ID: 1102285886

View in Genome Browser
Species Human (GRCh38)
Location 12:111656174-111656196
Sequence CTCGACATCCACCATGTGCC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 254
Summary {0: 1, 1: 0, 2: 2, 3: 29, 4: 222}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1102285886 Original CRISPR CTCGACATCCACCATGTGCC AGG (reversed) Intronic
902687723 1:18089741-18089763 CTGGGCACCCACCATGTGTCCGG - Intergenic
903690933 1:25173118-25173140 CTGGGCACTCACCATGTGCCAGG + Intergenic
904284196 1:29443540-29443562 CTCGACAACCACCTCCTGCCTGG - Intergenic
904616278 1:31751904-31751926 TTAGGCATCTACCATGTGCCAGG + Intronic
905370636 1:37480930-37480952 CTGAGCATCTACCATGTGCCAGG - Intronic
905785234 1:40750430-40750452 CTGAACACCCACAATGTGCCGGG + Intronic
905878481 1:41448481-41448503 CTCTACAACCACACTGTGCCTGG - Intergenic
906933137 1:50189013-50189035 CTAAACATCTACTATGTGCCAGG - Intronic
907293239 1:53431398-53431420 GTCAATATCCACCATGTGCTAGG - Intergenic
907396302 1:54192557-54192579 CTGAGCATCTACCATGTGCCAGG + Intronic
907525303 1:55050435-55050457 ATAGGCATCTACCATGTGCCCGG - Intronic
907862397 1:58366108-58366130 CTTGCCATCCACCAAGTGGCTGG - Intronic
907944873 1:59126455-59126477 CTCAATATCTACCATATGCCAGG + Intergenic
909470589 1:76023472-76023494 CTGAACATCTACTATGTGCCAGG - Intergenic
909893630 1:81037898-81037920 CTCAACATCTACTATGTGCTGGG - Intergenic
911226684 1:95314891-95314913 TTAAACATCTACCATGTGCCAGG + Intergenic
912698150 1:111856573-111856595 CTCAGGATCCACCATGTGCAAGG - Intronic
912874120 1:113339296-113339318 CTTGTCATCTATCATGTGCCAGG - Intergenic
915942647 1:160128732-160128754 CTCCACGTCCACCATCTGCTCGG + Exonic
918394235 1:184097571-184097593 CTGAACACTCACCATGTGCCAGG + Intergenic
920536128 1:206737618-206737640 CAGGACATACACCAAGTGCCTGG - Intergenic
921621193 1:217328299-217328321 CTCAACATCTACTATGTTCCAGG + Intergenic
921826522 1:219678200-219678222 CTCGCCATCCACTATGGCCCAGG - Intergenic
921891402 1:220357641-220357663 CTGGATGTCTACCATGTGCCAGG - Intergenic
922980455 1:229821782-229821804 CTGAACATCTATCATGTGCCAGG - Intergenic
923101008 1:230817518-230817540 CTCGTCTTCCACCATTTGCCAGG + Intergenic
1063428308 10:5966466-5966488 CTGTACATCCTCCACGTGCCTGG - Intronic
1065664273 10:28041109-28041131 CTATACATCCAGCCTGTGCCGGG - Intergenic
1066544738 10:36487553-36487575 CTGAACATCCACCTTGTGCCAGG + Intergenic
1066657898 10:37712280-37712302 CTCGGCCTCCACCGTGGGCCTGG + Intergenic
1067141231 10:43658832-43658854 TTCGACACCCCCCATGAGCCTGG - Intergenic
1069948941 10:72006353-72006375 CTGGACACCAACTATGTGCCAGG - Intronic
1071683098 10:87727369-87727391 CCCTCCGTCCACCATGTGCCAGG - Exonic
1072473724 10:95738105-95738127 CTGGACACCTACCATATGCCAGG - Intronic
1073204964 10:101763994-101764016 CTGAACACCCACCATGTGCTGGG + Intergenic
1075236621 10:120736627-120736649 CTCCACACCTGCCATGTGCCGGG - Intergenic
1075277994 10:121112749-121112771 CTGGACATCCATAACGTGCCAGG + Intergenic
1077037411 11:502153-502175 CTTCACCTCCACCATGAGCCTGG - Exonic
1080429858 11:32188433-32188455 CTCGGCACCTACTATGTGCCAGG + Intergenic
1081638118 11:44734464-44734486 CACGACACCTACTATGTGCCAGG - Intronic
1082764377 11:57155599-57155621 CTGGACACTCACTATGTGCCAGG - Intergenic
1083342739 11:61968646-61968668 ATTCACATCCACCCTGTGCCTGG - Intergenic
1085524966 11:77158848-77158870 TTGGACACCCACTATGTGCCAGG + Intronic
1089481043 11:118805315-118805337 CTGGACATCCACTGTGTTCCAGG + Intergenic
1089676282 11:120092169-120092191 ATTGACACCCAGCATGTGCCAGG + Intergenic
1090424294 11:126596271-126596293 CTCAACATCTACCATATGCCAGG - Intronic
1090949790 11:131463510-131463532 CTAAATATTCACCATGTGCCTGG - Intronic
1093113380 12:15180301-15180323 AGCCACATCCACTATGTGCCTGG + Intronic
1093189099 12:16054812-16054834 CTCCACCTCCACCATCTGACAGG - Intergenic
1093500239 12:19803609-19803631 TTAGACATCTCCCATGTGCCAGG + Intergenic
1097381853 12:58904764-58904786 CTGAGCATCCACCATGGGCCAGG + Intronic
1099176746 12:79430874-79430896 CTGGATTCCCACCATGTGCCAGG + Intronic
1100984242 12:100189504-100189526 CTGGACACCCACTATGTACCAGG + Intergenic
1101737514 12:107474210-107474232 CTTGACATCCAGCATGGGGCTGG + Intronic
1101830377 12:108252160-108252182 CTGAGCATCTACCATGTGCCAGG + Intergenic
1102285886 12:111656174-111656196 CTCGACATCCACCATGTGCCAGG - Intronic
1103064192 12:117883364-117883386 TTCGTCATCTACTATGTGCCAGG - Intronic
1103215579 12:119199125-119199147 CTGGACACCTACCATGTGCAAGG + Intronic
1103922774 12:124407783-124407805 CTGAGCATCTACCATGTGCCAGG + Intronic
1104093622 12:125536605-125536627 CTGAATATCTACCATGTGCCAGG - Intronic
1105005350 12:132717865-132717887 CTCACCATCCACCACGTGCCCGG + Intronic
1105751452 13:23425343-23425365 CTGGGCATCCACCAGGGGCCTGG + Intronic
1106535619 13:30639926-30639948 CTCCACCTCCGCCATGGGCCTGG + Intronic
1107663095 13:42659655-42659677 CTGGACATTTACCATGTGCTAGG - Intergenic
1107837474 13:44423364-44423386 CTCTGCATCCACCAGCTGCCTGG - Intergenic
1108048090 13:46402386-46402408 TTCAACATCTACCACGTGCCAGG - Intronic
1108520672 13:51244386-51244408 CTGAACACCCACCATGTGCCAGG - Intronic
1112495338 13:99899489-99899511 CCTGACAACCACCATATGCCAGG - Intergenic
1113161856 13:107390981-107391003 CTGAGCATCTACCATGTGCCAGG + Intronic
1113466560 13:110517573-110517595 CTGAGCATCAACCATGTGCCAGG + Intergenic
1115436196 14:33377490-33377512 CACGAAATCCATCATCTGCCAGG + Intronic
1115457940 14:33626647-33626669 CTGAACACCCACCATGTGACAGG + Intronic
1116982866 14:51189761-51189783 TTCAACATCTACTATGTGCCAGG + Intergenic
1117453913 14:55878881-55878903 CTGGATATCTACCATGTGTCAGG - Intergenic
1119217399 14:72879614-72879636 CTCCACCTCCACCCTGTCCCTGG - Intronic
1120762790 14:88301068-88301090 ATCGAAAGCTACCATGTGCCAGG + Intronic
1121453212 14:94022562-94022584 CTGGACATCAACTATGTGCCAGG - Intergenic
1125769407 15:42154841-42154863 CTCGGCCTCCTCCCTGTGCCTGG - Intronic
1127381488 15:58434376-58434398 CTGCACACCCAGCATGTGCCAGG + Intronic
1128345246 15:66849122-66849144 CTCCACCTCCACCAGGTGCAAGG + Intergenic
1129747963 15:78038162-78038184 CTGGACACCCACCATGAGCCAGG + Intronic
1129994477 15:79992683-79992705 CTGAACATCTAGCATGTGCCAGG + Intergenic
1130528276 15:84725527-84725549 CTGGACATCAACTATGGGCCAGG - Intergenic
1131592599 15:93766321-93766343 CTCAACACCTACCATGTGCCAGG + Intergenic
1133053641 16:3133902-3133924 CTAAGCATCTACCATGTGCCAGG + Intronic
1133509535 16:6444273-6444295 TTGGGCGTCCACCATGTGCCAGG - Intronic
1134155419 16:11839027-11839049 CTTGCCCTACACCATGTGCCAGG - Intronic
1136724535 16:32347839-32347861 CTGATCATCTACCATGTGCCAGG + Intergenic
1137495662 16:48967180-48967202 CTCCACAGCCAGCCTGTGCCAGG - Intergenic
1137963920 16:52912354-52912376 CTCAACATCAAGCAAGTGCCCGG - Intergenic
1140633452 16:76882317-76882339 TTCCACCTCTACCATGTGCCTGG + Intergenic
1141329103 16:83091786-83091808 TTATACACCCACCATGTGCCAGG - Intronic
1141947857 16:87322802-87322824 CTCCTCACCCACCAGGTGCCAGG + Intronic
1203001895 16_KI270728v1_random:169916-169938 CTGATCATCTACCATGTGCCAGG - Intergenic
1203133499 16_KI270728v1_random:1706322-1706344 CTGATCATCTACCATGTGCCAGG - Intergenic
1144628458 17:16857546-16857568 GGGAACATCCACCATGTGCCAGG - Intergenic
1145160046 17:20568117-20568139 GGGAACATCCACCATGTGCCAGG - Intergenic
1145817850 17:27808387-27808409 CTTGAGCTCCAGCATGTGCCAGG - Intronic
1147628161 17:41913317-41913339 CTGAGCATCTACCATGTGCCAGG + Intronic
1149605723 17:57923789-57923811 CTGGACACCTACTATGTGCCAGG + Intronic
1150378602 17:64702783-64702805 ATGAACATCTACCATGTGCCAGG + Intergenic
1150541227 17:66102200-66102222 CTAAACATCTACCATGTGCCAGG + Intronic
1153010260 18:532264-532286 ATCGACATCCGCCCTGTCCCTGG + Intergenic
1155187364 18:23399118-23399140 CAGGACATCAACCCTGTGCCAGG + Intronic
1156388584 18:36629093-36629115 GTCAACATCCACTATCTGCCAGG - Intronic
1157243342 18:46032143-46032165 CTGAACATCCACCATGTGCCAGG + Intronic
1158254816 18:55533889-55533911 CTGAGCATCCACCCTGTGCCAGG + Intronic
1159861350 18:73652944-73652966 CTGGGCACCCACCACGTGCCAGG - Intergenic
1160114610 18:76065539-76065561 CTGGGCACCCACCCTGTGCCAGG - Intergenic
1161086844 19:2339397-2339419 CTACACACCCACCAGGTGCCCGG - Intronic
1161583553 19:5093301-5093323 CCACACATCCACCAGGTGCCTGG - Intronic
1161606754 19:5219393-5219415 CTCGCCATCCACGATGGGCTGGG + Exonic
1165851263 19:38851560-38851582 CTCGAAATCCCCCATCAGCCGGG - Intronic
1166103714 19:40587180-40587202 CGGGGCACCCACCATGTGCCAGG + Intronic
1166312153 19:41969117-41969139 CTCACCATCCACCAGGGGCCAGG + Intronic
1168412802 19:56150143-56150165 CTAGACAGCACCCATGTGCCAGG - Intronic
925153415 2:1632890-1632912 CTGAGTATCCACCATGTGCCAGG - Exonic
925811066 2:7701371-7701393 CTGGATCTCCACCATGTGCTCGG - Intergenic
926980432 2:18561655-18561677 CTCTCCATCCAATATGTGCCTGG + Intronic
927185505 2:20479284-20479306 CATGGCATCCTCCATGTGCCAGG - Intergenic
927655500 2:24942069-24942091 CTGAGCATCTACCATGTGCCAGG - Intergenic
929227550 2:39526136-39526158 CTCGACAAACAGCTTGTGCCAGG + Intergenic
929841224 2:45466007-45466029 CTGAATATCTACCATGTGCCAGG + Intronic
931657122 2:64519556-64519578 ATCGCCATCAACCATGTACCAGG + Intergenic
933998148 2:87685043-87685065 CTTGATGGCCACCATGTGCCGGG - Intergenic
934321607 2:91975793-91975815 CTGATCATCTACCATGTGCCAGG - Intergenic
934769231 2:96897275-96897297 CTAGACATGTACCATGTGCCAGG - Intronic
934972617 2:98775187-98775209 CTGAACATCCACCATGAGCCAGG - Intergenic
936295704 2:111265830-111265852 CTTGATGGCCACCATGTGCCGGG + Intergenic
938977860 2:136496330-136496352 CTGGGCACCCACCATGTGCCTGG - Intergenic
940216874 2:151311330-151311352 CTCGGCATCCACGATGGTCCCGG - Intergenic
941598740 2:167511903-167511925 TTGGGCATCCACCATGTGCCAGG + Intergenic
943613083 2:190057908-190057930 CAGGACATCCATTATGTGCCAGG - Intronic
947622049 2:231597135-231597157 TTAAACATCCACTATGTGCCCGG + Intergenic
1171781017 20:29417802-29417824 CTCAACATCCACCATATTCCGGG + Intergenic
1173416589 20:42862319-42862341 CTGAACACCTACCATGTGCCAGG - Intronic
1173985675 20:47259672-47259694 CTCCACATCCTCAATGTCCCAGG + Intronic
1174406336 20:50305545-50305567 CTTGACATACACCATGTCCCGGG - Intergenic
1175209351 20:57340482-57340504 GGCGTCAGCCACCATGTGCCCGG - Intronic
1175365866 20:58455722-58455744 CTGAGCATCCATCATGTGCCAGG - Intergenic
1175379732 20:58554531-58554553 CTAAGCATGCACCATGTGCCTGG + Intergenic
1177504263 21:22000510-22000532 CACAACTTGCACCATGTGCCTGG - Intergenic
1180743178 22:18067826-18067848 CCCGTCGCCCACCATGTGCCAGG - Intergenic
1181618774 22:24073061-24073083 CTCAGCACCCACCATGAGCCAGG - Intronic
1181947329 22:26528381-26528403 CTGTACATCTACTATGTGCCAGG + Intronic
1182002098 22:26927929-26927951 CTTGACAGCCATCATGAGCCAGG + Intergenic
1182006114 22:26961035-26961057 TTTTAAATCCACCATGTGCCAGG + Intergenic
1182668187 22:31973927-31973949 TTGGACATCCACCACATGCCAGG + Intergenic
1184195161 22:42922722-42922744 GTGAACATCTACCATGTGCCAGG + Intronic
1184857890 22:47156476-47156498 CTCCACACCCACCATGTCCGAGG - Intronic
1184922000 22:47612558-47612580 CTGGGCATCCACCATGGGCCAGG + Intergenic
950494357 3:13324708-13324730 CTCGAGCTCCTCCAGGTGCCAGG + Intronic
950496600 3:13337736-13337758 CTCCACCTCCTCCATCTGCCTGG - Intronic
950505043 3:13389334-13389356 CTCAACATCCAGCGTGTGCCAGG + Intronic
950539473 3:13601641-13601663 TTGAACACCCACCATGTGCCAGG + Intronic
950704225 3:14770039-14770061 CTCCACATCCACCCTGGGCTGGG + Intronic
953717169 3:45325764-45325786 CTGGGCATCTCCCATGTGCCAGG - Intergenic
954093286 3:48301810-48301832 CTGGGCATCAACCATGTTCCAGG - Intergenic
955120941 3:56057694-56057716 ATCGGCATCCACCATGTAACAGG - Intronic
955351817 3:58199206-58199228 CTGAACATTCACTATGTGCCAGG + Intronic
955531022 3:59873261-59873283 CTGAATAGCCACCATGTGCCTGG - Intronic
955697946 3:61655436-61655458 CTGAACATCTACTATGTGCCAGG - Intronic
955755780 3:62223677-62223699 CCTCACATTCACCATGTGCCAGG - Intronic
957078083 3:75617458-75617480 CTGGGCATCCTCCGTGTGCCAGG + Intergenic
957083978 3:75663483-75663505 CTCAACAACCACCATATTCCAGG - Intergenic
958531204 3:95333176-95333198 CTCTACTTCCACCATGGCCCAGG + Intergenic
960046419 3:113203200-113203222 TTGGGCATCCACCATGTGCCAGG + Intergenic
960057741 3:113287202-113287224 CTCGTGATGAACCATGTGCCTGG - Exonic
960671814 3:120161705-120161727 CTGGGCATTGACCATGTGCCAGG + Intergenic
961033470 3:123626187-123626209 CTGGACACTCACCATGTGCCAGG + Intronic
961532848 3:127550183-127550205 TTGGACATCCATTATGTGCCAGG - Intergenic
961782202 3:129326873-129326895 CTCAACATCCAACATGCGCCAGG + Intergenic
961937593 3:130601979-130602001 CTCAAAATCTACCATGTCCCTGG - Intronic
963351650 3:144159169-144159191 TTGGACATCCACCATGCACCAGG - Intergenic
967681494 3:192369158-192369180 CTCCTCATCTACCTTGTGCCTGG - Intronic
968007148 3:195250868-195250890 CTGGGCATCTACTATGTGCCAGG - Intronic
968552535 4:1231089-1231111 CCCGACCTCCACCACGTACCAGG + Intronic
969792285 4:9500068-9500090 CTGGGCATTCTCCATGTGCCAGG - Intergenic
970044681 4:11838423-11838445 ATTGACATCCACTATGTGGCTGG - Intergenic
970607538 4:17694681-17694703 CTTGAGATCTACTATGTGCCAGG + Intronic
974497101 4:62645986-62646008 CTCCACATTCACCATGTGGCAGG + Intergenic
975326394 4:73063346-73063368 CTCAACATACACTATGTGCAAGG - Intronic
980639090 4:135550978-135551000 CTAACCATCCACCATGTTCCAGG - Intergenic
985636984 5:1040720-1040742 CTTCCCATCCACCATGTGCCAGG - Intergenic
990263190 5:54047413-54047435 CCCCACATCCACCATGTTGCGGG - Intronic
991140312 5:63232690-63232712 CTCGTCTTCCACCATCTCCCAGG - Intergenic
991722025 5:69502488-69502510 CTGGACGTCTACTATGTGCCAGG + Intronic
991749641 5:69787073-69787095 CACAGCATCCTCCATGTGCCAGG + Intergenic
991763469 5:69947567-69947589 CACAGCATCCTCCATGTGCCAGG - Intergenic
991783858 5:70170562-70170584 CACAGCATCCTCCATGTGCCAGG + Intergenic
991801220 5:70366887-70366909 CACAGCATCCTCCATGTGCCAGG + Intergenic
991827379 5:70643155-70643177 CACAGCATCCTCCATGTGCCAGG - Intergenic
991842698 5:70822627-70822649 CACAGCATCCTCCATGTGCCAGG - Intergenic
991876303 5:71170937-71170959 CACAGCATCCTCCATGTGCCAGG + Intergenic
992024460 5:72656956-72656978 TTGAACATCCACCATGTGCCAGG + Intergenic
992867025 5:80968116-80968138 CTGACCATTCACCATGTGCCAGG - Intronic
994534128 5:101006603-101006625 CTCAAAAACCACCATGTGGCGGG - Intergenic
994689487 5:102999416-102999438 CACGGCTTGCACCATGTGCCTGG - Intronic
997791806 5:136768802-136768824 CTGAGCATCCTCCATGTGCCAGG - Intergenic
999260161 5:150233362-150233384 TGCTACATCTACCATGTGCCAGG - Intronic
1002093147 5:176816491-176816513 CACTACCTCCTCCATGTGCCTGG - Intronic
1002191496 5:177480268-177480290 CTGGGCATCCACTATATGCCAGG + Intergenic
1002805546 6:570544-570566 CTGAACACCTACCATGTGCCAGG + Intronic
1004349607 6:14879650-14879672 TTCTACACCCACCATGTGCTTGG - Intergenic
1005722696 6:28618452-28618474 CTCTGCATCCACTATGTGGCAGG - Intergenic
1006681372 6:35798915-35798937 CTGGGCACCCACCATGTGCCAGG - Intergenic
1007106750 6:39288622-39288644 CTCAACACCTACCGTGTGCCCGG - Intergenic
1007575678 6:42924126-42924148 CTCGACACCCACCCTGTGCCAGG + Intronic
1009459394 6:63894143-63894165 CTCCAAATGCACCCTGTGCCAGG - Intronic
1010500390 6:76593045-76593067 CTGGACACCTACTATGTGCCAGG - Intergenic
1013432809 6:110070142-110070164 CTGATCACCCACCATGTGCCAGG - Intergenic
1017758009 6:157545941-157545963 CTACACATCTACAATGTGCCAGG - Intronic
1017846279 6:158261206-158261228 CTCAACAGCCTCCACGTGCCTGG - Intronic
1018039375 6:159908423-159908445 TTGAACATCCACAATGTGCCAGG - Exonic
1018725387 6:166608767-166608789 CTCACCATCCACGATGGGCCAGG - Intronic
1019351509 7:556226-556248 CTGGACACCCACCACGTGCCAGG + Intronic
1020256518 7:6505507-6505529 ACAGACATCCTCCATGTGCCTGG + Intronic
1021233859 7:18118597-18118619 ATTGACATTCACCATGTGCTAGG + Intronic
1026863040 7:73806018-73806040 CTCGGCCTCCACCATGCCCCAGG + Intronic
1028961617 7:96755223-96755245 TTCAACACCTACCATGTGCCAGG - Intergenic
1029725297 7:102399375-102399397 CACGACATCTACAATATGCCAGG + Intronic
1030299254 7:107959062-107959084 GTTGACATCCTCTATGTGCCAGG - Intronic
1031897124 7:127363462-127363484 ATCAACACCCACCATGTTCCAGG + Intronic
1032475412 7:132208442-132208464 CTCTCCATCCACCATGGGCCAGG - Intronic
1033307544 7:140236051-140236073 TTGGGCATCTACCATGTGCCTGG - Intergenic
1033414888 7:141152867-141152889 CTAGACATTTACTATGTGCCAGG + Intronic
1033415928 7:141161268-141161290 CTCGTCATCCACCATAGCCCTGG - Intronic
1035116319 7:156527319-156527341 CTGGGCATCTACTATGTGCCAGG + Intergenic
1036660299 8:10703605-10703627 CTCTGCATCTACCATCTGCCAGG + Intronic
1038106654 8:24442697-24442719 TTCGGCATACACCATGTGCTTGG + Intronic
1038584954 8:28779903-28779925 CCCAACAGCCGCCATGTGCCGGG + Intronic
1042625183 8:70749293-70749315 CTCGTCACCCACAATGTGGCAGG - Intronic
1046872116 8:119215275-119215297 TTGGACATCCACCATGAACCAGG + Intronic
1047350904 8:124072662-124072684 CCCCACAACCACCATGTGCCAGG + Intronic
1047351453 8:124078539-124078561 CTGGGAATCCACCATGTGTCAGG + Intronic
1049210979 8:141386277-141386299 CCCGACACCCACCAGCTGCCAGG + Intergenic
1049602446 8:143514180-143514202 CCCGAGGTCCACCATGTGCAGGG + Intronic
1049788804 8:144463607-144463629 CTGGAACTCCACCATGTCCCTGG + Intronic
1056724855 9:89105999-89106021 TTGAACATCCACTATGTGCCAGG + Intronic
1057893606 9:98888585-98888607 CTAAACATCTACAATGTGCCTGG - Intergenic
1058871853 9:109208891-109208913 TTGGACATCTACTATGTGCCGGG - Intronic
1058872330 9:109213339-109213361 CTGAACATCTACAATGTGCCAGG + Intronic
1060739689 9:126090183-126090205 CTAGAGATCCACCATGTGTCAGG + Intergenic
1061637268 9:131920450-131920472 CTCAACACCTACTATGTGCCAGG + Intronic
1185532052 X:829920-829942 CCTGATATCCACCATGAGCCTGG - Intergenic
1188308006 X:28582485-28582507 CTGGAAACCCACTATGTGCCAGG - Intergenic
1192111102 X:68365731-68365753 GTGGAAATCTACCATGTGCCAGG + Intronic
1192363165 X:70451993-70452015 CTCCTCAGCCAGCATGTGCCTGG - Exonic
1193749961 X:85329200-85329222 TTAAGCATCCACCATGTGCCAGG - Intronic
1193771197 X:85589482-85589504 TTGAACATCTACCATGTGCCAGG - Intergenic
1195744958 X:108107855-108107877 CTCTACAACCATCATATGCCGGG + Intronic
1196787000 X:119429548-119429570 CTCGACCTCTACCATGCACCAGG + Intronic
1198408614 X:136342341-136342363 CTAAACATCTACCATGTGCCAGG + Intronic
1199668249 X:150119323-150119345 CTCAACACCCACTATGTGGCAGG - Intergenic