ID: 1102281819

View in Genome Browser
Species Human (GRCh38)
Location 12:111624570-111624592
Sequence CCTAAAACTCATTTCGGGCC GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 11 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1102281819_1102281827 7 Left 1102281819 12:111624570-111624592 CCCGGCCCGAAATGAGTTTTAGG No data
Right 1102281827 12:111624600-111624622 ATTCAAGGTGTTGGCCTGGCTGG No data
1102281819_1102281828 18 Left 1102281819 12:111624570-111624592 CCCGGCCCGAAATGAGTTTTAGG No data
Right 1102281828 12:111624611-111624633 TGGCCTGGCTGGTGTCTTCTCGG No data
1102281819_1102281833 27 Left 1102281819 12:111624570-111624592 CCCGGCCCGAAATGAGTTTTAGG No data
Right 1102281833 12:111624620-111624642 TGGTGTCTTCTCGGGGGTGCAGG No data
1102281819_1102281834 28 Left 1102281819 12:111624570-111624592 CCCGGCCCGAAATGAGTTTTAGG No data
Right 1102281834 12:111624621-111624643 GGTGTCTTCTCGGGGGTGCAGGG No data
1102281819_1102281830 20 Left 1102281819 12:111624570-111624592 CCCGGCCCGAAATGAGTTTTAGG No data
Right 1102281830 12:111624613-111624635 GCCTGGCTGGTGTCTTCTCGGGG No data
1102281819_1102281835 29 Left 1102281819 12:111624570-111624592 CCCGGCCCGAAATGAGTTTTAGG No data
Right 1102281835 12:111624622-111624644 GTGTCTTCTCGGGGGTGCAGGGG No data
1102281819_1102281826 3 Left 1102281819 12:111624570-111624592 CCCGGCCCGAAATGAGTTTTAGG No data
Right 1102281826 12:111624596-111624618 TTAAATTCAAGGTGTTGGCCTGG No data
1102281819_1102281824 -8 Left 1102281819 12:111624570-111624592 CCCGGCCCGAAATGAGTTTTAGG No data
Right 1102281824 12:111624585-111624607 GTTTTAGGAAGTTAAATTCAAGG No data
1102281819_1102281829 19 Left 1102281819 12:111624570-111624592 CCCGGCCCGAAATGAGTTTTAGG No data
Right 1102281829 12:111624612-111624634 GGCCTGGCTGGTGTCTTCTCGGG No data
1102281819_1102281832 21 Left 1102281819 12:111624570-111624592 CCCGGCCCGAAATGAGTTTTAGG No data
Right 1102281832 12:111624614-111624636 CCTGGCTGGTGTCTTCTCGGGGG No data
1102281819_1102281825 -2 Left 1102281819 12:111624570-111624592 CCCGGCCCGAAATGAGTTTTAGG No data
Right 1102281825 12:111624591-111624613 GGAAGTTAAATTCAAGGTGTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1102281819 Original CRISPR CCTAAAACTCATTTCGGGCC GGG (reversed) Intergenic
No off target data available for this crispr