ID: 1102295036

View in Genome Browser
Species Human (GRCh38)
Location 12:111729905-111729927
Sequence CTGCTGACGGGGAAGATGGA GGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 326
Summary {0: 1, 1: 0, 2: 1, 3: 19, 4: 305}

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1102295036_1102295046 -1 Left 1102295036 12:111729905-111729927 CCCTCCATCTTCCCCGTCAGCAG 0: 1
1: 0
2: 1
3: 19
4: 305
Right 1102295046 12:111729927-111729949 GAGGACCACAGTGGTGCACGGGG 0: 1
1: 0
2: 0
3: 10
4: 98
1102295036_1102295048 7 Left 1102295036 12:111729905-111729927 CCCTCCATCTTCCCCGTCAGCAG 0: 1
1: 0
2: 1
3: 19
4: 305
Right 1102295048 12:111729935-111729957 CAGTGGTGCACGGGGACTTCAGG 0: 1
1: 0
2: 0
3: 13
4: 88
1102295036_1102295051 23 Left 1102295036 12:111729905-111729927 CCCTCCATCTTCCCCGTCAGCAG 0: 1
1: 0
2: 1
3: 19
4: 305
Right 1102295051 12:111729951-111729973 CTTCAGGTAGATGTGGTGGCAGG 0: 1
1: 0
2: 0
3: 24
4: 368
1102295036_1102295052 24 Left 1102295036 12:111729905-111729927 CCCTCCATCTTCCCCGTCAGCAG 0: 1
1: 0
2: 1
3: 19
4: 305
Right 1102295052 12:111729952-111729974 TTCAGGTAGATGTGGTGGCAGGG 0: 1
1: 0
2: 0
3: 19
4: 267
1102295036_1102295050 19 Left 1102295036 12:111729905-111729927 CCCTCCATCTTCCCCGTCAGCAG 0: 1
1: 0
2: 1
3: 19
4: 305
Right 1102295050 12:111729947-111729969 GGGACTTCAGGTAGATGTGGTGG 0: 1
1: 0
2: 0
3: 21
4: 183
1102295036_1102295043 -10 Left 1102295036 12:111729905-111729927 CCCTCCATCTTCCCCGTCAGCAG 0: 1
1: 0
2: 1
3: 19
4: 305
Right 1102295043 12:111729918-111729940 CCGTCAGCAGAGGACCACAGTGG 0: 1
1: 0
2: 0
3: 16
4: 138
1102295036_1102295045 -2 Left 1102295036 12:111729905-111729927 CCCTCCATCTTCCCCGTCAGCAG 0: 1
1: 0
2: 1
3: 19
4: 305
Right 1102295045 12:111729926-111729948 AGAGGACCACAGTGGTGCACGGG 0: 1
1: 0
2: 1
3: 19
4: 198
1102295036_1102295049 16 Left 1102295036 12:111729905-111729927 CCCTCCATCTTCCCCGTCAGCAG 0: 1
1: 0
2: 1
3: 19
4: 305
Right 1102295049 12:111729944-111729966 ACGGGGACTTCAGGTAGATGTGG 0: 1
1: 0
2: 0
3: 7
4: 91
1102295036_1102295044 -3 Left 1102295036 12:111729905-111729927 CCCTCCATCTTCCCCGTCAGCAG 0: 1
1: 0
2: 1
3: 19
4: 305
Right 1102295044 12:111729925-111729947 CAGAGGACCACAGTGGTGCACGG 0: 1
1: 0
2: 1
3: 27
4: 275

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1102295036 Original CRISPR CTGCTGACGGGGAAGATGGA GGG (reversed) Exonic
900435667 1:2629468-2629490 CTGCTGATGGGGAAGTCCGAAGG - Exonic
900926542 1:5709709-5709731 CTGATGACAGGGAAGATGGGAGG - Intergenic
901842823 1:11964585-11964607 CTGGTGGTGGGGAAGATGGAGGG - Intronic
902405871 1:16183371-16183393 CAGATGACGGTGAAGAGGGAGGG - Intergenic
902588338 1:17455448-17455470 CTGCTGAAGGAGGAGATGGGAGG - Intergenic
902725305 1:18331772-18331794 ATGCTGACTGTGGAGATGGAGGG + Intronic
905228451 1:36495081-36495103 CTGCTGGGCGGGGAGATGGATGG - Intergenic
905389112 1:37624859-37624881 GTGCTGAGGGGTAAGGTGGATGG - Intronic
905394016 1:37655801-37655823 CAGCAGACAGGGAAGATGCAGGG - Intergenic
906269182 1:44460935-44460957 GTGCTGACAGGGAAGGGGGAAGG - Intronic
907297457 1:53464524-53464546 CTCCTGATGGGGTAGATGCACGG - Intronic
907427118 1:54386929-54386951 GTGCTGACAGGCAAGAAGGAGGG - Intronic
908466711 1:64403099-64403121 CTGCGGAGGCAGAAGATGGAGGG + Intergenic
910279637 1:85484465-85484487 CTGCTGATGAGGCTGATGGAAGG + Intronic
911718597 1:101165221-101165243 CTGCTGAAGGGTAAGTAGGAAGG + Intergenic
912527302 1:110292972-110292994 CAGATGTCTGGGAAGATGGAGGG - Intergenic
913288562 1:117250777-117250799 CTTCTGACTGAGGAGATGGAAGG + Intergenic
915018118 1:152755765-152755787 CTGCTGGCAAGGATGATGGAAGG - Intronic
915140463 1:153764767-153764789 GTGCTGTCAGGGAGGATGGAGGG - Intronic
915289076 1:154870630-154870652 CTGATGAGGGGGCAGACGGAGGG + Intergenic
915758772 1:158289945-158289967 CGGCTGATGGGGAAGATTGTTGG + Exonic
916277450 1:163010075-163010097 CTGCAGAGGTGGGAGATGGAGGG + Intergenic
918728888 1:187963638-187963660 CTGCTGACGGGGAAAGTGAGAGG + Intergenic
920066661 1:203274088-203274110 ATGCTGGCGGGGCAGATGGGAGG - Intergenic
921066622 1:211627524-211627546 CTGCTGAAGGGGGCGATGCATGG + Intergenic
921095589 1:211884801-211884823 CAGCTGATGGGGAAGGAGGATGG - Intergenic
922745733 1:228042540-228042562 ATGATGAAGGGGATGATGGATGG + Intronic
922866441 1:228864961-228864983 CTTCTGTGGGAGAAGATGGAAGG + Intergenic
923273175 1:232375513-232375535 ATGCTGATGGGGAATATTGATGG - Intergenic
923684905 1:236147229-236147251 GGGCTGCCTGGGAAGATGGAAGG - Intronic
923687050 1:236160712-236160734 CGACTGACGGGGAGGCTGGAGGG - Intronic
924101109 1:240603514-240603536 GTGCTGGAGGGGGAGATGGATGG - Intronic
1062791473 10:309036-309058 CTGCTGACGGCGATAAGGGAAGG + Intronic
1064131554 10:12714141-12714163 CTGCTGACTTGGAAGGTGGTGGG + Intronic
1065581621 10:27177522-27177544 CGGCTGAGAGGCAAGATGGAGGG - Intronic
1065630607 10:27677026-27677048 CTACTGAAGGGAAAGATGTAGGG + Intronic
1066265759 10:33774385-33774407 CTGCAGATGGGGAAGCCGGAAGG - Intergenic
1067282138 10:44880742-44880764 CTGTTGATGGGGGAGATGGTGGG + Intergenic
1068517602 10:58043813-58043835 CTGCTGGCTCTGAAGATGGAAGG - Intergenic
1068632524 10:59312406-59312428 CTGGTGACAATGAAGATGGAGGG - Intronic
1071970127 10:90896674-90896696 CTGGTGAGGGAGAAGAAGGAAGG - Intronic
1072952251 10:99858006-99858028 CTGCTGGCTTTGAAGATGGAGGG + Intergenic
1073612526 10:104958585-104958607 CTGCTGGCTTTGAAGATGGAAGG + Intronic
1074516929 10:114179197-114179219 CTGCTTCCGGGGAAGGCGGAGGG + Intergenic
1074819644 10:117168507-117168529 CTGCTGCTGGGGAACGTGGAGGG - Intergenic
1074845125 10:117391009-117391031 CTGCTGGCTTTGAAGATGGAAGG + Intergenic
1074910015 10:117899928-117899950 CTATTGAATGGGAAGATGGAAGG - Intergenic
1075952876 10:126497190-126497212 CTGCTGATGGGAAAGGTGGCAGG + Intronic
1076096335 10:127737196-127737218 CTGCTGGCGGCCAAGCTGGATGG + Intergenic
1076284324 10:129278126-129278148 CAGATGACGTGGAAGATGGCAGG - Intergenic
1076692435 10:132230660-132230682 CTGCTGGGGGGGAAGCTGGCGGG + Intronic
1076800135 10:132817933-132817955 CTGCCGACGGTGAGGATGGAGGG - Intronic
1077316976 11:1923697-1923719 CTAATGATGAGGAAGATGGAAGG - Intronic
1077413101 11:2412611-2412633 CTGGTGACTGGGAAGATGGGAGG + Intronic
1078741214 11:14067812-14067834 CTGCAAGTGGGGAAGATGGAGGG + Intronic
1079326894 11:19501081-19501103 TTGCTGACTTTGAAGATGGAAGG - Intronic
1079590893 11:22181295-22181317 CTTCTTAAGGGGAAGATAGAGGG - Intergenic
1080642770 11:34167314-34167336 CGGCTGTCGGGGTGGATGGAAGG + Exonic
1081224421 11:40502397-40502419 CTGGAGACGGGGAAGAAGAAAGG + Intronic
1083580415 11:63821238-63821260 CTGCTGGCTTTGAAGATGGAAGG - Intronic
1083939252 11:65886515-65886537 CTGCTGACTGGATAGGTGGATGG - Intronic
1084188934 11:67490226-67490248 AGGCTGAGGGGGAGGATGGATGG + Intronic
1084427290 11:69091855-69091877 TTGCTGACTTTGAAGATGGAGGG - Intergenic
1084720434 11:70902248-70902270 CTGCTGGCTGGGAAGGAGGAAGG + Intronic
1085015128 11:73169066-73169088 GTGCTGACTGGGGAGTTGGAGGG + Intergenic
1087518745 11:99201737-99201759 CTGCTGACTCTGAAGATGGAAGG + Intronic
1089667980 11:120032411-120032433 CTGCTGAAGGGGTAGGTGGCAGG - Intergenic
1089742529 11:120594632-120594654 CTGCTGACATGGAAGATGGGAGG - Intronic
1089752345 11:120660679-120660701 CAGCTGTCGGGGAAAAAGGAGGG + Intronic
1089778593 11:120856996-120857018 CTGGTGTCTGGGAACATGGAGGG - Intronic
1090125953 11:124084307-124084329 CTGGGGATGGGGAAGGTGGATGG + Intergenic
1090295054 11:125580115-125580137 CAGCTGACCGACAAGATGGATGG - Exonic
1091119262 11:133043128-133043150 TTGATGAGGTGGAAGATGGAAGG - Intronic
1092404607 12:8210331-8210353 TTGCTGAGGAGGAAGAGGGAAGG + Intergenic
1092587246 12:9912107-9912129 CTGCTGATGGGGTAGAAGAAGGG + Intronic
1093598524 12:20992042-20992064 CTGCAGACAAGGAAGTTGGAGGG - Intergenic
1095812972 12:46390930-46390952 CTGCTGACGGGTAACATCAAGGG - Intergenic
1098608458 12:72423890-72423912 TTGCTGACTTTGAAGATGGAGGG + Intronic
1099904066 12:88751113-88751135 CTGCTGCCCTGGAAGTTGGAGGG - Intergenic
1100460595 12:94795601-94795623 CTGCTGAGGAGGAAGAGGGGAGG - Intergenic
1102295036 12:111729905-111729927 CTGCTGACGGGGAAGATGGAGGG - Exonic
1103267927 12:119646596-119646618 TTGCTGCCGTTGAAGATGGAAGG - Intergenic
1103971691 12:124676446-124676468 CTGCACACGGGTAAGCTGGAAGG + Intergenic
1105472650 13:20706125-20706147 CTGCCCACGGGGAAGTTGGGTGG + Intronic
1106483574 13:30154638-30154660 GTGGTGACGGGGGAGATGCAGGG - Intergenic
1110255694 13:73431399-73431421 CTGGTGACAGGGATGATAGAAGG + Intergenic
1113156378 13:107327313-107327335 CTGCTGACTTGTAAGAGGGAAGG + Intronic
1113651850 13:112039120-112039142 CTCCTGACAGAGAAGTTGGATGG - Intergenic
1114446146 14:22789816-22789838 CTGCTGACTTTGAAAATGGAAGG + Intronic
1120460294 14:84786662-84786684 CTGCTGACATGGAAGGTAGAAGG + Intergenic
1121097063 14:91224834-91224856 CTGCTCACACGGAACATGGACGG - Exonic
1121724052 14:96133274-96133296 GTGGTGAGGGGGTAGATGGATGG - Intergenic
1122122385 14:99561432-99561454 CTGCTGCCGTGGAGGATGGCTGG - Intronic
1123032559 14:105458767-105458789 CTGCTGGCAGGGAAGGTGCATGG - Intronic
1123061212 14:105595296-105595318 CTGGTGATGGGGTGGATGGAGGG + Intergenic
1123085667 14:105716207-105716229 CTGGTGATGGGGTGGATGGAGGG + Intergenic
1124687291 15:31793136-31793158 CTGCTTCCGGGGAAGGTGCATGG - Intronic
1127378305 15:58405482-58405504 TTGCTGACTTTGAAGATGGAGGG - Intronic
1127979066 15:64021103-64021125 CTACTGAGGGGAAAGATGAAGGG - Intronic
1129334517 15:74844129-74844151 CTGCTGATGGGGAGCATGGGCGG + Exonic
1129897150 15:79117004-79117026 CTGCTGAAGAGGCAGGTGGAAGG + Intergenic
1130782105 15:87051119-87051141 CTGCTGAAGGGGAAGAGGTGGGG + Intergenic
1131119987 15:89815976-89815998 CTGCTGGCTTTGAAGATGGATGG - Intergenic
1132203108 15:99968675-99968697 CTGGGGCCGGAGAAGATGGATGG - Intergenic
1133290032 16:4714248-4714270 CTGCTGGCTGGGAAGACAGAAGG + Intronic
1133397734 16:5461739-5461761 CTGCTGGCAGGGTGGATGGATGG + Intergenic
1133670551 16:8014874-8014896 CTGCAGAGGGGAAATATGGAAGG + Intergenic
1134073989 16:11277744-11277766 CTGCTGGCTTTGAAGATGGAGGG + Intronic
1136012160 16:27370858-27370880 CTGCTGGCTTTGAAGATGGAGGG + Intergenic
1139752046 16:69114841-69114863 CTGCTGACGGTGCAGCTGGTGGG + Exonic
1142494570 17:299498-299520 CTGCTGATGGGGAAGCTGAGTGG - Intronic
1143840540 17:9728236-9728258 CTGCTAACAGCGAAGATGGTGGG + Exonic
1144237293 17:13273959-13273981 CAACTGAAGGGGAAGAAGGAGGG - Intergenic
1144391779 17:14800310-14800332 ATGCTGAGTGGGAGGATGGAAGG + Intergenic
1144727032 17:17507200-17507222 CTGCTGCCAGGGAGGAGGGAGGG + Intronic
1144844649 17:18210284-18210306 CTGGTGAAGGGGGAGATGGCAGG + Intergenic
1147422669 17:40330470-40330492 GTGCTGGGGGGGAAGAGGGAGGG - Intronic
1147753366 17:42751190-42751212 CTGCTGATAGGGAAGAGAGAAGG - Intergenic
1148479380 17:47950039-47950061 CTGCAGAAGGGGAAGTTGGGAGG - Intergenic
1148835936 17:50465773-50465795 CTGTCGAAGGGGAAGTTGGAGGG + Exonic
1150667676 17:67157843-67157865 CTGCTTTCTGGGAAAATGGAAGG - Intronic
1152102395 17:78309736-78309758 CTGCTGACTTTGAAGGTGGAGGG + Intergenic
1153429343 18:4999080-4999102 CTGCTGCTGGGGATGAAGGAGGG - Intergenic
1157300746 18:46477398-46477420 CTGCTGACCGCCAAGGTGGAGGG + Intronic
1157457437 18:47846615-47846637 TTGCTGACTTTGAAGATGGATGG + Intronic
1157605123 18:48921667-48921689 CAGCTGACGCGGGAGGTGGATGG - Exonic
1157605716 18:48924712-48924734 CTGCTGGTGGGGGAGCTGGAGGG - Intronic
1157947600 18:51998268-51998290 GTGCTGAGTGGGAAGAAGGAGGG + Intergenic
1158585161 18:58726447-58726469 GGGCTGTGGGGGAAGATGGAAGG + Intronic
1158643335 18:59221053-59221075 CTGCTGGCTGGAAAGAGGGAGGG - Intronic
1158729181 18:60003803-60003825 CTGGAGACAGGGAAGCTGGACGG - Intergenic
1159961805 18:74560962-74560984 CTGCTGACCGGGGCGATGGGTGG + Exonic
1160034155 18:75285885-75285907 GTGCTGACGGGGCAGGTGGGGGG - Exonic
1160139402 18:76307626-76307648 TTGCTGACTGGGAGGAAGGATGG - Intergenic
1160762690 19:793568-793590 CTGCTCATGGGGAGGAGGGACGG + Intergenic
1161039291 19:2101485-2101507 CTGCTGACCAGGAAGACGGGTGG + Exonic
1161294611 19:3513349-3513371 CTGCCCACGGGGAAGCTGCAAGG - Intronic
1161399812 19:4062240-4062262 CTGCTGGGGGGACAGATGGAGGG + Intronic
1161641147 19:5424029-5424051 TGGCTGAGTGGGAAGATGGATGG - Intergenic
1162136421 19:8558079-8558101 CTGCTGAGGGGCAAGGTGAAGGG - Intronic
1162301876 19:9849128-9849150 CTGCGGACGGGGGAGATGAGCGG + Exonic
1162412846 19:10517114-10517136 CTGCTGCCGGGCAAGCTGGGCGG - Intronic
1165144264 19:33721487-33721509 ATGGTGAGTGGGAAGATGGATGG + Intronic
1166279370 19:41780774-41780796 CTGGTGATGGGGGAGGTGGAAGG + Intergenic
1166317011 19:41994674-41994696 CTGCAGGAGGGGAAGTTGGAAGG + Intronic
1166398398 19:42459547-42459569 CTGCTGGCTTTGAAGATGGAAGG + Intergenic
1167625938 19:50589257-50589279 CTGCTGACTTTGAAAATGGAAGG + Intergenic
1168021627 19:53612988-53613010 GTGTTTACAGGGAAGATGGAGGG + Intergenic
925437665 2:3854474-3854496 CTGCTTATGGGAAAGAGGGAAGG + Intergenic
926625095 2:15084619-15084641 CTCCAGAAGTGGAAGATGGAAGG - Intergenic
928084916 2:28339992-28340014 CAGCTGACAGGCAAGATGGGAGG - Intergenic
928136733 2:28693512-28693534 GTGCTGGGGGGGAAGTTGGAGGG - Intergenic
928378541 2:30798874-30798896 CTGCTGACAAGGAACAAGGAAGG + Intronic
930450303 2:51527504-51527526 CTGCTGACTTGGAAGATGTAAGG - Intergenic
934971956 2:98770941-98770963 GTGATGACCGGGAAGATGGACGG - Intergenic
935503242 2:103868146-103868168 CTGCTGGTTTGGAAGATGGATGG + Intergenic
935657467 2:105437095-105437117 CTGCTGAAAGGCAAGATGGTGGG + Intronic
935800693 2:106692305-106692327 CTGCAGAAGGGGCAGGTGGAGGG + Intergenic
937219436 2:120333308-120333330 CTGCTGAAGAGGTAGTTGGATGG - Intergenic
937242827 2:120473652-120473674 CTGCTGACTGGGAAAATGAGGGG - Intergenic
937323793 2:120976846-120976868 CTGCTCCCTGGAAAGATGGATGG + Intronic
937645435 2:124261313-124261335 CTGCTGAGAGGGAAGATTGTTGG - Intronic
937735820 2:125287540-125287562 CTGCTGCTGGGGAAGCTGCATGG + Intergenic
937863896 2:126733523-126733545 CGTCTGATGGGGAAGATGGGTGG + Intergenic
941163650 2:162062664-162062686 TTGCTGACTTGGAAGATGGAGGG - Intronic
941320828 2:164052136-164052158 CTGCTGGCTTTGAAGATGGAGGG - Intergenic
942502808 2:176609786-176609808 CTGCAGACGGGGATGAATGAGGG - Intergenic
942603144 2:177661781-177661803 ATGCTGAAAGGGAATATGGAAGG - Intronic
943520393 2:188942643-188942665 CTGCTGACTTTGAAGATGGGAGG - Intergenic
945881383 2:215328408-215328430 CTGCTGAGGGGGCAGATAGGAGG - Intronic
945924255 2:215787753-215787775 CTGGCCACGGAGAAGATGGACGG + Intergenic
946247661 2:218396700-218396722 CAGCTGAAGGAGGAGATGGATGG + Exonic
946268179 2:218567226-218567248 CTGCTGAAAGGTAAAATGGAAGG - Intronic
946421106 2:219565346-219565368 TTGCTGGTGGTGAAGATGGATGG - Exonic
946687946 2:222290763-222290785 CTGCTGGAGGGGGAGAAGGAGGG + Intronic
947670726 2:231933924-231933946 CTGGTGGCGGGAAAGAAGGAAGG - Intergenic
948534743 2:238637513-238637535 CTGCTGGCCTGGAAGAAGGAAGG + Intergenic
948598100 2:239093281-239093303 CTGCTTTCGGGGAAGGTGGCTGG + Intronic
948993262 2:241565070-241565092 CAGCTGACGGGGAATGTGGGCGG + Intronic
1169189870 20:3651772-3651794 CTCCTGTAGGGGAAGATGGCAGG + Intergenic
1169912208 20:10656087-10656109 GTGCTGATGGGCTAGATGGAGGG - Intronic
1169956186 20:11105555-11105577 CAGCTAACCGGGAAGATGGTAGG + Intergenic
1170633842 20:18088027-18088049 TTGCTGACTTTGAAGATGGAAGG - Intergenic
1171488541 20:25500767-25500789 CTGCTGCAGAGGAGGATGGATGG - Intronic
1172890569 20:38260883-38260905 CTGCTGAGGGGGTGGACGGAGGG - Intronic
1173357595 20:42308510-42308532 CTTCTGAGGGGGAAGAGGGTTGG - Intronic
1174703234 20:52630385-52630407 ATGCTGGCTGTGAAGATGGAGGG + Intergenic
1175182672 20:57159687-57159709 GTGCTGGCTGTGAAGATGGAGGG + Intergenic
1175943159 20:62547176-62547198 CTGCTGAGGGTGAGGGTGGAGGG - Intergenic
1176315919 21:5243771-5243793 CTCCTGGCGGGGAAGAAAGAAGG - Intergenic
1178258115 21:31073965-31073987 CTGCTGGCTTTGAAGATGGAGGG - Intergenic
1178626803 21:34225201-34225223 ATGCTGATGGAGGAGATGGAAGG + Intergenic
1178901492 21:36602600-36602622 AAGCTGATGGGGAAAATGGAAGG - Intergenic
1179979074 21:44887138-44887160 CTGCTGACAGAGAAGAAGGCAGG + Intronic
1180393716 22:12309712-12309734 CTCCTGGCAGGGAAGAAGGAAGG - Intergenic
1180406029 22:12555036-12555058 CTCCTGGCAGGGAAGAAGGAAGG + Intergenic
1181462587 22:23094373-23094395 CTGCTGGCAGGAAAGGTGGATGG + Intronic
1183344669 22:37300758-37300780 GGGCTGACGGGGAAGTGGGATGG - Intronic
1183730096 22:39613688-39613710 CTGCTGACCAGGTAGGTGGAAGG - Intronic
1183732602 22:39627231-39627253 AGGCTGAGGGGGGAGATGGAAGG - Intronic
1184463626 22:44655946-44655968 TTGCTGGCTGTGAAGATGGAGGG + Intergenic
1184607973 22:45585331-45585353 CTGCTGGCTGGGACAATGGACGG - Intronic
950969014 3:17167967-17167989 CTGCGGATGGGGAAGCTGCAGGG + Intronic
952413802 3:33072562-33072584 CTGCTGAAGATGAAGATGGCTGG - Exonic
952885659 3:38009771-38009793 CTGCTGAAGGGGAAGAAGCTCGG - Exonic
953412113 3:42696523-42696545 CTGCAGCCTGGGAGGATGGAGGG - Intronic
953531775 3:43746045-43746067 CTGCTGGCTTTGAAGATGGAGGG + Intergenic
956463737 3:69498055-69498077 ATGCTGCCGAGGAAGCTGGATGG + Intronic
956976928 3:74591701-74591723 TTCCTGACAGGGAAGATGTATGG + Intergenic
960101267 3:113745942-113745964 CAGCAGGCGGGGAAGATGAAAGG - Exonic
960305397 3:116054157-116054179 CTGCTGGCTTTGAAGATGGAAGG - Intronic
960404015 3:117238002-117238024 CTGCTGATGGGGAATGTGGGAGG - Intergenic
961090038 3:124103136-124103158 CTGCTGACAGGGAAGGTGGCTGG - Intronic
961319866 3:126064984-126065006 CTGCTGCCTTTGAAGATGGAAGG + Intronic
961333989 3:126159277-126159299 CTGGTGACGGGGCAGGAGGAGGG - Intronic
961578144 3:127855426-127855448 CTGCTGGCTCTGAAGATGGAGGG - Intergenic
961868532 3:129971974-129971996 CTCCTGAAGGGTAAGATGGCTGG - Intergenic
962872515 3:139509932-139509954 CTCCTGGAAGGGAAGATGGAGGG - Intergenic
964982144 3:162698126-162698148 CTGCTGGTGCCGAAGATGGATGG - Intergenic
965927548 3:174000876-174000898 CTGCTGAGTGGGCAGATGGGTGG + Intronic
969761510 4:9187686-9187708 TTGCTGAGGAGGAAGAGGGAAGG - Intergenic
970554877 4:17220985-17221007 CTGCTGACAGGGCAAGTGGAGGG - Intergenic
971766046 4:30833367-30833389 CTGCTGACTTTGAAGATGGAAGG - Intronic
972292095 4:37698751-37698773 CTGCTGACTTCAAAGATGGAGGG + Intergenic
972388001 4:38586451-38586473 CTGCTGACTTTGAGGATGGAAGG - Intergenic
973931153 4:55793926-55793948 CTGGGGATGGGGAAGAGGGACGG + Intergenic
975218800 4:71789873-71789895 TTGCTGACTTTGAAGATGGAAGG + Intronic
975228172 4:71899211-71899233 CTGTTGAAGGGGTAGATGGTGGG - Intergenic
975887485 4:78982679-78982701 CTGCTGACCTTGAAGATGAAGGG + Intergenic
982000060 4:151014577-151014599 GTGATGACGGGGGAGGTGGAGGG - Exonic
983111838 4:163760165-163760187 CTGCTGGCTGTGAAGATGGAAGG - Intronic
985870211 5:2548514-2548536 CTGCTCATGGGGAAGACTGAGGG - Intergenic
986579619 5:9251813-9251835 CTCCTGATGGGGAAGATGGCTGG + Intronic
988449442 5:31326123-31326145 TTGGTGATGGGAAAGATGGAAGG + Exonic
988874098 5:35424793-35424815 CTGCTGGCTGCGAGGATGGAAGG + Intergenic
989069247 5:37493345-37493367 TTGCTGACCCTGAAGATGGAGGG - Intronic
991402925 5:66273126-66273148 CTGCTGAAGGGGAAGCTGGAAGG - Intergenic
992877961 5:81076447-81076469 CCGCTGATGGGGCAGATGGGAGG + Intronic
992877983 5:81076574-81076596 CCGCTGATGGGGCAGATGGGAGG + Intronic
995061685 5:107817435-107817457 CTGCTAAGGTGGGAGATGGAGGG + Intergenic
995598194 5:113768992-113769014 CTGCTTTAGGGGAAGAGGGAAGG + Intergenic
996094982 5:119389015-119389037 CTGCTGTCCGTGGAGATGGAGGG + Intronic
998168350 5:139857210-139857232 CTACCGACTGGGAAGATAGACGG + Intronic
998188325 5:140000365-140000387 CTGCGGCAGGGGAAGCTGGAAGG - Intronic
1000217695 5:159179234-159179256 CTGCTGACGTAAAAGAAGGAAGG + Intronic
1001562341 5:172677827-172677849 CTGGTGAGGGGGCTGATGGAGGG - Intronic
1002303359 5:178269776-178269798 ATGCTGACTGGATAGATGGATGG - Intronic
1002340515 5:178513775-178513797 GTGCTGACCGTGAAGATGGAGGG - Intronic
1002688801 5:181036560-181036582 GGGCTGCCGGGGAAGGTGGATGG + Intergenic
1003626220 6:7744134-7744156 CAGCTGAATGGGAAAATGGATGG - Intronic
1003757862 6:9142350-9142372 ATGCTGGCTTGGAAGATGGAAGG - Intergenic
1004905625 6:20234718-20234740 CTGCTGGCTTTGAAGATGGAAGG - Intergenic
1006984156 6:38166548-38166570 GTGCGGAGGGGGAAGGTGGAGGG - Intergenic
1007332864 6:41127619-41127641 ATGCTGAGGGTGAACATGGAGGG + Intergenic
1007357319 6:41331300-41331322 ATTCTAACGGGGAACATGGAGGG - Intergenic
1010752527 6:79631334-79631356 CTGCCGTCGGGGAAGATCGCTGG - Exonic
1011479965 6:87784118-87784140 TTGCTGGCTGTGAAGATGGAGGG + Intergenic
1012692831 6:102336406-102336428 TTGCTGACTTTGAAGATGGAAGG - Intergenic
1013524572 6:110962469-110962491 CTCCTGACAGAGAAGAAGGAAGG + Exonic
1014212433 6:118720919-118720941 TTGCTGACTTTGAAGATGGAAGG + Intergenic
1014975685 6:127879736-127879758 GTGCAGTCGGGGAAGAAGGATGG + Intronic
1016038950 6:139411990-139412012 CAGCTGAATGGGAAGCTGGAAGG + Intergenic
1016377751 6:143441004-143441026 CTGCTGGCTTTGAAGATGGAGGG + Intronic
1017335662 6:153256645-153256667 CTACTGGCTTGGAAGATGGAAGG + Intergenic
1019844156 7:3480234-3480256 TTGCTGGCTGTGAAGATGGAAGG + Intronic
1019875351 7:3806093-3806115 CTGCTGACTTTGAAGATGGTGGG - Intronic
1021837690 7:24696485-24696507 CTGCTGGCTCTGAAGATGGAAGG - Intergenic
1022339757 7:29456917-29456939 CTGCAGATGGGGAAGATGAAGGG - Intronic
1025744951 7:64234416-64234438 TTGCTGACTTTGAAGATGGAGGG + Intronic
1025752006 7:64301986-64302008 TTGCTGACTTGGAAGATGGAGGG - Intergenic
1026437112 7:70408649-70408671 CTGCTGACTGGGGAGGTGGTGGG - Intronic
1028456156 7:91040151-91040173 CTGCAGACAGGGCAGGTGGAAGG - Intronic
1028776759 7:94685811-94685833 CTGTTGAGGGGGCGGATGGAGGG + Intergenic
1029037680 7:97539413-97539435 CTGCTTAGGAGGAAGATGGATGG + Intergenic
1029457662 7:100679225-100679247 CTGCTGAGGGGGTGGATGGTGGG + Intergenic
1030324574 7:108205555-108205577 CTGCTGAAGGGCTAGATGGATGG + Intronic
1030951299 7:115793256-115793278 CTGCTGGCAGAAAAGATGGAAGG - Intergenic
1033068567 7:138180255-138180277 CTGCTGTCTTTGAAGATGGAAGG + Intergenic
1034449955 7:151131997-151132019 CTGCCGACGGGGACCAGGGACGG + Intronic
1034697642 7:153068157-153068179 CTGCAGAAGAGGAAGCTGGAAGG + Intergenic
1035593075 8:833053-833075 CTGCTCATGGGGATGATGGGAGG - Intergenic
1035797943 8:2376470-2376492 CTGGTGAAGGGGAAGCTGGCAGG + Intergenic
1036020465 8:4839154-4839176 CTGATGAAGGGAAAGAAGGATGG - Intronic
1036271611 8:7309515-7309537 TTGCTGAGGAGGAAGAGGGAAGG - Intergenic
1036349737 8:8000835-8000857 TTGCTGAGGAGGAAGAGGGAAGG + Intergenic
1036845011 8:12161356-12161378 TTGCTGAGGAGGAAGAGGGAAGG + Intergenic
1036866380 8:12403677-12403699 TTGCTGAGGAGGAAGAGGGAAGG + Intergenic
1038197362 8:25380744-25380766 CTGATGGCTGGGAATATGGAGGG - Intronic
1038930584 8:32189230-32189252 CTACTGAGGGGGAAGACGGAAGG - Intronic
1038980694 8:32756275-32756297 CTGGTGATGAGGAAGAGGGAAGG - Intronic
1039392095 8:37189518-37189540 GTGCTGCATGGGAAGATGGAAGG + Intergenic
1040455508 8:47593862-47593884 CTGCTGAGGGGTAGGAGGGAAGG + Intronic
1041231399 8:55756764-55756786 CTGCTGAGGGGGAAGAGAGGAGG + Intronic
1041775619 8:61519736-61519758 CTGCTGGCTCTGAAGATGGAAGG + Intronic
1042057504 8:64781554-64781576 TTGCTGGCTTGGAAGATGGATGG - Intronic
1043760717 8:84063947-84063969 CTGCTGCCGGGGATGGAGGAGGG + Intergenic
1046259755 8:111752059-111752081 ATGCTGACTTTGAAGATGGAGGG - Intergenic
1046854800 8:119019029-119019051 CTGCAGAAGGGGAAGATAGTAGG - Intronic
1047208895 8:122824920-122824942 CTGCTGGCTTTGAAGATGGACGG - Intronic
1047853008 8:128879295-128879317 TTGCTGATGTTGAAGATGGAAGG + Intergenic
1047890431 8:129302920-129302942 CTGCTGCTGTGGAAGATGGGGGG + Intergenic
1053386556 9:37695727-37695749 CTGCTGATGGGGTGGATGCAGGG - Intronic
1055307245 9:74942687-74942709 CTGCTGGCTTTGAAGATGGAAGG - Intergenic
1055749787 9:79492310-79492332 CTGCAGACTGGGAAGATCAAAGG - Intergenic
1055913226 9:81374601-81374623 CTGCTGAGTGGGAAGGTGGGAGG - Intergenic
1057819763 9:98321965-98321987 TTGCTGAAGGGGAAGAAAGAGGG - Intronic
1059603591 9:115808775-115808797 CTGCTGCCAAGGAAAATGGATGG + Intergenic
1185755145 X:2647315-2647337 CTGCTGGCTTTGAAGATGGAGGG - Intergenic
1187842858 X:23506728-23506750 CTGCTCACTGGGAAGATTGGTGG + Intergenic
1187909706 X:24100122-24100144 TTGCTGACTTTGAAGATGGAAGG - Intergenic
1187915684 X:24150225-24150247 CTGCTGCAGGGGACGATAGAGGG + Intronic
1189057049 X:37708325-37708347 CTGCTGGCTTTGAAGATGGAGGG + Intronic
1192580777 X:72279119-72279141 CTGCTGAGGGGTAAAGTGGATGG - Intronic
1192800825 X:74463111-74463133 CTGCAGAGGGAGAGGATGGATGG + Intronic
1194186993 X:90783461-90783483 CTGGTGACTGGGAAGATGAGTGG + Intergenic
1195543450 X:106088308-106088330 CTGCTGGGGTGGATGATGGAGGG + Intergenic
1195637224 X:107131956-107131978 CTTCTGACAGAGAAGAAGGAAGG + Intronic
1195833822 X:109089703-109089725 CTGCTGGCTGGCAAGATGGCTGG - Intergenic
1196284916 X:113868281-113868303 ATGCTGACAGTGAAGATGAAAGG + Intergenic
1200255557 X:154580693-154580715 CTGCAGGCGGGGAGGAGGGAAGG - Intergenic
1200262212 X:154623711-154623733 CTGCAGGCGGGGAGGAGGGAAGG + Intergenic
1200533582 Y:4365538-4365560 CTGGTGACTGGGAAGATGAGTGG + Intergenic
1200884574 Y:8254570-8254592 CTGCTGCTGGGTAAGATGGCAGG - Intergenic
1202232081 Y:22668675-22668697 CTGCTGCTGGGAAAGATGGCAGG + Intergenic
1202311075 Y:23527483-23527505 CTGCTGCTGGGAAAGATGGCAGG - Intergenic
1202559727 Y:26143111-26143133 CTGCTGCTGGGAAAGATGGCAGG + Intergenic