ID: 1102287828

View in Genome Browser
Species Human (GRCh38)
Location 12:111673641-111673663
Sequence ATAGTTAGATCCCATCTAAT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 105
Summary {0: 1, 1: 0, 2: 0, 3: 10, 4: 94}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1102287825_1102287828 22 Left 1102287825 12:111673596-111673618 CCAACTACTCTTTAATAAACCAA 0: 1
1: 0
2: 0
3: 22
4: 345
Right 1102287828 12:111673641-111673663 ATAGTTAGATCCCATCTAATGGG 0: 1
1: 0
2: 0
3: 10
4: 94
1102287826_1102287828 3 Left 1102287826 12:111673615-111673637 CCAAATAATAATAATAATAATAT 0: 5
1: 134
2: 289
3: 788
4: 2998
Right 1102287828 12:111673641-111673663 ATAGTTAGATCCCATCTAATGGG 0: 1
1: 0
2: 0
3: 10
4: 94

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1102287828 Original CRISPR ATAGTTAGATCCCATCTAAT GGG Intronic
904155736 1:28481454-28481476 ATAGTTAGATGCCACGTAGTAGG - Intronic
916089639 1:161297805-161297827 GGATTTAGATCCCATCTAAAGGG + Intergenic
921257062 1:213351831-213351853 ATAGTTAAATCCCTTCTACATGG - Intergenic
924463262 1:244278240-244278262 ATAGTGAGATACCATCTCACAGG - Intergenic
1064049811 10:12050189-12050211 ACAGTAAGATCCCAGCTACTCGG + Intergenic
1067497085 10:46771073-46771095 ATAATTATATTCCATCTAAATGG + Intergenic
1067597565 10:47569339-47569361 ATAATTATATTCCATCTAAATGG - Intergenic
1070425477 10:76283108-76283130 ACAGTTAGCTCCCCTTTAATGGG + Intronic
1075370963 10:121934541-121934563 ATGGTGAGATCTCAGCTAATTGG - Intergenic
1082969467 11:59004394-59004416 ATAGTTAGATGCCATCTACAAGG + Intronic
1083507719 11:63174771-63174793 ATAGGAAGTTCCCATTTAATGGG - Intronic
1087518080 11:99192244-99192266 ATAGTTATATGCCAACAAATTGG + Intronic
1089859143 11:121573200-121573222 ATATTTACATCCTATTTAATAGG + Intronic
1090714963 11:129422478-129422500 ATAGTGAGACCCCATCTCAATGG - Intronic
1093607236 12:21107421-21107443 CTTGCTAGGTCCCATCTAATAGG - Intronic
1097227155 12:57484377-57484399 CTAGTTAGGGCCCCTCTAATGGG - Intronic
1098281737 12:68868866-68868888 ATGCTTACATCCCATCTAACAGG - Intronic
1099329419 12:81264095-81264117 AGAGTCACATCCCATTTAATTGG + Intronic
1101814800 12:108137697-108137719 ATAGTTAAATCCTATTTAATAGG + Intronic
1102287828 12:111673641-111673663 ATAGTTAGATCCCATCTAATGGG + Intronic
1106386662 13:29292082-29292104 GTAGTTAAATCCCAAATAATTGG + Intronic
1108018518 13:46100732-46100754 AATGTTAGATGCCATCCAATAGG + Intronic
1110111773 13:71756360-71756382 ATACTTAGACCCCATCTACCAGG + Intronic
1113221411 13:108107817-108107839 ATAATTAGATTCCATCACATGGG + Intergenic
1116601302 14:46927326-46927348 ATAGGTAGAACCCATCAAATTGG - Intronic
1117787257 14:59299254-59299276 ATAGTTAAAAGCCATCTAAAAGG + Intronic
1119510439 14:75207191-75207213 ATAGCAAGACCCCATCTACTTGG + Intergenic
1120052627 14:79885042-79885064 ATAATTTGATCTCATTTAATTGG + Intergenic
1125281482 15:38046417-38046439 ATTGCTAGATCTCATCTCATCGG - Intergenic
1133404343 16:5510831-5510853 AGAGTCAGATGGCATCTAATGGG - Intergenic
1134469954 16:14515156-14515178 ATAGCAAGATCCCATCTCAAAGG - Intronic
1140642234 16:76989342-76989364 AAAGTTAATTCCCATCTCATAGG + Intergenic
1140970594 16:80008798-80008820 ATAGTCAGAGCACATCTAACAGG + Intergenic
1145715664 17:27018051-27018073 ATAGTGAGATTCCATCTCTTGGG - Intergenic
1151003737 17:70409319-70409341 ACAGTTAAATCCCATCTAGTTGG - Intergenic
1154472290 18:14716016-14716038 ATAGTGAGATTCCATCTCTTGGG + Intergenic
1155535876 18:26816911-26816933 AGAGTGAGATTCCATCTACTGGG - Intergenic
1155587571 18:27385072-27385094 ACAGTGAGATCCCAGCTAAAGGG - Intergenic
1156735812 18:40257932-40257954 ATGCTTAGATCACAGCTAATGGG - Intergenic
1160675086 19:386345-386367 ATAGTTAGACGCCATCTACAGGG + Intergenic
1164154267 19:22580457-22580479 ATGGTTAGATGCCATCTACAGGG + Intergenic
1167157727 19:47749760-47749782 ATAGTGAGATCTCATCTCAGGGG - Intronic
1167991298 19:53363467-53363489 ATGGTTAGATGCCATCTACAAGG + Intergenic
927895274 2:26777860-26777882 ACAGCTAGAACCCATCTAATAGG + Intronic
930515216 2:52398780-52398802 TTAGTTATATTCGATCTAATTGG - Intergenic
936833053 2:116672152-116672174 ATAGTTATATCACATGAAATAGG - Intergenic
938856694 2:135320043-135320065 ATAGTGAGAACCCATCTCTTGGG - Intronic
941045826 2:160674754-160674776 TTAGTTAGATCTCATCTAACAGG - Intergenic
945393412 2:209292852-209292874 ATACTTATATCCCAGCTATTTGG + Intergenic
1168962726 20:1880069-1880091 ATAGTAGTATCCCATTTAATAGG - Intergenic
1170077638 20:12437150-12437172 ATAGTGAGAACTCTTCTAATTGG + Intergenic
1171503264 20:25611196-25611218 ATAATTAGATGCCATGAAATAGG - Intergenic
1172586035 20:36085589-36085611 ATATTTGGATTCCATCTAACAGG - Intergenic
1176802200 21:13441888-13441910 ATAGTGAGATTCCATCTCTTGGG - Intergenic
1177859282 21:26434219-26434241 ATATTTAGATCTCATTAAATAGG - Intergenic
1179112199 21:38457074-38457096 ATACTTACATCACATCCAATAGG + Intronic
1185392142 22:50568125-50568147 ATAGTGAGACCCTATCTCATGGG + Intergenic
960077562 3:113505078-113505100 ATACTCAAATCCCACCTAATTGG + Intronic
960195035 3:114755245-114755267 ATAGTTAAGTCACATTTAATAGG - Intronic
960724248 3:120654228-120654250 ATACTTAAATCCCTTCTACTGGG - Intronic
961297495 3:125898463-125898485 ATAGTTAGACGCCATCTACAAGG + Intergenic
961545908 3:127632931-127632953 ATAATTGGATCACATCTGATTGG + Intronic
966867697 3:184269116-184269138 ATTGGTAGAACCCATCTTATAGG + Intronic
969813228 4:9666188-9666210 ATGGTTAGATGCCATCTACAAGG + Intergenic
972641278 4:40927421-40927443 AACATTAGAGCCCATCTAATGGG - Intronic
973054941 4:45644597-45644619 TTAGTTAGATGCTATATAATGGG - Intergenic
977763109 4:100763634-100763656 ATATTTAAATCCCATGTATTTGG - Intronic
980162170 4:129178475-129178497 ATAGTTAAAGCTCATCTTATAGG + Intergenic
985173741 4:187178741-187178763 AAAATCAGATCCCATCTAAGAGG - Intergenic
986175832 5:5351247-5351269 ATAGTCAGAGCCAATTTAATAGG + Intergenic
990437925 5:55812692-55812714 TTACTAAGATACCATCTAATTGG + Intronic
991774292 5:70069592-70069614 ATAATTAAATCCCTTCTAACAGG - Intronic
991853587 5:70945015-70945037 ATAATTAAATCCCTTCTAACAGG - Intronic
992511478 5:77440371-77440393 ATTGTTGGATTCCATCTTATAGG - Intronic
993292508 5:86092720-86092742 ACAGTTAGTTGCCATCTAACTGG + Intergenic
994435601 5:99727538-99727560 CTAGATAGCTCCCATCTAGTCGG + Intergenic
997860510 5:137411268-137411290 ATAATTAGGTCCCATCCTATAGG - Intronic
999598313 5:153231356-153231378 TTAGTTAGCTCCCATCAAAAAGG + Intergenic
1005085469 6:22001884-22001906 ATAGTTAAAATCCATGTAATGGG + Intergenic
1005730387 6:28691662-28691684 ATGGTTAGATGCCATCTACAGGG + Intergenic
1007571553 6:42894968-42894990 ATGGTTAGATGCCATCTACAGGG - Intergenic
1007995185 6:46299933-46299955 ATAATTAGATTCCATATCATTGG - Intronic
1009603315 6:65832863-65832885 ATAGTTAGATCATATTAAATTGG - Intergenic
1013175441 6:107672942-107672964 AGAATTAGATCCCATGTACTAGG + Intergenic
1016125804 6:140401607-140401629 AGAGTTAGATGCCATTTACTTGG - Intergenic
1017102495 6:150861132-150861154 ATGGTTAGATGCCATCTACAAGG + Intergenic
1021919383 7:25468977-25468999 TTAGTTAGATCCAATTTAGTTGG + Intergenic
1028091997 7:86714261-86714283 ATAGTTACATCACATGAAATTGG - Intronic
1031784976 7:126018248-126018270 ATAGTTAGATGTAATTTAATTGG - Intergenic
1031935197 7:127728865-127728887 ATAGTTAGATACCAGCACATTGG - Intronic
1036057290 8:5270376-5270398 TCATTTAGATCCCATCTAAAGGG - Intergenic
1038938491 8:32278596-32278618 AAGGGTAGATCTCATCTAATGGG - Intronic
1041993229 8:64020686-64020708 ATAGTTACATGCCAACAAATTGG + Intergenic
1046303769 8:112334226-112334248 CTAATTAGATACCATCTAATTGG + Intronic
1048056296 8:130869449-130869471 ATAATTAGATCCTCTGTAATTGG - Intronic
1049876166 8:145022572-145022594 ATGGTTAGATGCCATCTACAAGG - Intergenic
1053092174 9:35288707-35288729 ATAATCTGATCCCATCTACTGGG - Intronic
1055638571 9:78300917-78300939 AAAGTGAGATCCCATCTCATGGG - Intronic
1058749337 9:108023640-108023662 ATAGTGAGATTCCATCTCAATGG + Intergenic
1059481705 9:114595760-114595782 ATAGTGAGATCCCATCTCTTCGG + Intronic
1190132504 X:47762563-47762585 ATCATTACATTCCATCTAATAGG + Intergenic
1190999642 X:55646468-55646490 ATAGGGAGATCCCATCTACTTGG - Intergenic
1192130716 X:68547061-68547083 ATATTTAGGTCAGATCTAATTGG - Intergenic
1200260026 X:154609728-154609750 ATGGTTAGATGCCATCTACAAGG - Intergenic
1200752529 Y:6959726-6959748 ATGGTTAGATGCCATCTACAAGG - Intronic