ID: 1102283270

View in Genome Browser
Species Human (GRCh38)
Location 12:111635034-111635056
Sequence CAAAATAAGAAAAAGTTAGC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1102283263_1102283270 8 Left 1102283263 12:111635003-111635025 CCAGATCAGCCTGGGCAACATAG 0: 49
1: 679
2: 2521
3: 6580
4: 7540
Right 1102283270 12:111635034-111635056 CAAAATAAGAAAAAGTTAGCTGG No data
1102283265_1102283270 -1 Left 1102283265 12:111635012-111635034 CCTGGGCAACATAGGAGACCCCC No data
Right 1102283270 12:111635034-111635056 CAAAATAAGAAAAAGTTAGCTGG No data
1102283258_1102283270 27 Left 1102283258 12:111634984-111635006 CCACTTGAGCCCAGGAGTTCCAG 0: 33
1: 424
2: 1516
3: 2870
4: 4228
Right 1102283270 12:111635034-111635056 CAAAATAAGAAAAAGTTAGCTGG No data
1102283260_1102283270 17 Left 1102283260 12:111634994-111635016 CCAGGAGTTCCAGATCAGCCTGG 0: 139
1: 3788
2: 36285
3: 66516
4: 59721
Right 1102283270 12:111635034-111635056 CAAAATAAGAAAAAGTTAGCTGG No data
1102283259_1102283270 18 Left 1102283259 12:111634993-111635015 CCCAGGAGTTCCAGATCAGCCTG 0: 72
1: 2020
2: 17718
3: 34602
4: 31305
Right 1102283270 12:111635034-111635056 CAAAATAAGAAAAAGTTAGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1102283270 Original CRISPR CAAAATAAGAAAAAGTTAGC TGG Intergenic
No off target data available for this crispr