1: 0
2: 6
3: 190
4: 576
Right 1102259340 12:111434939-111434961 CCTGGCCTGGCTGTGCCAGTTGG 0: 1
1: 0
2: 1
3: 36
4: 370
1102259333_1102259343 10 Left 1102259333 12:111434911-111434933 CCGGTGCTGTGCCGTGGCTGGAG 0: 1
1: 0
2: 6
3: 190
4: 576
Right 1102259343 12:111434944-111434966 CCTGGCTGTGCCAGTTGGCTGGG 0: 1
1: 0
2: 2
3: 23
4: 213
1102259333_1102259338 -8 Left 1102259333 12:111434911-111434933 CCGGTGCTGTGCCGTGGCTGGAG 0: 1
1: 0
2: 6
3: 190
4: 576
Right 1102259338 12:111434926-111434948 GGCTGGAGGAGGACCTGGCCTGG 0: 1
1: 1
2: 8
3: 72
4: 589
1102259333_1102259341 9 Left 1102259333 12:111434911-111434933 CCGGTGCTGTGCCGTGGCTGGAG 0: 1
1: 0
2: 6
3: 190
4: 576
Right 1102259341 12:111434943-111434965 GCCTGGCTGTGCCAGTTGGCTGG 0: 1
1: 0
2: 2
3: 24
4: 383

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1102259333 Original CRISPR CTCCAGCCACGGCACAGCAC CGG (reversed) Intronic
900241128 1:1618096-1618118 CCACAGCCACAGCCCAGCACTGG - Intronic
900284936 1:1894538-1894560 CTCCAGCCAGGGCCCATCCCTGG + Intergenic
900457717 1:2785566-2785588 CACCAGGCAGGGCACAGCTCAGG + Intronic
900510803 1:3060157-3060179 CAGCAGCCACAGCACAGCCCTGG + Intergenic
900534216 1:3169061-3169083 CCGCAGCAGCGGCACAGCACAGG - Intronic
900566241 1:3333379-3333401 CTGCAGCCAGGCCAAAGCACTGG - Intronic
901057477 1:6455383-6455405 CTCCAGCCCCGGGCCAGCACCGG - Intronic
901160426 1:7173017-7173039 CCCCAGCCACGCTCCAGCACGGG - Intronic
901238421 1:7679726-7679748 CACCAGCCAGGGCACAGCTAGGG + Intronic
901453343 1:9349385-9349407 CTCCTGGCCCGGCACAGCTCTGG - Intronic
901607562 1:10471393-10471415 ATCCAGCCACGGCACTGAAGGGG + Intronic
902704501 1:18195308-18195330 TGCCAGCCTCGGAACAGCACAGG + Intronic
903072410 1:20732822-20732844 CTCCAGCCACGGCACTGGGACGG + Intronic
904302270 1:29561918-29561940 CTCCACCCAGGGCCCTGCACTGG - Intergenic
907337272 1:53708249-53708271 CTCCAGCCTGGGCACAGCAGAGG + Intronic
908598146 1:65710568-65710590 CTCCAGCAAGGGCACAAAACTGG - Intergenic
908611263 1:65864387-65864409 CTCCAGCAAGGGCACAAAACTGG - Intronic
909384357 1:75037770-75037792 CTCCAGCAAGGGCACAAAACTGG + Intergenic
909697657 1:78484972-78484994 CTCCAGCAAGGGCACAAAACTGG + Intronic
910016702 1:82534126-82534148 CTCCAGTAAGGGCACAGAACTGG - Intergenic
910635583 1:89404486-89404508 CTCCAGCAAGGGCACAAAACTGG - Intergenic
910827698 1:91427459-91427481 CTCCAGCAAGGGCACAAAACTGG - Intergenic
911051746 1:93677318-93677340 CTCGAGCCACAGCACACAACTGG - Intronic
911242899 1:95484285-95484307 CTCCAGCAAGGGCAGAGAACTGG + Intergenic
911464470 1:98234051-98234073 CTCCAGCAAGGGCACAGAATTGG + Intergenic
911504141 1:98727490-98727512 CTCCAGCAAGGCCACAGAACTGG + Intronic
912276449 1:108263009-108263031 CTCCAGTAAGGGCACAGAACAGG + Intergenic
912291779 1:108431349-108431371 CTCCAGTAAGGGCACAGAACAGG - Intronic
914218362 1:145655327-145655349 CTCCAGCAAGGGCACAGAACTGG - Intronic
914470923 1:147978018-147978040 CTCCAGCAAGGGCACAGAACTGG - Intronic
915049322 1:153050538-153050560 CTCCAGCCAGGGCTCAGAACTGG + Intergenic
915204995 1:154263547-154263569 CTTCATCCACAGCACAGCATTGG - Intronic
915639675 1:157215129-157215151 CTCCAGCAAGGGCACAGAACAGG - Intergenic
916040092 1:160954321-160954343 CTCCAGGCCCTGCACAGCAGAGG + Intronic
916143754 1:161722431-161722453 CTACAGCCACCTCACAGCTCAGG - Intronic
916183049 1:162104930-162104952 CTCCAGCAAAGGCACAGAACTGG - Intronic
916218685 1:162421383-162421405 CTCCAGCCACAGCACAACTGTGG + Intergenic
916343307 1:163759684-163759706 CTCCAGCAAGGGCACAGAACTGG + Intergenic
916973586 1:170049957-170049979 CTCCAGCAAGGGCACAAAACTGG + Intronic
917062665 1:171057081-171057103 CTCCAGCAAGGGCACAGCACTGG + Intronic
917079191 1:171238473-171238495 CTCCATCAAGGGCACAGAACTGG + Intergenic
917269757 1:173259459-173259481 CTCCAGCAAGGGCACAGAACTGG + Intergenic
917295568 1:173515686-173515708 GTCCAGCAAAGGCACAGAACTGG - Intronic
918160151 1:181890492-181890514 CTCCAGCAAGGGCACAAAACTGG + Intergenic
918168864 1:181975919-181975941 CTCCAGCAATGGCACAAAACTGG + Intergenic
918614683 1:186531187-186531209 CTCCAGCAAGGGCACAGAACTGG - Intergenic
918697200 1:187559717-187559739 CTCCAGCAAGGGCACAGAACTGG - Intergenic
918839360 1:189513991-189514013 CTCTAGCAAGGGCACAGAACTGG + Intergenic
918943283 1:191027983-191028005 CTCCAGCAAAGGCACAGAATTGG + Intergenic
919220784 1:194625546-194625568 CTCCAGCAAGGGCACAGAACTGG + Intergenic
919231585 1:194780621-194780643 CTCCAGCAAGGGCACAGAACTGG + Intergenic
919466217 1:197923325-197923347 CTCCTGCCCCAGCACAGCAGGGG - Intronic
919932256 1:202229004-202229026 CCCAAGCCAGGGCACAGGACGGG - Intronic
920799906 1:209176849-209176871 ATCCTGCCACGCAACAGCACAGG - Intergenic
921918818 1:220643070-220643092 CTCCAGCAAGGGAACAGAACTGG + Intronic
922404044 1:225293507-225293529 CTCCATCCATGTCACAGCAAAGG - Intronic
922576728 1:226665824-226665846 TTGCAGCCACGGCCCAGCCCAGG + Intronic
922693690 1:227714520-227714542 CTCCAGCAAGGGCACAGAACTGG + Intergenic
922785563 1:228280805-228280827 CTGCAGGCACGGCAGAGCTCAGG + Intronic
922910389 1:229210898-229210920 CTCCACACACGGCACAGCCTGGG + Intergenic
923195392 1:231661770-231661792 CTCCAGCAAGGGAACAGAACTGG - Intronic
924629682 1:245724809-245724831 GTCCAGCCAGGCCACAGAACTGG + Intergenic
924883807 1:248190068-248190090 CTCCAGCAAGGGCAAAGAACTGG + Intergenic
1064757980 10:18588883-18588905 CTCCAGCAAGGGCACAAAACTGG + Intronic
1064848323 10:19681684-19681706 CTCTAGCAAGGGCACAGAACTGG - Intronic
1065120860 10:22529513-22529535 CTCCAGCAAGGGCACAAAACTGG - Intergenic
1067923326 10:50481640-50481662 CTCCAGCAAGGGCACAGAACTGG + Intronic
1068381036 10:56254477-56254499 CTTCAGCAAGGGCACAGAACTGG - Intergenic
1068410295 10:56645952-56645974 CTCCAGCAAGGGCACAGAACAGG - Intergenic
1068518932 10:58058059-58058081 CTCCAGCAAGGGCACAGAACTGG + Intergenic
1069371062 10:67747725-67747747 CTCCAGCAAGGGGACAGAACTGG + Intergenic
1069957433 10:72060653-72060675 CTCCAGCCCCGGCTCAGTTCAGG - Exonic
1070052825 10:72905669-72905691 CTTCAGCCATGGCAGAGCCCTGG + Intronic
1070213300 10:74348551-74348573 CTCCAGCAAGGGCACAAAACTGG + Intronic
1070987574 10:80701461-80701483 CTCCAGAAACGGCAGAGCCCTGG + Intergenic
1071317324 10:84415170-84415192 CTCCAGCAAGGGCACAGAACTGG - Intronic
1071340053 10:84637733-84637755 CTCCAGCAAGGGCACAAAACTGG + Intergenic
1072360719 10:94656442-94656464 CCCCAGCAAGGGCACAGAACTGG - Intergenic
1072537335 10:96373595-96373617 TTCCAGGCAGTGCACAGCACAGG - Exonic
1072834599 10:98697117-98697139 CTCCAGCAAGGGCACAGAACTGG + Intronic
1072953433 10:99869001-99869023 CTCCAGCAAGGGCACAAAACTGG - Intergenic
1073915132 10:108394190-108394212 ATCCAGACAGGGCAAAGCACAGG + Intergenic
1074022115 10:109594693-109594715 CTCCAGCCAGGGCACAGAACTGG + Intergenic
1074636207 10:115320895-115320917 CTCCAGCAAGGGCGCAGAACTGG - Intronic
1075281978 10:121147057-121147079 TTCCAGCAAGGGCACAGAACTGG - Intergenic
1075860714 10:125674446-125674468 CTCCAGCAAGGGCACAGAACTGG - Intronic
1076644664 10:131944674-131944696 CTCAAGCCACTGGACAGCAGAGG - Intronic
1076933124 10:133547050-133547072 CTCCAGCAAGGGCACAGAACTGG + Intronic
1077228761 11:1449520-1449542 CAGCAGCCCAGGCACAGCACAGG - Intronic
1077239025 11:1500989-1501011 CTCCAGCCACAGCAAAGGACAGG - Intronic
1077323377 11:1952506-1952528 CACCAGCCAGGGCACACGACAGG - Intronic
1077428175 11:2497692-2497714 CTCCAGCAAGGGCACAAAACTGG - Intronic
1077713779 11:4560512-4560534 CTCCAGCAAGGGCACAAAACTGG + Intergenic
1077855190 11:6116702-6116724 CTTCAGCAAGGGCACAGAACTGG + Intergenic
1078501787 11:11886212-11886234 CTCCAGCAAGGGCACAGAACTGG + Intronic
1078691365 11:13583423-13583445 CTCCAGCAAGGGCACAGAACTGG + Intergenic
1079256944 11:18838743-18838765 CTCCAGCAAGGGCACAGAACTGG + Intergenic
1079276385 11:19041086-19041108 CTCCAGGAAGGGCACAGAACTGG + Intergenic
1079437316 11:20470534-20470556 CTCCATCCACGGCCCTGCAAAGG + Intronic
1079437598 11:20473777-20473799 CTCCAGCAAGGGCACAGAACTGG - Intronic
1079481951 11:20890475-20890497 CTCCATCAAGGGCACAGAACTGG + Intronic
1079738998 11:24034734-24034756 CTCCAGCAAGGGCACAGAACCGG - Intergenic
1079935129 11:26607958-26607980 CTCCGGCAAGGGCACAGAACTGG - Intronic
1080782990 11:35448665-35448687 CTCCAGCAATGGCACAGAACTGG - Intronic
1080920855 11:36708147-36708169 CTCTAGCCACGGAAAACCACAGG - Intergenic
1081008862 11:37782173-37782195 CTCCAGCAAGGGCACAGAACTGG + Intergenic
1081269501 11:41066031-41066053 CTCCAGCAAGAGCACAGAACTGG + Intronic
1081664003 11:44905904-44905926 CTCCAGCCACAGAACAGACCAGG - Intronic
1082122110 11:48390908-48390930 CTCCAGCAACAGAACAGAACTGG - Intergenic
1082746404 11:56968028-56968050 CTCCAGCAAGGGCACAGAACTGG - Intergenic
1082876199 11:57991716-57991738 CTCCAGCAAGGGCACAAAACTGG - Intergenic
1083768581 11:64854012-64854034 CTCCAGCCACAGCAAAGGCCGGG + Exonic
1083828611 11:65217184-65217206 CTCCAGCCACAGCAGTGCTCAGG + Intergenic
1085066427 11:73499489-73499511 CTCCATCAAGGGCACAGGACTGG + Intronic
1085335043 11:75687157-75687179 CTCCATCAAGGGCACAGAACTGG - Intergenic
1086021707 11:82238912-82238934 CTCCAGCAAGGGCAGAGAACTGG - Intergenic
1086050007 11:82578138-82578160 CTCCAGCAAGGGCACAGAACTGG + Intergenic
1086279875 11:85172582-85172604 CTCCTGCAAGGGCACAGAACTGG + Intronic
1086414369 11:86574233-86574255 CTCCAGCAAGGGCACAAAACTGG - Intronic
1086820624 11:91432617-91432639 CTCCAACAAGGGCACAGAACTGG - Intergenic
1086894404 11:92295443-92295465 ATTCAGACACGGCACAGCTCGGG - Intergenic
1087316880 11:96614128-96614150 CTTCAGCAAGGGCACAGAACTGG - Intergenic
1087513615 11:99129067-99129089 CTCCAGCAAGGCCACAGAACGGG + Intronic
1087815208 11:102650623-102650645 CTGCATCCATGGCACTGCACAGG + Intergenic
1088004961 11:104928191-104928213 CTCCAGCAAGGGCACAGAACTGG + Intergenic
1088008444 11:104970043-104970065 CTCCAGCAAGGGCACAAAACAGG + Intergenic
1088020519 11:105112577-105112599 CTCCAGCAAGGGCACACAACAGG + Intergenic
1088034494 11:105295762-105295784 CTCCAGCAAGGGCACAAAACTGG - Intergenic
1088037535 11:105335094-105335116 CTCCAGCAAGGGAACAGAACTGG + Intergenic
1088383265 11:109220728-109220750 CTCCAGGAAGGGCACAGAACTGG - Intergenic
1088703279 11:112434188-112434210 CTCCAGCAAGGGCACAGAACTGG - Intergenic
1090106258 11:123855750-123855772 CTCCAGCAAGGGCACAGAATTGG + Intergenic
1090307917 11:125706081-125706103 CTCCAGCAAGGGCACAAAACTGG + Intergenic
1090318527 11:125819056-125819078 CTCCAGCAAGGGCACAAAACTGG + Intergenic
1090740919 11:129659139-129659161 CTCCAGCAAGGGCACAGAATGGG + Intergenic
1090811822 11:130250905-130250927 CTCCAGCGAGGGCACAACACTGG + Intronic
1202806365 11_KI270721v1_random:7701-7723 CACCAGCCAGGGCACACGACAGG - Intergenic
1092512504 12:9171475-9171497 CACCAGCAAGGGCACAGAACCGG + Intronic
1092637630 12:10468873-10468895 CTCCAGCCCAGGAACAGCAAGGG + Intergenic
1093303427 12:17480235-17480257 CTCCAGCAAGGGCACAGAACTGG + Intergenic
1094525762 12:31229631-31229653 CTCCAGCCAGGACACGGCCCCGG + Intergenic
1094811649 12:34143812-34143834 CCCCAGCAAGGGCACAGAACTGG + Intergenic
1095510215 12:42943473-42943495 CTCCAGCAAGGGAACAGAACTGG - Intergenic
1095595436 12:43952255-43952277 CTCCAGCAACAGCACAGAACAGG + Intronic
1096194701 12:49642444-49642466 CCCCAGTCACGTCACAGCCCTGG + Exonic
1097455829 12:59797002-59797024 CTCCAGCAAGGGCAAAGAACTGG + Intergenic
1097498574 12:60374161-60374183 CTCCAGCAAGGGCACAGAACTGG + Intergenic
1097517083 12:60618870-60618892 CTCCATCAAGGGCACAGAACTGG + Intergenic
1097654289 12:62342434-62342456 CTCCAGCAAGGGCACAAAACTGG - Intronic
1098047151 12:66411596-66411618 CTTCAGCAAGGGCACAGAACTGG + Intronic
1098193501 12:67976084-67976106 CTCCAGCAAGGGCGCAGAACTGG - Intergenic
1098733478 12:74067028-74067050 CTCCAGCAAGGGCACAGAGCTGG + Intergenic
1098764417 12:74468541-74468563 CTCCAGCAAGGGCACAGAACAGG - Intergenic
1098830075 12:75350812-75350834 CTCCAGCAAGGGCACAGAACTGG + Intronic
1098839867 12:75466136-75466158 CTCCAGCAAGGGCACAAAACTGG - Intergenic
1099108020 12:78520034-78520056 CTCCAGCAAGGGCACAAAACTGG + Intergenic
1099502561 12:83432026-83432048 CTCCAGTAAGGGCACAGAACTGG - Intergenic
1100099922 12:91091235-91091257 CTCCAGCAAGGGCACAGAACTGG - Intergenic
1101186766 12:102289040-102289062 CTCCAGCAAGGACACAGAACTGG - Intergenic
1102259333 12:111434911-111434933 CTCCAGCCACGGCACAGCACCGG - Intronic
1103169034 12:118798159-118798181 CTCCAGCAAGGGCACAAAACTGG - Intergenic
1103320005 12:120086970-120086992 CTACAGCCGCGGCGCAGCGCCGG - Intronic
1104038582 12:125114947-125114969 CCCCTACCACGGCGCAGCACAGG - Intronic
1104072553 12:125358454-125358476 CTCCAGGAACCCCACAGCACAGG + Intronic
1104224081 12:126814016-126814038 CTGCAGCCATGGCAGTGCACAGG + Intergenic
1104256264 12:127142348-127142370 CTCCATCAAGGGCACAGAACTGG - Intergenic
1104640880 12:130466130-130466152 CTCAGGACACGGCCCAGCACAGG + Intronic
1105316598 13:19270940-19270962 CTCCAGCAAGGGCACAAAACTGG + Intergenic
1105414002 13:20193301-20193323 CCCCGCCCACGGCACAGCGCCGG - Intergenic
1106336466 13:28788210-28788232 CTCCAGCAAAGGCACAAAACTGG - Intergenic
1106425628 13:29625882-29625904 TTCCAGCAAGGGCACAGAACTGG + Intergenic
1106650978 13:31689399-31689421 CTCCAGCAAGGGCACAAAACTGG + Intergenic
1107243564 13:38265753-38265775 CTCCAGCAAGGGCACAGAATGGG + Intergenic
1107993813 13:45841473-45841495 TTCCAGCTGTGGCACAGCACTGG - Intronic
1108144789 13:47464705-47464727 CTCCAGCAAGGGCACAGAACTGG + Intergenic
1108160527 13:47633432-47633454 CTCCATCAAGGGCACAGAACTGG + Intergenic
1108636625 13:52341596-52341618 CTCCAGCAAGGGCACAGAACTGG + Intergenic
1108651427 13:52483959-52483981 CTCCAGCAAGGGCACAGAACTGG - Intergenic
1108676467 13:52741159-52741181 CTCCAGCCAGGGCTCATCCCTGG + Intergenic
1108815522 13:54286355-54286377 CTCCAGCAAGGGCACAGAACTGG - Intergenic
1108940691 13:55948757-55948779 CTCCAGCAAGGGCACAAAACTGG + Intergenic
1109724336 13:66319463-66319485 CTCAAGCCATGGCACCTCACAGG - Intronic
1109968868 13:69738363-69738385 CTCCAGCAAGTGCACAGAACTGG + Intronic
1110337422 13:74347725-74347747 CTCCAGCAAGGGCGCAGAACTGG + Intergenic
1110836809 13:80093116-80093138 CTCCAGCAAGGGCACAGAACTGG - Intergenic
1111045297 13:82806179-82806201 CTCCAACAAGGGCACAGAACTGG + Intergenic
1111305773 13:86410481-86410503 CTCCAGCAAGGGCACAGAACTGG + Intergenic
1111332696 13:86781448-86781470 CTCCAGCAAGGACACAGAACTGG - Intergenic
1111641744 13:90978178-90978200 CTCCAGCAAGGGCACATAACTGG + Intergenic
1112620031 13:101045970-101045992 CTCCAGCAAGGGCACAAAACTGG - Intergenic
1113725135 13:112592797-112592819 CTTCAGACACGGCAGTGCACTGG + Intergenic
1114958305 14:27850077-27850099 CTCCAGCAAGGGCACAGAACTGG + Intergenic
1115124321 14:29973453-29973475 CTCCAGCAAGGGCACAAAACTGG + Intronic
1115385330 14:32789836-32789858 CTCCAGCAAGGGCACAGAACTGG + Intronic
1115927337 14:38449805-38449827 CTCCAGCAAGGGCACAGAACTGG + Intergenic
1116123859 14:40756482-40756504 CTTCAGCAAGGGCACAGAACTGG - Intergenic
1116312204 14:43341668-43341690 CTCCAGCAAGGGCATAGAACAGG - Intergenic
1116685579 14:48035124-48035146 CTCCAGCAATGGCACAGAATTGG - Intergenic
1116781909 14:49245245-49245267 CTCCAGCAAGGGCACAAAACTGG + Intergenic
1118053980 14:62058912-62058934 CTCCACCCACGTCCCAGCAAAGG - Intronic
1120799295 14:88670533-88670555 CTCCAGCAAGGGCACAGAACTGG + Intronic
1121142532 14:91555769-91555791 CTCCAGCAATGGCACAGAACTGG + Intergenic
1121706920 14:96003071-96003093 CTCCAGCAGGGGCACAGAACTGG + Intergenic
1122599096 14:102912461-102912483 CACCAGCCAGGGCACGGCAGGGG - Intergenic
1122614596 14:103008370-103008392 CTGCAGCCACCCCACAGCCCTGG - Intronic
1122623842 14:103074274-103074296 CTCCAGTCCCAGGACAGCACTGG - Intergenic
1122804196 14:104248377-104248399 CACCAGCCCCGGCAGAGCCCAGG - Intergenic
1122812308 14:104295146-104295168 CTCCGGCCACCGCCCAGCAGAGG - Intergenic
1123066509 14:105621996-105622018 CTGTAGGCAAGGCACAGCACAGG + Intergenic
1123070651 14:105641049-105641071 CTGTAGGCAAGGCACAGCACAGG + Intergenic
1123075246 14:105664710-105664732 CTGTAGGCAAGGCACAGCACAGG + Intergenic
1123089894 14:105737846-105737868 CTGTAGGCAAGGCACAGCACAGG + Intergenic
1123095678 14:105765998-105766020 CTGTAGGCAAGGCACAGCACAGG + Intergenic
1123884972 15:24717882-24717904 CTTCAGCAAGGGCACAGAACTGG - Intergenic
1124441409 15:29688706-29688728 CTCACGCCAGGGCCCAGCACCGG + Intergenic
1124923611 15:34049170-34049192 CTCCAGCAAAGGCACAGAACTGG + Intronic
1125015738 15:34932708-34932730 CACCCGCCACGCCAAAGCACTGG - Intronic
1125054463 15:35341394-35341416 CTCCAGCAAGGGCACAGAACTGG - Intronic
1125175758 15:36819800-36819822 CTTCAGCGGCGGCACAGCACAGG + Intergenic
1125216533 15:37282309-37282331 CTCCAGCAAGGGCACAGAACTGG - Intergenic
1125235013 15:37502758-37502780 CTCCGGCAAGGGCACAGAACTGG + Intergenic
1125258441 15:37794176-37794198 CTCCAGTGACTTCACAGCACTGG - Intergenic
1125373309 15:39000901-39000923 CTCTAGCAAGGGCACAGAACTGG + Intergenic
1126513843 15:49511984-49512006 CTCCAGCAAGGGAACAGAACTGG + Intronic
1126956367 15:53936998-53937020 CTCCAGCAAGGGCACAGAACTGG + Intergenic
1127042477 15:54991697-54991719 CTACAGCAAGGGCACAGAACTGG + Intergenic
1127099969 15:55554152-55554174 CTCCAGCAAGGGCACTGAACTGG + Intronic
1127687571 15:61364130-61364152 CTCCATCAAGGGCACAGAACTGG - Intergenic
1127996962 15:64158712-64158734 CTCCTGCCACAGAACAGCACCGG + Intronic
1128856825 15:71024728-71024750 CTCCAGCAAGGACACAGAACTGG + Intronic
1129566840 15:76632627-76632649 CTCCAGCAAGGGCACAGAACTGG - Intronic
1130375723 15:83327110-83327132 CTCCAGTCATGGCCAAGCACTGG + Intergenic
1130779304 15:87017763-87017785 CTCCAGGAAGGGCACAGAACAGG + Intronic
1130848396 15:87768688-87768710 CTCCAGCATGGGCACAGAACTGG + Intergenic
1131590998 15:93747811-93747833 TTCCAGCAAGGGCACAGAACTGG + Intergenic
1131942635 15:97584474-97584496 CTCCAGCAAGGGCGCAGAACTGG - Intergenic
1132397023 15:101481586-101481608 CCCCTGCCACCGCCCAGCACAGG - Intronic
1132708898 16:1257935-1257957 CTGCAGGCACAGAACAGCACTGG + Intronic
1132726590 16:1341538-1341560 CTCCAGGCACAGCCCAGCTCTGG - Intronic
1133287559 16:4697663-4697685 CTCCAGCCAGGGCCCAGACCCGG - Intronic
1138342094 16:56296681-56296703 CTCCAGCTAGAGCCCAGCACAGG + Intronic
1138786811 16:59856204-59856226 CTCCAACCAAAGGACAGCACAGG - Intergenic
1139323673 16:66135174-66135196 CTCCAGTTCCGACACAGCACAGG - Intergenic
1139402187 16:66691667-66691689 CTCCAGCCTGGGCACAGAGCAGG + Intronic
1140182579 16:72735581-72735603 CTCCAGTAAGGGCACAGAACTGG - Intergenic
1140669965 16:77268750-77268772 CTCCAGCAAGGACACAGAACTGG - Intronic
1140866006 16:79062749-79062771 CTTCAGCCCCGGAACATCACAGG + Intronic
1140946225 16:79770655-79770677 CTCCAGCCGCGGCCCAGAAGAGG + Intergenic
1142029503 16:87831545-87831567 CTCCAGCCACAGCTGAGCACTGG + Exonic
1142305122 16:89280437-89280459 CTCCAGCCCCGGCTCAGCGACGG + Exonic
1142804272 17:2363301-2363323 CTCCAGCCACGGACCAGCATGGG - Intronic
1142983191 17:3683166-3683188 CTCCACCCACAGCACAGGGCAGG + Intronic
1143025157 17:3937292-3937314 CCCCAGCCAGGGCAGGGCACAGG + Intronic
1143367887 17:6420362-6420384 CTGCAGCCTCAGCACAGCAATGG - Intronic
1143490887 17:7284689-7284711 CTCCAGGCAGGGCACAGCCCCGG + Intronic
1144120942 17:12151586-12151608 CTCCAGCAAGGGCACAGAACTGG + Intergenic
1144431902 17:15199668-15199690 CTCCAGCAAGGGCACAGAACTGG + Intergenic
1144616770 17:16783363-16783385 CTCCAGCAAGGGCTCAGAACTGG - Intronic
1144895922 17:18532310-18532332 CTCCAGCAAGGGCTCAGAACTGG + Intergenic
1145136292 17:20411922-20411944 CTCCAGCAAGGGCTCAGAACTGG - Intergenic
1145978665 17:28998668-28998690 CTCCTGCCACTGGACAGCTCTGG - Intronic
1146061355 17:29609062-29609084 TGCCAGACACGGAACAGCACAGG - Intronic
1146817280 17:35953105-35953127 CTCCAGCAAGGGCACAAAACTGG - Intergenic
1146938193 17:36825676-36825698 GCCCAGCCAAGGCACAGCGCGGG + Intergenic
1147620727 17:41865058-41865080 CTCCAGCCCCGCCGAAGCACAGG + Exonic
1149242046 17:54662520-54662542 CTCCAGCAAGGGCACAGAACTGG - Intergenic
1149377825 17:56063774-56063796 CTCCAGCAAGAGCACAGAACTGG - Intergenic
1150090900 17:62323726-62323748 CTCCAGCAAAGGCACAAAACTGG + Intergenic
1152348599 17:79770171-79770193 CTCCAGCCACAGGAAAGCAAAGG - Intergenic
1152427632 17:80226852-80226874 CTCCCTCCAGGCCACAGCACTGG - Intronic
1152717110 17:81905497-81905519 CGCCACCCACAGCCCAGCACAGG + Intronic
1152785862 17:82247680-82247702 CTCCAGACACAGCACAGAAAGGG - Intronic
1155429958 18:25744554-25744576 CTCCAGCAAGGGCACAGAACTGG + Intergenic
1155763029 18:29589646-29589668 CTCCAGCAAGGGCACAGAGCTGG + Intergenic
1157016428 18:43720201-43720223 CTCCAGCAAGGGCACAGAACTGG + Intergenic
1157644937 18:49258658-49258680 CCACAGCCATGGCAGAGCACTGG - Intronic
1157936902 18:51883495-51883517 CTCCAAGCCCAGCACAGCACTGG - Intergenic
1158659215 18:59371088-59371110 CTCCAGCAAGGGCACAAAACTGG - Intergenic
1158676860 18:59528491-59528513 CTCCAGCAAGGGCACAGAACTGG - Intronic
1159972759 18:74674230-74674252 CTCCAGCTCCAGCACAGCACTGG - Intronic
1160428870 18:78797657-78797679 CTCCAGCCACTGCGCTCCACTGG - Intergenic
1160557124 18:79733261-79733283 CCGCAGCCTCGGCACAGGACGGG + Intronic
1160901085 19:1429056-1429078 CCGCAGCGACGGCACAGCCCAGG - Intronic
1160946210 19:1645164-1645186 CTCCAGCCAGGGCCCACCCCTGG + Intronic
1160985298 19:1835863-1835885 CTCCAGCCAGGGCTCAGCCCAGG + Intronic
1161570319 19:5026986-5027008 CTCCAGCCAGCTCACACCACGGG + Intronic
1163638629 19:18449518-18449540 CTCCAGCCACAGCAGGGGACGGG + Intronic
1163995920 19:21047359-21047381 CTCCAGGAAGGGCACAGAACTGG - Intronic
1164047411 19:21554670-21554692 CTCCAGCAAGGGCACAAAACTGG - Intronic
1164234164 19:23317537-23317559 TTCCTGACAAGGCACAGCACAGG + Intronic
1164248953 19:23460073-23460095 TTCCTGACAAGGCACAGCACAGG + Intergenic
1164303071 19:23979091-23979113 TTCCTGACAAGGCACAGCACAGG - Intergenic
1164578116 19:29417887-29417909 CTCCAGCCGCTGACCAGCACAGG + Intergenic
1165153806 19:33775678-33775700 ATCCACCCACCCCACAGCACAGG - Intergenic
1165270035 19:34697770-34697792 CTCCAGCAAGGGCACAAAACTGG + Intergenic
1166864387 19:45827165-45827187 CTCAGGCCCCGGCACAGGACTGG + Intronic
1166899186 19:46045086-46045108 CTCCAGCAAGGGCACAGAACTGG + Intronic
1166904739 19:46100142-46100164 CTCCAGCAAGGGTACAGAACTGG - Intergenic
1168438381 19:56341070-56341092 CTCCAGCAAGGGCACAAAACTGG - Intronic
925388438 2:3479593-3479615 CCCAAGCCACGGCCCAGCCCAGG + Intronic
925433141 2:3814545-3814567 CTCCATCAAGGGCACAGAACTGG - Intronic
925442194 2:3898474-3898496 CTCCAGCAAGGGCACAGAACTGG - Intergenic
925890105 2:8426428-8426450 CGCAGGCCAAGGCACAGCACAGG + Intergenic
926242560 2:11099859-11099881 CTCCAGCCTTGGCACATCAAGGG + Intergenic
928475548 2:31623465-31623487 CTCCAGCAAGGGCACAGAACTGG - Intergenic
928488406 2:31755473-31755495 CTCCAGCAAGGGCACAAAACTGG + Intergenic
928805874 2:35154103-35154125 CTACAGCCCCTGCACAGCAAGGG + Intergenic
928850154 2:35735268-35735290 CTCCAGCAAGGGCACAGAACTGG + Intergenic
930175933 2:48301979-48302001 CTCCAGCAAAGGCACAAAACTGG - Intergenic
930424207 2:51193278-51193300 CTCCAGCAATGGCACAGAACTGG - Intergenic
930552345 2:52851885-52851907 CTCCAGCAAGGACACAGAACTGG - Intergenic
931458548 2:62431496-62431518 CTCCAGGCATGGCAAAGCCCTGG - Intergenic
931560551 2:63555962-63555984 CTCCAGCAAGGGCACAGAACTGG + Intronic
931560603 2:63556589-63556611 CTTCAGCAAGGGCACAGAACTGG - Intronic
932379721 2:71270823-71270845 CTCCAGCAAGGGCACAGAACTGG + Intergenic
933052177 2:77613074-77613096 CTCCAGCGAGTGCACAGAACTGG + Intergenic
933129619 2:78655936-78655958 CTCCAGCAAGAGCACAGAACTGG + Intergenic
933436423 2:82256313-82256335 CTCCAGCAAGGGCACAGAACTGG - Intergenic
933465268 2:82642837-82642859 CTCCAGCAAGGGCACAGAACTGG + Intergenic
933602405 2:84347074-84347096 CTCCAGCAAGGGCACAGAACTGG - Intergenic
934478992 2:94617970-94617992 CTCCATCAAGGGCACAGAACTGG - Intergenic
934548799 2:95241612-95241634 CTCCAGCAAGGGCACAGAATTGG + Intronic
934923555 2:98365923-98365945 CTCCACCAAGGGCACAGAACTGG - Intronic
935399559 2:102645416-102645438 CTCCAGCAAGGGCACAAAACTGG + Intronic
935732102 2:106072794-106072816 CTCTGGCCACCACACAGCACAGG - Intronic
935929842 2:108112726-108112748 TTCCAGCAAGGGCACAGAACTGG - Intergenic
936171634 2:110181754-110181776 CTCCAGCAAGGGCACAGAAGTGG + Intronic
937526247 2:122773202-122773224 CTCCAGCAAGGGCACAAAACTGG + Intergenic
937562828 2:123245846-123245868 CTCCAGCAAGGGCACAAAACTGG + Intergenic
937914146 2:127090670-127090692 CCCCAGCCAGGGCACAGCTGTGG + Intronic
938367676 2:130747686-130747708 CTCCAGCCACTGTTCAACACAGG - Intergenic
938567984 2:132538071-132538093 CTCCAGCAAGGGCACAGAACTGG - Intronic
938904467 2:135825490-135825512 CTCCAGCCCTGGGACATCACCGG - Intronic
940400832 2:153245763-153245785 CTCCAGCAAGGGCACAAAACTGG + Intergenic
940979865 2:159989466-159989488 CTCCAGTTACTGCACAGCACAGG + Intronic
942581976 2:177429335-177429357 CTCCAGCAAGGGCAGAGAACTGG - Intronic
942856636 2:180556444-180556466 CTCCAGCGAGGGCACAGAACTGG + Intergenic
942989367 2:182181113-182181135 CTCCAGCAAGGACACAGGACTGG - Intronic
943074522 2:183178566-183178588 CTCCAGCAAGGGCACAAAACGGG - Intergenic
943630171 2:190242446-190242468 CTCCAGCAAGGGCACAAAACTGG - Intronic
944035625 2:195291135-195291157 CTCCAGCAAGGGCACAGAACAGG + Intergenic
944167828 2:196742297-196742319 CTCCAGCAAGGGCACAGAACTGG - Intronic
944439287 2:199726413-199726435 CTCCAGCAAGGGCACAGAACTGG - Intergenic
944539374 2:200741587-200741609 CTCCACCCAGAGCACAGCCCTGG + Intergenic
945024216 2:205605233-205605255 CTCCAGCAAGAGCACAGAACTGG - Intronic
945164441 2:206927515-206927537 CTCCAGCAAGGGCACAGAATAGG + Intergenic
945439617 2:209863861-209863883 CTCCATCAAGGGCACAGAACTGG - Intronic
945481447 2:210350565-210350587 CTCCAGCAAGGGCACAAAACTGG - Intergenic
945714227 2:213337337-213337359 CTCCAGCAAAGGCACAGAACTGG + Intronic
946470881 2:219959915-219959937 CTCCAGCCACGGAGCAGTCCTGG - Intergenic
946648838 2:221869230-221869252 CTCCAGCAAGGGCACAGATCTGG + Intergenic
947492246 2:230604760-230604782 CACCAGCCAGGGCACAAAACTGG + Intergenic
948697361 2:239738301-239738323 CCCCAGCCACAGCCCAGCCCCGG + Intergenic
948981158 2:241495555-241495577 CTGCAGGCACGACATAGCACAGG + Exonic
1168974969 20:1958027-1958049 TTCAGGCCACGGCACAGGACAGG + Intergenic
1169980726 20:11380651-11380673 CTCCACCAAGGGCACAGAACAGG + Intergenic
1170011587 20:11729119-11729141 CTCCAGCAAGGGCACAGAACTGG + Intergenic
1171397785 20:24849696-24849718 CTCCAGCAAGGGCACAGAATTGG - Intergenic
1171423069 20:25032021-25032043 CTGCAGCCCCGAGACAGCACTGG + Intronic
1173149497 20:40553873-40553895 CTCCAGCAAGGGCACAGAACTGG + Intergenic
1173259017 20:41416605-41416627 CTTCAGCAACGGCGCAGCATTGG - Exonic
1174040694 20:47697488-47697510 TTCCAGCCAAGGCAGAGCTCAGG - Intronic
1174949018 20:55023133-55023155 CTCCATCCATGGCCCAGCAAAGG + Intergenic
1175591808 20:60199598-60199620 CTCCAGCAAGGGCACAGAACTGG - Intergenic
1176636799 21:9252851-9252873 CTCCCGCCTCAGCACACCACTGG + Intergenic
1176687547 21:9864341-9864363 CTCCAGCCAGGGTTCAGAACAGG - Intergenic
1176987544 21:15455395-15455417 CTCCAGCGAGGGCATAGAACTGG - Intergenic
1177099291 21:16879929-16879951 CTCCAGCAAGGGCACAGAGCTGG + Intergenic
1177224131 21:18231831-18231853 CCCAAGCCACGGCACAGTAATGG + Intronic
1179022999 21:37656673-37656695 CTCCAGCCACCGTCCAGCTCAGG - Intronic
1179129720 21:38624173-38624195 ATCCAGCCTCGGCAAAGCCCTGG + Intronic
1179211079 21:39324937-39324959 CTCCAGCCCCTGGCCAGCACTGG - Intergenic
1179253280 21:39692266-39692288 CTCCATCCACGTCACTGCAAAGG + Intergenic
1179585168 21:42370119-42370141 CTCCTGCCAAGGCACAGGTCAGG - Intergenic
1180093755 21:45544920-45544942 CTCCAGCCAAGGCAGAGGACTGG - Intergenic
1180096465 21:45557527-45557549 CTCCAGCCACAGCCCTGCAGTGG + Intergenic
1180250245 21:46581472-46581494 CTCCAGCAAGGGCACAGAACTGG - Intergenic
1180975791 22:19847442-19847464 CCCCAGCCAAGGCACTGCATGGG + Exonic
1181050738 22:20237214-20237236 CTCCAGGCATGGCCCAGCAAGGG + Intergenic
1182195048 22:28507026-28507048 CTCCAGCAAGGGCACAGAACTGG + Intronic
1182870434 22:33641496-33641518 CTCCAGCAAGGGCACAAAACTGG + Intronic
1182938821 22:34254472-34254494 CTCCATCAAGGGCACAGAACTGG - Intergenic
1183182592 22:36270948-36270970 CTCCAGCAAGGGCACAAAACTGG - Intergenic
1183459543 22:37941556-37941578 CTGCAGCCTGGGGACAGCACTGG - Exonic
1183585925 22:38752848-38752870 CTCCAGCCGCTGCACAGTGCAGG - Intronic
1183606881 22:38871418-38871440 CCCCAGCCCCGGCACAGCACGGG - Intronic
1183676118 22:39299683-39299705 CTCACACCACTGCACAGCACTGG + Intergenic
1183719323 22:39553162-39553184 CTCCAGCCATGGCACAGGCCTGG + Intergenic
1184260010 22:43309473-43309495 CTCCAAGCAAGGCACAGCATAGG + Intronic
1184807538 22:46805134-46805156 CTCCAGCCACGGCCCAAGAGAGG - Intronic
1184809589 22:46822264-46822286 CTCCATCAAGGGCACAGAACTGG - Intronic
1184975328 22:48057683-48057705 CACCTGCCACTGCACAGCCCGGG - Intergenic
1185032247 22:48450257-48450279 CTCCAGGCTCCGCACATCACAGG - Intergenic
1185319924 22:50195972-50195994 GTCCAGCCAGGGCCCAGCACTGG + Intronic
949250311 3:1975786-1975808 CTCCAGCAAGTGCACAGAACTGG + Intergenic
949351619 3:3129071-3129093 CTCCACCTACGGTTCAGCACTGG - Exonic
950587533 3:13905169-13905191 ATCCAGCAAGGGCACAGAACTGG + Intergenic
950847272 3:16027110-16027132 CTCCAGCCACAGCCTAGCACAGG + Intergenic
951957656 3:28275117-28275139 CTCCAGCAAGGGCATAGAACTGG - Intronic
951996467 3:28735793-28735815 CTCCAGCAAGAGCACAGAACTGG - Intergenic
952333362 3:32384759-32384781 CTCCAGCCACGCCAAAGGACTGG + Intergenic
952503659 3:33988493-33988515 CTCCAGCAAGGGCACAGAACTGG - Intergenic
953286775 3:41617737-41617759 CTCCAGCAAGGGCACAAAACTGG + Intronic
953791280 3:45950004-45950026 CTCCATCCACATCACAGCCCAGG + Intronic
953896763 3:46809117-46809139 CACCAGCCAGAGCACAGCCCTGG + Intronic
954491410 3:50910245-50910267 CTCCAGCAAGAGCACAGAACTGG - Intronic
954529127 3:51303436-51303458 CTCCAGCAAGGGCAAAGAACTGG - Intronic
956157788 3:66317130-66317152 CTCCAGCAAGGGCACAGAACTGG - Intronic
957103939 3:75862283-75862305 CTCCCGCCCCAGCACACCACTGG - Intergenic
957584212 3:82113900-82113922 CTCTAGCAAGGGCACAGAACTGG - Intergenic
957629967 3:82706429-82706451 CTCCAGCAAGGGCACAGAACTGG - Intergenic
957690001 3:83555274-83555296 CTCCAGCAAGGGCACAGAACTGG - Intergenic
958481826 3:94653487-94653509 CTCCAGCAAGGGCACAGCACTGG - Intergenic
958515655 3:95112233-95112255 CTCCAACAAGGGCACAGAACTGG - Intergenic
958523792 3:95226203-95226225 CTCCAGCAAAGGCACAGAACTGG - Intergenic
958817324 3:98929774-98929796 CTCCAGGAAGGGCACAGAACTGG + Intergenic
959453889 3:106535165-106535187 CTCCAGCAAGGGCACAAAACTGG + Intergenic
959686066 3:109148011-109148033 CTCCATCCACCACATAGCACTGG + Intergenic
960565458 3:119126994-119127016 CTCCATCAAGGGCACAGAACTGG + Intronic
960579963 3:119268302-119268324 CTCCAGCAAGGGCACAAAACTGG + Intergenic
960680027 3:120238338-120238360 CTCCAGCAAGGGCACAGAACTGG - Intronic
961829407 3:129615808-129615830 TTCCAGGCAGGGCACAGCAAGGG + Intergenic
962064506 3:131964337-131964359 CTCCAGCAAGGGCACAAAACTGG + Intronic
962998843 3:140657047-140657069 CTCCAGCAAGGGCATAGAACTGG + Intergenic
963023594 3:140897219-140897241 CTGCAGCCACTGCAGAGAACTGG + Intergenic
963416143 3:144998450-144998472 CTCCAACAAGGGCACAGAACGGG - Intergenic
963481376 3:145879112-145879134 CTCCAGCAAAGGCACACAACTGG - Intergenic
963756122 3:149236324-149236346 CTCCAGAAAGGGCACAGAACTGG + Intergenic
964295038 3:155224690-155224712 CTCCAGCAGGGGCACAGAACTGG - Intergenic
964391133 3:156199844-156199866 CTCCAGCAAGGGCACAAAACTGG - Intronic
965342982 3:167512577-167512599 CTCCAGAAACGGCACAGAACTGG + Intronic
965621817 3:170650170-170650192 CTCCAGCGAGGGCACAAAACTGG - Intronic
966071502 3:175884757-175884779 CTCCAGCAAGGGCACAGAACTGG - Intergenic
966250384 3:177859465-177859487 CTCCATCAAAGGCACAGAACTGG - Intergenic
966390918 3:179451517-179451539 CTCCAGCCACGTCCCCGCCCCGG - Exonic
966573689 3:181476413-181476435 CTCCAGCAACGGCACAAAATTGG - Intergenic
1202750096 3_GL000221v1_random:152168-152190 CTCCCGCCTCAGCACACCACTGG - Intergenic
969720597 4:8891338-8891360 CCCCAGCGACGGGACAGCATTGG - Intergenic
970155226 4:13134430-13134452 CTCCATCAAGGGCACAGAACTGG + Intergenic
971516764 4:27496927-27496949 CTCCAGCAAGGGCACAGAAGTGG + Intergenic
971853819 4:32018323-32018345 CTCCATCCAGAGCAAAGCACAGG + Intergenic
972356797 4:38287008-38287030 CTGCAGGCACAGCACAGCTCAGG + Intergenic
972765746 4:42151542-42151564 ATCCCGACACGGCCCAGCACGGG + Intronic
973284693 4:48402747-48402769 CTCCGGCAAGGGCACAGAACTGG - Intronic
973321937 4:48818539-48818561 CTCCAGCAAGGGCACAAAACTGG + Intronic
973584789 4:52378692-52378714 CTCCAGCAAGGGCACAGAACTGG + Intergenic
973629231 4:52803105-52803127 CTCCAGCAAGGGCACAAAACTGG + Intergenic
974130398 4:57747746-57747768 CTCCAGCAAGGGCACAAAACTGG - Intergenic
974302189 4:60082402-60082424 CTCCAGCAAGGGCACAAAACTGG + Intergenic
974814556 4:66988465-66988487 CTCCAGCAAGGGCACAGAATGGG - Intergenic
974868030 4:67603914-67603936 CTCCAAGCCCAGCACAGCACAGG + Intronic
974913122 4:68147889-68147911 CTCCAGCAAGGGCATAGAACTGG - Intergenic
974946493 4:68535397-68535419 CTCCAGCAAGGGCACAAAACTGG - Intergenic
975479455 4:74860935-74860957 CTCCAGCAAGGGCACAAAACTGG + Intergenic
975998376 4:80341788-80341810 CTCCAGCAAGGGCACAGAATTGG + Intronic
976395563 4:84551150-84551172 CTCCAGCAAGGGCACAGAACTGG + Intergenic
976792902 4:88899748-88899770 CTCCAGCAAAGGCACAGAACTGG + Intronic
977039922 4:92002795-92002817 CTCCAGCAAGGGCACAGAACTGG + Intergenic
977476708 4:97519721-97519743 CTCTAGCCAGGACACAACACTGG + Intronic
977506801 4:97912284-97912306 CTCCAGCAAGGGCACAGAACTGG + Intronic
977508895 4:97937404-97937426 CTTCAGCAAGGGCACAGAACTGG - Intronic
977657149 4:99535758-99535780 CTCAAGCAAGGGCACAGAACTGG - Intronic
977678714 4:99775014-99775036 CTCCAGCAAGGGCACAGAACTGG + Intergenic
978328021 4:107580308-107580330 CTCCAGCAAGGGCACAGAACTGG + Intergenic
979576233 4:122294731-122294753 CTCCAGCAAGGGCGCAGGACTGG + Intronic
979742523 4:124168618-124168640 CTCCAGCAAGAGCACAGAACTGG + Intergenic
979819248 4:125150882-125150904 CTCCAGCAAGGGCACAAAACTGG - Intergenic
980022001 4:127721986-127722008 CTCTAGCAAGGGCACAGAACTGG - Exonic
980200715 4:129652624-129652646 CTCCAGCAAGGGCACAAAACTGG + Intergenic
980276014 4:130651491-130651513 CTCCAGCAAGGGCACAAAACTGG + Intergenic
980350896 4:131682156-131682178 CTCCAGCCAGGGTTCAGAACAGG - Intergenic
980404853 4:132343709-132343731 CTCCAGAAAGGGCACAGAACTGG - Intergenic
980512618 4:133813203-133813225 CTCCAGCAAGGGCACAGAAATGG + Intergenic
981237666 4:142436878-142436900 CTCCAACAAGGGCACAGAACTGG + Intronic
981273960 4:142875718-142875740 CTCCAGCAAGGGCACAGAACTGG + Intergenic
981746111 4:148053863-148053885 CTGCAGCTACAGCACAGCAAAGG - Intronic
982214501 4:153069022-153069044 CTCCAGCCACGTGGCAGCGCTGG + Intergenic
982372416 4:154647996-154648018 CTCCAGCAAGGGCACAGAACTGG + Intronic
982393753 4:154893075-154893097 CTCCAGCAAGGGCACAAAACTGG + Intergenic
982528348 4:156506721-156506743 TTCCAGCAAGGGCACAACACTGG + Intergenic
982859708 4:160433979-160434001 CTCCAGCAAGGGCACAGAACTGG - Intergenic
983169473 4:164520063-164520085 CTCCAGCAAGGGCACAGAACTGG - Intergenic
983315942 4:166133532-166133554 CTCCAGCCAGGGCACAGAACTGG - Intergenic
983403019 4:167289316-167289338 CTCCAGCAAGGGCACAGAACTGG - Intergenic
983632085 4:169859858-169859880 TTCCCCCCACGGAACAGCACGGG + Intergenic
983727056 4:170941378-170941400 CCCCATCAACGGCACAGAACTGG + Intergenic
983774789 4:171594053-171594075 CTCCAGCAAGGGCACAGAACTGG - Intergenic
983965467 4:173804244-173804266 CTCCACCCACGACCCAGCAAAGG + Intergenic
984050106 4:174855396-174855418 CTCCAGCCATGGCATAAAACTGG + Intronic
984854104 4:184177985-184178007 CTCCAGCAAGGGCACAGAACTGG + Intronic
1202751685 4_GL000008v2_random:11293-11315 CTCCCGCCTCAGCACACCACTGG + Intergenic
985694370 5:1331563-1331585 CTCCAGCGGCTGCACAGCTCAGG - Intronic
986011767 5:3723748-3723770 CTTCAGCAAAGGCACAGGACAGG - Intergenic
986140782 5:5027340-5027362 CTCCAGCAAGAGCACAGAACTGG + Intergenic
986358668 5:6953223-6953245 CTCCAGCAAGGGCACAAAACTGG + Intergenic
986753670 5:10813133-10813155 CTCCAGCAAGGGCACAGAACTGG + Intergenic
986996640 5:13614409-13614431 CTCCAGCAAGGGCACAAAACTGG + Intergenic
987634917 5:20526890-20526912 CTCCAGCAAGGGCACAGAACTGG + Intronic
987834582 5:23145449-23145471 CTCCATCAAGGGCACAGAACTGG - Intergenic
987988464 5:25180481-25180503 CTACAGCAAGGGCACAGAACTGG - Intergenic
988021582 5:25628055-25628077 CTCCAGCAAGGGCACAAAACTGG + Intergenic
988076446 5:26361589-26361611 CTCCAGCAAGGGCACAGAACTGG - Intergenic
989657354 5:43759398-43759420 CTCCAGCAAGGGCACAGAACTGG - Intergenic
989682494 5:44046102-44046124 CTCCAGCAAGGGCACATAACTGG - Intergenic
990230809 5:53711700-53711722 CTCCAGCAAGGGCACAGAACTGG - Intergenic
990231484 5:53717094-53717116 CTCCAGCAAGGGCACAAAACTGG + Intergenic
990704859 5:58516268-58516290 CCCCAGCAAGGGCACAGAACTGG + Intergenic
990793247 5:59507298-59507320 CTCCAGCCTGGGCAAAGCAGTGG + Intronic
991117360 5:62969956-62969978 CTCCAGCCATGACTCAGCAGAGG + Intergenic
992383716 5:76264459-76264481 CTCCAGCAAGGGCACAAAACTGG - Intronic
992571819 5:78066280-78066302 CTCCAGCAAGGGTACAGAACTGG + Intronic
993837533 5:92834347-92834369 CTCCAGCAAGGGCACAGAAATGG - Intergenic
994298918 5:98122498-98122520 CTCCAGCCAGGGCACAGAACTGG + Intergenic
994350807 5:98743421-98743443 CTCCAGCAAGGGCACAGAATTGG + Intergenic
994843041 5:104951066-104951088 CACCAGCAAGGGCACAGAACTGG - Intergenic
995052347 5:107720350-107720372 CTCCAGCAAGGGCACAGAACTGG + Intergenic
995258190 5:110071922-110071944 CTCCAGCAAAGACACAGAACTGG - Intergenic
995264040 5:110138099-110138121 CTCCAGCAAGGGCACAGAAATGG - Intergenic
995292265 5:110470227-110470249 CTACGGGCAGGGCACAGCACAGG - Intronic
995329607 5:110932823-110932845 CTCCAGCAAGGGCTCAGAACTGG - Intergenic
995578920 5:113573986-113574008 CTCTAGCAAGGGCACAGAACTGG - Intronic
995694940 5:114867886-114867908 CTCCAGCAAGGGCACAGAACTGG + Intergenic
996005963 5:118420663-118420685 CTCCAGCAAGGGGACAGAACTGG + Intergenic
996242637 5:121222047-121222069 CTCCAGCAATGGCACAAAACTGG + Intergenic
996463099 5:123770080-123770102 CTGCAGCAAGGGCACAGAACTGG - Intergenic
996527151 5:124491562-124491584 CTCCAGCAAGGGCACAGAACTGG - Intergenic
996829823 5:127727657-127727679 CTCCAGCAAGGGAACAGAACTGG + Intergenic
996965732 5:129305734-129305756 CTCCAGCAAGGGCACAGAACTGG - Intergenic
998007796 5:138668634-138668656 CACGAGCAAGGGCACAGCACAGG - Intronic
998277873 5:140775928-140775950 CTCCAGCAAGTGCACAGAACTGG - Intergenic
998755503 5:145375008-145375030 CTCCAGCAAGGGCACAGAACTGG - Intergenic
998976811 5:147658031-147658053 GTCCAGCAAGGGCACAGAACTGG - Intronic
1000523643 5:162328371-162328393 CTCCAGCAAGGGCGCAGAACTGG + Intergenic
1000749223 5:165074034-165074056 CTCCAGCAAGGGCACAGAACTGG - Intergenic
1000820067 5:165972678-165972700 CTCCAGCAAGGGTACAACACTGG - Intergenic
1001372491 5:171219918-171219940 CTCCAGCAAGGGCACAAAACTGG - Intronic
1002222263 5:177693016-177693038 CTGCAGCCACTGGACAGCGCAGG + Intergenic
1002650927 5:180693078-180693100 CTGCAGCCTCAGCACAGCCCTGG + Intergenic
1002967349 6:1979164-1979186 CTCCAGCAAGGGCTCAGAACTGG + Intronic
1003053238 6:2798312-2798334 CTCCATCCACGGCCCAGGAGAGG - Intergenic
1003248878 6:4406757-4406779 CTCCAGCAAGGGTACAGAACTGG + Intergenic
1003902441 6:10667755-10667777 CTCCAGCAAGGGCACAGAACTGG - Intergenic
1005120904 6:22388989-22389011 CTCCAGCAAGGGCACAGAACAGG - Intergenic
1005670416 6:28099840-28099862 CTCCAGTAAGGGCACAGAACTGG + Intergenic
1005778240 6:29161048-29161070 CTCCAGCAAGGGCACAAAACTGG - Intergenic
1006240999 6:32679096-32679118 CTCCAGCAATGACACAGAACTGG - Intergenic
1006447494 6:34087972-34087994 CTCCATTTACGGCACAGCACGGG + Intronic
1007133822 6:39501444-39501466 CTCCAGCAAGGGCTCAGAACTGG + Intronic
1008176086 6:48270025-48270047 CTCCAGCAAGGGCACAAAACTGG - Intergenic
1008468126 6:51853943-51853965 CTCCATCAAGGGCACAGAACTGG - Intronic
1008819236 6:55610148-55610170 CTCCAGCTAGGGTACAGAACTGG + Intergenic
1009570309 6:65375503-65375525 CTCCAGCAAGGGCACAAAACTGG + Intronic
1009707015 6:67265596-67265618 CTCCAGCAAGGGCATAGAACTGG - Intergenic
1009916664 6:70005174-70005196 CTCCAGCAAGGGTACAGAACTGG - Intronic
1010282863 6:74040841-74040863 CTCCAGCAAGGACACAGAACTGG - Intergenic
1010331427 6:74627437-74627459 CTCCATCAAGGGCACAGAACTGG + Intergenic
1010411826 6:75569429-75569451 CTCCAGCAACGGCGCAGAACTGG + Intergenic
1010668190 6:78654844-78654866 CTCCAGCAAGGGCACAAAACTGG - Intergenic
1010945748 6:81971035-81971057 CTCCACCAAGGGCACAGAACTGG + Intergenic
1011321222 6:86095382-86095404 CTCCAGCAAAGGCACAAAACTGG + Intergenic
1011377525 6:86706138-86706160 CTGCAGCAAGGGCACAGAACTGG - Intergenic
1012075149 6:94673346-94673368 CTCCAGCAAAGGCATAGAACTGG + Intergenic
1012434710 6:99203392-99203414 CTGCAGCAAGGGCACAGAACTGG - Intergenic
1012741046 6:103017549-103017571 CTCTAGCAAGGGCACAGAACTGG - Intergenic
1012878146 6:104753871-104753893 CTCCAGCAAAAGCACAGAACTGG + Intronic
1012922281 6:105233024-105233046 CTCCAGCAAGGGCACAAAACTGG - Intergenic
1013025167 6:106263958-106263980 CTCCAGCAAGGGCACAAAACTGG + Intronic
1013232132 6:108168582-108168604 CTCCAGCCCCGGCTCAGGTCGGG + Intronic
1013379797 6:109557009-109557031 CTCCACCAAGGGCACAGAACTGG - Intronic
1013920353 6:115395949-115395971 CTCCAGCAAGGGCAAAGAACTGG - Intergenic
1013932098 6:115546092-115546114 CTTCAGCAAGGGCACAGAACTGG + Intergenic
1014064779 6:117111662-117111684 CTCCAGGAAGGGCACAGAACTGG + Intergenic
1014223416 6:118822151-118822173 CTCCAGCAAGGGCACAAAACTGG - Intronic
1014422431 6:121261746-121261768 CTCCAGCAAGGGCACAGAACTGG + Intronic
1014464385 6:121738046-121738068 CTCCAGCAAGGGTACAGAACGGG - Intergenic
1014958637 6:127653803-127653825 CTCCAGCCCCTGCACAGGTCTGG - Intergenic
1015136887 6:129882494-129882516 CTCCAGCAACGGTGCAGAACTGG - Intergenic
1015320337 6:131865962-131865984 CTCCAGCCTGGGCACAGAGCGGG + Intronic
1015368464 6:132424567-132424589 CCCCAGCAAGGGCACAGAACTGG - Intergenic
1015587494 6:134790346-134790368 CCCCAGCAAGGGCACAGAACTGG + Intergenic
1016790636 6:148064055-148064077 CTCCAGCAAAGGCAGAGAACTGG - Intergenic
1016847839 6:148586927-148586949 CTCCAGCAAGGGCTCAGAACTGG - Intergenic
1017766090 6:157608558-157608580 CTCCTGCCCGGGCTCAGCACAGG - Intronic
1018578375 6:165283942-165283964 CTCCAGCAAGGGCATAGAACTGG + Intronic
1018741507 6:166732723-166732745 GTGCACCCAGGGCACAGCACAGG + Intronic
1018805931 6:167259406-167259428 CTCCAGCAAGGGCACAAAACTGG + Intergenic
1019113404 6:169737342-169737364 CTCCATCAAGGGCACAGAACTGG - Intergenic
1019203537 6:170340519-170340541 CTCCAGCAAGGGCACAAAACTGG - Intronic
1019204791 6:170350906-170350928 CTCCAGCAAGGACACAGAACTGG + Intronic
1019402011 7:860531-860553 CTCCACACACGGCACTGCCCAGG - Intronic
1019700799 7:2474348-2474370 CTCTTGCCACGGCTCAGCCCTGG - Intergenic
1020067274 7:5198190-5198212 GCTCAGCCATGGCACAGCACAGG + Intronic
1020162193 7:5781326-5781348 CTCCAGCCTCGCCACCGCACCGG + Intronic
1020557848 7:9692070-9692092 CTCCAGCAAGGGCACAGAACTGG + Intergenic
1020599054 7:10248949-10248971 CTCCAGCAAGGGCACAGAACTGG + Intergenic
1021916905 7:25443350-25443372 CTCTAGCAAGGGCACAGAACTGG - Intergenic
1023196084 7:37641317-37641339 CTCCAGCAATGGCAAAGAACTGG - Intergenic
1023207305 7:37764385-37764407 CTCCAGCAAGGGCACAGAACTGG + Intronic
1023363575 7:39440706-39440728 CTCCAACAAGGGCACAGAACTGG - Intronic
1023666549 7:42528367-42528389 CTCCAGCAAGGGCACAGAACTGG + Intergenic
1023894431 7:44419963-44419985 CTCCAGCAAGGGCACAAAACTGG + Intronic
1024590103 7:50873474-50873496 CTCCGGCAAGGGCACAGAACTGG + Intergenic
1024795206 7:53012024-53012046 CTCCAGCAAGGGCAGAGAACTGG - Intergenic
1024990435 7:55231115-55231137 CTCCAGGAAGGGCACAGAACTGG - Intronic
1025041822 7:55652111-55652133 CTCCAACAAGGGCACAGAACTGG + Intergenic
1028027777 7:85867552-85867574 CTCCAGCAAGGGCACAGAACTGG + Intergenic
1028459306 7:91072641-91072663 CTCCAGCAATGGCGCAGAACTGG + Intronic
1028609143 7:92689396-92689418 CTCCAGCCATGTCCCAGCAAAGG + Intronic
1028626918 7:92888372-92888394 CTCCAGCAAGGGCACAGAACTGG - Intergenic
1028644275 7:93077475-93077497 CTCCAGCAGGGGCACAGAACTGG + Intergenic
1028779400 7:94719094-94719116 CTCCAGCAAGGGCACAGAACTGG - Intergenic
1030256651 7:107516971-107516993 CTCCAGCAAGGGCGCAGAACTGG + Intronic
1030391090 7:108930043-108930065 CTCCAGCAAGGGCACAGAACTGG - Intergenic
1032776947 7:135123010-135123032 CTCCAGCAATGGCACAGAATTGG + Intronic
1032809245 7:135393941-135393963 CTCCCGCCACAGCACAACACAGG - Exonic
1032974056 7:137201231-137201253 CTCCAGAAAGGACACAGCACTGG + Intergenic
1033052257 7:138015983-138016005 TTCCAGCCACTACACGGCACAGG - Intronic
1033617785 7:143033137-143033159 CTCCAGCAAGGGCACAAAACTGG + Intergenic
1033791627 7:144797598-144797620 CTCCAGCAAGGGCACAGAACTGG + Intronic
1033879535 7:145863337-145863359 CTCCAGCAAGGGCACAGAACTGG + Intergenic
1033989530 7:147266104-147266126 CTCCAGCAAGGACACAGAACTGG + Intronic
1034107349 7:148501758-148501780 CTCCAGCCTCCTCACAGAACTGG - Intergenic
1034457699 7:151180198-151180220 CTCCAGACACGACACAGCATGGG + Intronic
1034559408 7:151870623-151870645 CTCCAGCCCCGGGGCAGGACGGG + Intronic
1034671446 7:152861974-152861996 CTGCGGCCACGGCACAGTTCCGG + Intergenic
1035274632 7:157740420-157740442 CTCCATCCACGGCAAGGCAGGGG + Intronic
1035491815 7:159285642-159285664 CTCCAGCAAGGGCAAAGAACTGG + Intergenic
1037421770 8:18709959-18709981 CTCCAGCAAGGGCACAGAACTGG + Intronic
1038341493 8:26689682-26689704 TTCCAGCCAAGGTACAGTACAGG + Intergenic
1039265279 8:35816812-35816834 CTCCAGCAAGGGCGCAGAACTGG + Intergenic
1039685794 8:39801039-39801061 CTCCATCAAGGGCACAGAACTGG - Intronic
1039706754 8:40015451-40015473 CTGCAGCCAAGGCAAAGCATGGG + Exonic
1039809251 8:41030399-41030421 CTGCAGCCACTGCACCCCACCGG - Intergenic
1040029884 8:42814563-42814585 GGGCAGCCACAGCACAGCACTGG + Intergenic
1041341169 8:56847358-56847380 CTCCAGCAAGGGCACAGAATTGG + Intergenic
1042058750 8:64794328-64794350 CTTCAGCCACTGCCCACCACTGG + Intronic
1042622583 8:70723330-70723352 CTCCAGCAAGGGCACAAAACAGG - Intronic
1042644232 8:70968463-70968485 CTCCAGCAAGGGCACAGAACTGG - Intergenic
1042759791 8:72257954-72257976 CTCCAGCAAGGGCACAGAACTGG + Intergenic
1043025074 8:75056801-75056823 CTCCAGCAAGGGCACAAAACTGG + Intergenic
1043036549 8:75207352-75207374 CTCCAGCAAGGGCACAAAACTGG - Intergenic
1043092683 8:75925004-75925026 CTTCAGCAAGGGCACAGAACTGG + Intergenic
1043253532 8:78105617-78105639 CTCCAGCAAGGGCACAAAACTGG - Intergenic
1043363079 8:79498847-79498869 CTTCAGCAAGGGCACAGAACTGG - Intergenic
1043495915 8:80799780-80799802 CTCCAGCAAAGGCAAAGAACTGG + Intronic
1044113412 8:88303912-88303934 CTCCAGCAAAGGCGCAGAACTGG + Intronic
1044117122 8:88349561-88349583 CTCCAGCAAGGACACAGAACTGG - Intergenic
1044221975 8:89679477-89679499 CTCCAGCAAGGGCACAAAACTGG + Intergenic
1044315718 8:90748527-90748549 CTCCAGCAAGGGCACAGAACTGG - Intronic
1044405386 8:91819848-91819870 CTCCAGCAAGGGCACAAAACTGG + Intergenic
1044505113 8:93007494-93007516 TTCCAGCAAGGGCACAGAACTGG + Intronic
1044873269 8:96641198-96641220 CCCCAGCAAGGGCACAGAACTGG - Intergenic
1046338776 8:112825330-112825352 CTCCAGCAAGGGCACAGAACTGG - Intronic
1046986982 8:120398618-120398640 CTCCAGCAAGGGCACAGAACTGG + Intronic
1047121436 8:121909045-121909067 CTCCAGCAAGGGCACAAAACTGG + Intergenic
1047152040 8:122274483-122274505 CTCCAGCAAGGGTACAGAACTGG + Intergenic
1048179961 8:132185396-132185418 CTGTAGCCACAGGACAGCACTGG - Intronic
1048587578 8:135789868-135789890 CTCCAGCAAGGGCACAGAACTGG - Intergenic
1049093650 8:140535180-140535202 CTCCAGCCACACCACACCCCTGG + Intronic
1049438767 8:142599705-142599727 CGCCAGCCACTGCACAGGGCGGG + Intergenic
1049803860 8:144530230-144530252 GTGCAGCCAGGGCACAGCAGCGG - Exonic
1050398256 9:5222985-5223007 CTGCAGCAAGGGCACAGAACTGG + Intergenic
1050630228 9:7550330-7550352 CTCCAGCAAGGACACAGAACTGG + Intergenic
1051703887 9:19856309-19856331 CTCCAACAAAGGCACAGAACTGG - Intergenic
1052115624 9:24645850-24645872 CTCCAGCAAGGGCACAGAACAGG - Intergenic
1052381092 9:27771846-27771868 GCCCAGCCACGTCACAGAACTGG - Intergenic
1052387019 9:27834877-27834899 CTCCAGCAAGGGTACAGAACTGG - Intergenic
1053678837 9:40465599-40465621 CTCCAGCAAGGGCACAGAACTGG + Intergenic
1053781812 9:41617559-41617581 CTCCAGCCAGGGTTCAGAACAGG + Intergenic
1053928822 9:43093952-43093974 CTCCAGCAAGGGCACAGAACTGG + Intergenic
1054169763 9:61827713-61827735 CTCCAGCCAGGGTTCAGAACAGG + Intergenic
1054284886 9:63159343-63159365 CTCCAGCAAGGGCACAGAACTGG - Intergenic
1054291915 9:63301137-63301159 CTCCAGCAAGGGCACAGAACTGG + Intergenic
1054389934 9:64605680-64605702 CTCCAGCAAGGGCACAGAACTGG + Intergenic
1054505781 9:65910696-65910718 CTCCAGCAAGGGCACAGAACTGG - Intergenic
1054667775 9:67753102-67753124 CTCCAGCCAGGGTTCAGAACAGG - Intergenic
1054884794 9:70184904-70184926 CTCCAGCAAGGGCACAAAACTGG - Intronic
1055343200 9:75307983-75308005 CTCCAGCAAGGACACAGAACTGG - Intergenic
1055509675 9:76984071-76984093 CTCTAGCTAGGGCACAGAACTGG - Intergenic
1055823766 9:80300302-80300324 CTCCAGCAAGGGCACAAAACTGG - Intergenic
1056015110 9:82377059-82377081 CTCCAGCAAGGGCACAGAACTGG + Intergenic
1056095769 9:83251482-83251504 CTCTAGCAAGGGCACAGAACTGG + Intronic
1056195341 9:84223496-84223518 CGCCAGCCAAGTCACAGCATTGG - Intergenic
1057216245 9:93230424-93230446 CTCCTCCCAGGGCACAGCTCAGG + Intronic
1058530242 9:105899440-105899462 CTCCAGCAACTGCACAGAACTGG - Intergenic
1059509877 9:114835451-114835473 CTCCAGCAAGAGCACAGAACTGG - Intergenic
1059596412 9:115724943-115724965 CTCCAGCAAGGGCTCAGAACTGG + Intergenic
1060340251 9:122768702-122768724 CTTCAGCAAGGGCACAGAACTGG + Intergenic
1061303215 9:129718220-129718242 GTCCAGCCAAGGCCCAGCAGGGG - Intronic
1062022313 9:134325496-134325518 CTCCTGCCCCGGGACAGCTCGGG - Intronic
1062370808 9:136237634-136237656 CTCCAGGTATGGCACAGGACGGG - Intronic
1062709245 9:137964721-137964743 CTCCAGCAAGGGCTCAGAACTGG - Intronic
1203718740 Un_KI270742v1:182258-182280 CTCCCGCCTCAGCACACCACTGG - Intergenic
1203652968 Un_KI270751v1:145932-145954 CTCCCGCCCCAGCACACCACTGG - Intergenic
1186431062 X:9504415-9504437 CTCCATCAAGGGCACAGAACTGG + Intronic
1186585289 X:10867017-10867039 CTCAAGCCAAGGCCTAGCACTGG - Intergenic
1186758559 X:12699491-12699513 GTGCACGCACGGCACAGCACCGG + Intronic
1186964320 X:14771660-14771682 CTCCAGCAATGGCACAAAACTGG - Intergenic
1187605323 X:20875714-20875736 CTCCAGCAAAGGGACAGAACAGG + Intergenic
1187646253 X:21349723-21349745 CTCCAGCAAGGGCACAGAACTGG + Intergenic
1187818273 X:23256698-23256720 CTCCAGCAAGGGCACAGAACTGG + Intergenic
1188669907 X:32869366-32869388 CTCCAGCAAGGGCACAGAAGTGG + Intronic
1188744717 X:33828805-33828827 TTCCAGCAAGGGCACAGAACTGG - Intergenic
1188860740 X:35252252-35252274 CTCCAGCAAGGGCACAGAACTGG + Intergenic
1189260685 X:39676805-39676827 ATTCAGACAGGGCACAGCACGGG + Intergenic
1189861305 X:45275498-45275520 CTCCAGCAAGGGCACAGAATTGG - Intergenic
1189940026 X:46112174-46112196 CTCAAGCAAGGGCACAGAACTGG - Intergenic
1190803236 X:53812474-53812496 CTCCAGCAAGGGCTCAGAACTGG - Intergenic
1190943834 X:55072080-55072102 CTCCAGCAAGGGCACAAAACTGG - Intergenic
1190946008 X:55094934-55094956 CTCCAGCAAGGGCACAAAACCGG - Intronic
1191037588 X:56043827-56043849 CTCCAGCAAGGGCACAAAACTGG - Intergenic
1191093812 X:56654061-56654083 CTGCAGCAAGGGCACAGAACTGG - Intergenic
1191099490 X:56710526-56710548 CTCCAGCAAGGGCACAGAACTGG - Intergenic
1191174033 X:57481267-57481289 CTCCAGCAAGGGCACAAAACTGG - Intronic
1191225071 X:58034377-58034399 CTCCAGCAAGGGCACAGAACTGG - Intergenic
1192277365 X:69647714-69647736 CTCCAGCAAAGGCACAGAACTGG - Intronic
1192718508 X:73668385-73668407 CTCCAGCAAGGGCTCAGAACTGG - Intronic
1192867212 X:75147511-75147533 CTCCAGCCATGTCACTGCAAAGG - Intronic
1192944266 X:75949015-75949037 CTCCAGCAAGGGCACAGAACTGG - Intergenic
1192960761 X:76127956-76127978 CTCTAGCAAGGGCACAGAACTGG + Intergenic
1193065516 X:77255144-77255166 CTCCAGCAAGGGCACAAAACTGG + Intergenic
1193094241 X:77528777-77528799 CTCCAGCAAGAGCACAGAACTGG + Intronic
1193158866 X:78205124-78205146 CTCCATCAAGGGCACAGAACTGG + Intergenic
1193164208 X:78263370-78263392 CCCCAGCAAGGGCACAGAACTGG - Intergenic
1193190231 X:78562747-78562769 CTCCAGCAAGGGCACAGAACAGG - Intergenic
1193365046 X:80622435-80622457 CTCCAGCAAAGGCACAGAACTGG - Intergenic
1193514517 X:82446709-82446731 CTCCAGCAAGGGCACAAAACTGG + Intergenic
1193533519 X:82685854-82685876 CTCCAGCAAAGGCACATAACTGG - Intergenic
1193571793 X:83152783-83152805 CTCCAGCAAGGGCACAAAACTGG + Intergenic
1193687283 X:84592570-84592592 CTCCAGCAAGGGCACAGAACAGG + Intergenic
1193909054 X:87280067-87280089 CTCCAGCAAGGGCAGAGAACTGG - Intergenic
1194193649 X:90866090-90866112 CTCCAGCAAGGGCACAGAACTGG + Intergenic
1194263877 X:91732817-91732839 CTCCAGCAAGGGCACAGAACTGG - Intergenic
1194281256 X:91957281-91957303 CTCCAGCAAGGGCACAGAACTGG - Intronic
1194315156 X:92368521-92368543 CTCCAGCAAGGGCACAAAACTGG - Intronic
1194405828 X:93494578-93494600 CTCCAGCAAGGGCACAAAACTGG + Intergenic
1194444842 X:93975198-93975220 CTCCAGCAAGGGCACAGAACTGG - Intergenic
1194489797 X:94531511-94531533 CTCCATCAAGGGCACAGAACTGG + Intergenic
1194596837 X:95868743-95868765 CTCCATCAAGGGCACAGAACTGG + Intergenic
1194623149 X:96197403-96197425 CTCCAGCAAGGGCATAGAACTGG + Intergenic
1194708259 X:97201282-97201304 CTCCAGCCAGGGCACAAAACTGG + Intronic
1195127307 X:101821563-101821585 CTCCAGCAAGGGCACAAAACTGG - Intergenic
1195140230 X:101951314-101951336 CTCCAGCAAGGGCACAAAACTGG + Intergenic
1195212991 X:102668867-102668889 CTCCAGCAAGTGCACAGAACTGG - Intergenic
1195469165 X:105213092-105213114 CTCCAGCAAGGGCACAAAACTGG + Intronic
1195686243 X:107589101-107589123 TTCCAGCAAGGGCACAGAACTGG - Intronic
1195820747 X:108943425-108943447 CTCCAGCAAGGGCACAAAACTGG - Intergenic
1196168085 X:112556518-112556540 CTCCAGCAAGGGCACAGAACTGG + Intergenic
1196229193 X:113202167-113202189 CTCCAGCAAGAGCACAGAACTGG - Intergenic
1196381911 X:115099559-115099581 CTCCAGCAAGGGCACAGAACTGG + Intergenic
1196517146 X:116627781-116627803 CTCCATCAAGGGCACAGAACTGG - Intergenic
1196555747 X:117083163-117083185 CTCCAGCAAGGGCACAGAACTGG - Intergenic
1196559025 X:117123787-117123809 CTCCAGTGAGGGCACAGAACTGG + Intergenic
1197029983 X:121802195-121802217 CTCCAGCAAGGGCGCAGAACTGG - Intergenic
1197356841 X:125445578-125445600 CTCCAGCAAGGGCACAGAACTGG + Intergenic
1197413711 X:126149947-126149969 CTCCAGCAAGGGCACAGAACTGG - Intergenic
1197455334 X:126671415-126671437 CTCCAGCTAAGGCACAGAACTGG + Intergenic
1197602020 X:128542642-128542664 CTCCATCGATGGCACAGAACTGG - Intergenic
1198062725 X:133062843-133062865 CTCCAGCAAGGGCACAAAACTGG + Intronic
1198687204 X:139238969-139238991 CTCCAGCCAGGGCACAGAAGTGG + Intergenic
1199401746 X:147406388-147406410 CTCCAGCAAGGGCACAAAACTGG + Intergenic
1199564325 X:149198695-149198717 CTCCAGCAAGGGCACAGAACTGG - Intergenic
1199589158 X:149450562-149450584 CTCCAGCAAGGGCTCAGGACTGG - Intergenic
1200321625 X:155196094-155196116 CTCCAGCAAGGGCACAGAACTGG - Intergenic
1200344756 X:155436708-155436730 CTCCAGCAAGGGCTCAGAACTGG + Intergenic
1200365284 X:155656621-155656643 CTCCAGCAAGGGCACAAAACTGG - Intronic
1200540259 Y:4448472-4448494 CTCCAGCAAGGGCACAGAACTGG + Intergenic
1200598846 Y:5181945-5181967 CTCCAGCAAGGGCACAGAACTGG - Intronic
1200604461 Y:5245711-5245733 TTCCAGCAAGGGCACAGAACTGG + Intronic
1200731890 Y:6751936-6751958 CTCCAGCAAGGGCACAGAAATGG - Intergenic
1201172898 Y:11287093-11287115 CTCCCGCCTCAGCACACCACTGG - Intergenic
1201376843 Y:13331551-13331573 CTCCAGCAAGGGCACAGAACTGG + Intronic
1201946507 Y:19515907-19515929 CTCCAGCAAAGGCACAAAACAGG + Intergenic