ID: 1102281833

View in Genome Browser
Species Human (GRCh38)
Location 12:111624620-111624642
Sequence TGGTGTCTTCTCGGGGGTGC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1102281823_1102281833 21 Left 1102281823 12:111624576-111624598 CCGAAATGAGTTTTAGGAAGTTA No data
Right 1102281833 12:111624620-111624642 TGGTGTCTTCTCGGGGGTGCAGG No data
1102281819_1102281833 27 Left 1102281819 12:111624570-111624592 CCCGGCCCGAAATGAGTTTTAGG No data
Right 1102281833 12:111624620-111624642 TGGTGTCTTCTCGGGGGTGCAGG No data
1102281821_1102281833 26 Left 1102281821 12:111624571-111624593 CCGGCCCGAAATGAGTTTTAGGA No data
Right 1102281833 12:111624620-111624642 TGGTGTCTTCTCGGGGGTGCAGG No data
1102281822_1102281833 22 Left 1102281822 12:111624575-111624597 CCCGAAATGAGTTTTAGGAAGTT No data
Right 1102281833 12:111624620-111624642 TGGTGTCTTCTCGGGGGTGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1102281833 Original CRISPR TGGTGTCTTCTCGGGGGTGC AGG Intergenic
No off target data available for this crispr