ID: 1102297450

View in Genome Browser
Species Human (GRCh38)
Location 12:111747956-111747978
Sequence GTTCACCTGATTCCAAGGCC CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 193
Summary {0: 1, 1: 0, 2: 1, 3: 12, 4: 179}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1102297443_1102297450 10 Left 1102297443 12:111747923-111747945 CCCAGCCAGCAAGTAGAGAACCC 0: 1
1: 0
2: 2
3: 7
4: 175
Right 1102297450 12:111747956-111747978 GTTCACCTGATTCCAAGGCCCGG 0: 1
1: 0
2: 1
3: 12
4: 179
1102297440_1102297450 25 Left 1102297440 12:111747908-111747930 CCTGGGGTATGAGCCCCCAGCCA 0: 1
1: 0
2: 1
3: 24
4: 217
Right 1102297450 12:111747956-111747978 GTTCACCTGATTCCAAGGCCCGG 0: 1
1: 0
2: 1
3: 12
4: 179
1102297442_1102297450 11 Left 1102297442 12:111747922-111747944 CCCCAGCCAGCAAGTAGAGAACC 0: 1
1: 0
2: 0
3: 12
4: 158
Right 1102297450 12:111747956-111747978 GTTCACCTGATTCCAAGGCCCGG 0: 1
1: 0
2: 1
3: 12
4: 179
1102297441_1102297450 12 Left 1102297441 12:111747921-111747943 CCCCCAGCCAGCAAGTAGAGAAC 0: 1
1: 0
2: 3
3: 14
4: 167
Right 1102297450 12:111747956-111747978 GTTCACCTGATTCCAAGGCCCGG 0: 1
1: 0
2: 1
3: 12
4: 179
1102297447_1102297450 -10 Left 1102297447 12:111747943-111747965 CCCAGAGTCAAAGGTTCACCTGA 0: 1
1: 0
2: 1
3: 8
4: 139
Right 1102297450 12:111747956-111747978 GTTCACCTGATTCCAAGGCCCGG 0: 1
1: 0
2: 1
3: 12
4: 179
1102297444_1102297450 9 Left 1102297444 12:111747924-111747946 CCAGCCAGCAAGTAGAGAACCCA 0: 1
1: 0
2: 1
3: 6
4: 120
Right 1102297450 12:111747956-111747978 GTTCACCTGATTCCAAGGCCCGG 0: 1
1: 0
2: 1
3: 12
4: 179
1102297439_1102297450 30 Left 1102297439 12:111747903-111747925 CCTTGCCTGGGGTATGAGCCCCC 0: 1
1: 0
2: 0
3: 19
4: 185
Right 1102297450 12:111747956-111747978 GTTCACCTGATTCCAAGGCCCGG 0: 1
1: 0
2: 1
3: 12
4: 179
1102297445_1102297450 5 Left 1102297445 12:111747928-111747950 CCAGCAAGTAGAGAACCCAGAGT 0: 1
1: 0
2: 1
3: 17
4: 111
Right 1102297450 12:111747956-111747978 GTTCACCTGATTCCAAGGCCCGG 0: 1
1: 0
2: 1
3: 12
4: 179

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1102297450 Original CRISPR GTTCACCTGATTCCAAGGCC CGG Intronic
901223811 1:7600421-7600443 GTTATCCTGATACCAAAGCCTGG - Intronic
901876952 1:12172275-12172297 GTTTATCTGATTCAGAGGCCGGG - Intronic
903236795 1:21955764-21955786 GTCCAGCTGACTCCAAGCCCGGG + Intergenic
903549502 1:24148116-24148138 GCCCATCTGACTCCAAGGCCTGG + Intergenic
903693385 1:25190280-25190302 ATTAACATGATTCCAAGTCCAGG + Intergenic
903757396 1:25672159-25672181 GTTGTTCTGATTCCAAGGGCAGG + Intronic
904496223 1:30888345-30888367 CTTCAAGTGATTCCAAGGTCAGG - Intronic
904683792 1:32246895-32246917 GGTCTCCTGACTCCCAGGCCAGG + Intergenic
906944823 1:50286753-50286775 GTTCACTTTATTCTAAGCCCTGG + Intergenic
907582400 1:55583976-55583998 CTTCACCTCAGTCCAAGCCCTGG - Intergenic
908791761 1:67789793-67789815 CTTCCTCTGAGTCCAAGGCCTGG - Intronic
909747768 1:79120107-79120129 ATACACCTGAATCCAAAGCCTGG + Intergenic
910599347 1:89014134-89014156 GTCCATCTGCTTCCAAGTCCAGG + Exonic
910603659 1:89058892-89058914 GTCCATCTGCTTCCAAGTCCAGG + Exonic
911585445 1:99684897-99684919 GTCCACCTGATTCCACAGCTAGG + Intronic
913003439 1:114604945-114604967 GTTTTCCTGATTCAAAGGACTGG - Exonic
918372322 1:183873510-183873532 GTCCAACTGACTCCAAGACCTGG + Intronic
918967902 1:191375268-191375290 CATCACCTGATACCAAAGCCTGG - Intergenic
922273524 1:224056063-224056085 ATTCACCTGATTTCAATTCCTGG - Intergenic
922507889 1:226137065-226137087 GATCAGCTGATCCCAAGGACAGG + Intergenic
923076122 1:230610270-230610292 GGTCTCCTGCATCCAAGGCCAGG - Intergenic
1063890428 10:10622770-10622792 TATCACCTGCTTCCAAAGCCAGG - Intergenic
1068462269 10:57343350-57343372 GTTCATCTGGTTCCATGGCTTGG - Intergenic
1069681439 10:70288438-70288460 GTTCACCTGACTGCAGGGCTGGG + Intergenic
1070048851 10:72866818-72866840 GGTCTCCTGATTTCTAGGCCTGG - Intronic
1070111770 10:73494208-73494230 ATTCAGCTCATTCCAATGCCTGG + Intronic
1070286097 10:75085090-75085112 GTCCACCCGTGTCCAAGGCCCGG + Intergenic
1072558223 10:96541924-96541946 GTTTACCTGATTCCAGTTCCTGG - Intronic
1073444537 10:103572664-103572686 GGTCACCTGACTCCCAGCCCAGG + Intronic
1075098077 10:119486184-119486206 GTCAATCTGATTCCAAGGTCTGG + Intergenic
1076425174 10:130362681-130362703 GTGCATGTGCTTCCAAGGCCTGG + Intergenic
1076510786 10:131012405-131012427 TTGCACCTGCTTCCAGGGCCTGG - Intergenic
1081545915 11:44071414-44071436 GGTCTCCTGATTCCCAGGCCAGG - Intronic
1084963164 11:72727761-72727783 GTTTACCCAATTCCAGGGCCAGG - Intronic
1086176181 11:83893701-83893723 GTTTACCTGATTCCAACTCATGG - Intronic
1086500430 11:87447336-87447358 GTTTCCCTGACTCCAAGTCCAGG + Intergenic
1087844823 11:102961161-102961183 GTGCATCTGACTCCAAGGCCTGG - Intergenic
1088180796 11:107107469-107107491 ATTAACCTGATACCAAAGCCAGG + Intergenic
1089237190 11:117039878-117039900 GTTTTCCTGACTCCAAAGCCTGG + Intronic
1089865074 11:121624512-121624534 GTGCTTCTGATTTCAAGGCCAGG + Intronic
1090026951 11:123175838-123175860 TTCCACCTGATGCAAAGGCCAGG - Intronic
1090131175 11:124143853-124143875 GTTCACTTGATTCATTGGCCTGG - Intronic
1090131946 11:124152697-124152719 CTCCATCTGATTCCAAGGACTGG + Intergenic
1090921000 11:131205692-131205714 GTCTACCTGATTCCAAGGCCTGG + Intergenic
1091274000 11:134337834-134337856 GTTCAACTGAATCCAAATCCAGG - Intronic
1092035002 12:5326565-5326587 GGTCTCCTGATTCCCAGGTCAGG + Intergenic
1092534983 12:9379092-9379114 GTTTTCCTGGTTCCTAGGCCAGG + Intergenic
1098329433 12:69337499-69337521 GCTGACTTGATTGCAAGGCCTGG + Intergenic
1098752555 12:74313833-74313855 ATTACCCTGATTCCAAAGCCAGG + Intergenic
1098886772 12:75968589-75968611 GTTCTCCAGATTCCAATTCCAGG - Intergenic
1102297450 12:111747956-111747978 GTTCACCTGATTCCAAGGCCCGG + Intronic
1102583839 12:113909513-113909535 GTCCACCTGACTCCAATGGCTGG + Intronic
1103783126 12:123412827-123412849 GCAGGCCTGATTCCAAGGCCCGG - Exonic
1105560102 13:21482349-21482371 GTTCTCCTCAATCCAAGGCCAGG - Intergenic
1108033008 13:46256489-46256511 CTTCATCTGGTTTCAAGGCCTGG - Intronic
1110206322 13:72918613-72918635 GATCACTTGAGGCCAAGGCCAGG - Intronic
1112434908 13:99384929-99384951 GCCGACCTGCTTCCAAGGCCTGG + Intronic
1113725277 13:112594176-112594198 ATTAACCTGATACCAAAGCCAGG + Intergenic
1113952849 13:114081292-114081314 GCTGACCTGGCTCCAAGGCCAGG - Intronic
1115596904 14:34918194-34918216 CTTGCCCTGATTCCAAGTCCTGG - Intergenic
1118498401 14:66332100-66332122 GTTCACATGATTGCGAAGCCTGG + Intergenic
1120406989 14:84102786-84102808 GTTCCACAGATTCCAAGGGCAGG - Intergenic
1121019351 14:90569681-90569703 CTTCACAGGACTCCAAGGCCTGG - Intronic
1121965149 14:98296837-98296859 CTTTATCTGATTCTAAGGCCAGG + Intergenic
1122080078 14:99261040-99261062 GTTCACCCGATTCCAAAGAACGG + Intronic
1127166284 15:56246820-56246842 GGTCTTCTGACTCCAAGGCCAGG - Intronic
1130051140 15:80484864-80484886 GTTCATCTGACTCCAAGTACAGG - Intronic
1132598430 16:763526-763548 GTTCAGCTACTTCCCAGGCCTGG - Intronic
1132998468 16:2836638-2836660 GTTCACCTGGTGCCTGGGCCGGG - Intronic
1133856035 16:9550135-9550157 GGTCACCTGACCCCAAAGCCTGG + Intergenic
1133864549 16:9630276-9630298 TATCAGCTGATTCCATGGCCAGG - Intergenic
1135781701 16:25308743-25308765 ATTACCCTGATTCCAAAGCCAGG - Intergenic
1136499591 16:30663828-30663850 GGTCTCCTGACTCCCAGGCCAGG + Intronic
1138693900 16:58793337-58793359 GTCTGCCTGATTCCAAGCCCAGG - Intergenic
1141765461 16:86055591-86055613 ATTATCCTGATTCCAAAGCCAGG + Intergenic
1141890184 16:86921087-86921109 GTTCACCAGATTCTGAGCCCCGG - Intergenic
1144705366 17:17364312-17364334 CTTCCCCAGATTCCCAGGCCTGG + Intergenic
1147260379 17:39206650-39206672 GGACACCTGCTTCCCAGGCCTGG + Intergenic
1147448464 17:40489187-40489209 GTCTGTCTGATTCCAAGGCCTGG - Intronic
1149536293 17:57436145-57436167 GTTCATCTCATTCCAAAGCTCGG - Intronic
1150223064 17:63508033-63508055 GTTCACCAGACTCCAGGGACAGG - Intronic
1151682569 17:75629616-75629638 GTGCACCTCTTGCCAAGGCCTGG - Intronic
1158036472 18:53037707-53037729 GTCCACCTGATTTCAAAGACCGG - Intronic
1158491810 18:57916723-57916745 ATTCATCTCCTTCCAAGGCCAGG + Intergenic
1158531075 18:58262276-58262298 GTTCACCACATTCCAGTGCCAGG + Intronic
1161028743 19:2048408-2048430 GTTCCCCAGCTTCAAAGGCCCGG - Intronic
1161209728 19:3060150-3060172 TTTCTCCAGATTCCCAGGCCCGG + Intronic
1163738159 19:18994513-18994535 GTGCACCTGAGCCCAGGGCCTGG + Intronic
1167597835 19:50436600-50436622 GTACACCTGGGTCCAGGGCCGGG - Exonic
926575276 2:14573392-14573414 GGTCCCCTGACTCCCAGGCCAGG - Intergenic
926830699 2:16958985-16959007 GGCCTCTTGATTCCAAGGCCAGG + Intergenic
927037639 2:19196033-19196055 GGTCTTCTGATTCCAAGCCCTGG - Intergenic
930692753 2:54381154-54381176 GCTCTCCTGCTTTCAAGGCCTGG + Intronic
930710682 2:54548521-54548543 TTTTCCCTGATTCCAAGCCCTGG + Intronic
931444391 2:62314619-62314641 TGTCACCTGATCCAAAGGCCAGG + Intergenic
933493556 2:83019175-83019197 CTTCACCTGTTTCAAAGGGCAGG + Intergenic
933771012 2:85743888-85743910 GGTCTCCTGATTCCAACTCCAGG - Intergenic
934713660 2:96531044-96531066 GTCCACCTGACTCCAGAGCCGGG + Intergenic
936669557 2:114640848-114640870 CTTCCCCTCATTCCAAGACCGGG - Intronic
937999889 2:127724550-127724572 ATTCACCAGAGTCCAAGTCCAGG - Intronic
938108499 2:128549210-128549232 TCTCACATGATTCCAATGCCTGG - Intergenic
938113164 2:128583299-128583321 CATTACCTGATTCCAAAGCCAGG - Intergenic
939091804 2:137788645-137788667 GTTTATCTGACTCCAAAGCCTGG - Intergenic
941254175 2:163207073-163207095 ATTAACATGATTCCAATGCCAGG - Intergenic
944070149 2:195658126-195658148 GTTCAGCAGATTCCCAGACCCGG - Intronic
945496635 2:210515179-210515201 ATTCACCTGATACCAAAACCTGG - Intronic
946144818 2:217722668-217722690 GTTCCCCTGCTTCCACGTCCAGG - Intronic
946819800 2:223618068-223618090 GTTCACCTTGTTCCAAGCACAGG + Intergenic
1170659419 20:18322418-18322440 GTTCACGTGTTTTCAAGTCCTGG + Intergenic
1174056628 20:47802705-47802727 GGGCATCTGATTCCAGGGCCTGG - Intergenic
1177876087 21:26633279-26633301 GCTAACCTAATGCCAAGGCCTGG + Intergenic
1178242722 21:30921339-30921361 TTGCACCTCATTCCAAGTCCAGG + Intergenic
1179122013 21:38556640-38556662 GTAGACCTGTTTCCTAGGCCAGG - Intronic
1183099856 22:35577154-35577176 GTACACCTGATTTCCAGTCCTGG - Intergenic
952324178 3:32306247-32306269 GGTCACCTGATGGCAAGGCCAGG + Intronic
952775506 3:37042127-37042149 GTTAACCAGATTCCACAGCCAGG + Intronic
953017228 3:39089018-39089040 GGCCCCCAGATTCCAAGGCCAGG - Intronic
954325709 3:49862203-49862225 GTGCAGCTGATGCTAAGGCCAGG - Intronic
954654872 3:52188168-52188190 GATCACCTGAGGCCAGGGCCTGG + Intergenic
959654448 3:108785428-108785450 ATTCCCCTGATACCAAAGCCTGG + Intergenic
962742337 3:138370871-138370893 GTACACCTGATCCTAATGCCAGG - Intronic
963082121 3:141403630-141403652 ATTCAATTGATTCCAAGGCCTGG - Intronic
964481638 3:157144523-157144545 GTTCAAATGATTACAAAGCCAGG + Intergenic
965614787 3:170583515-170583537 GTTAACTTGATTCCAGGCCCAGG - Intronic
969207244 4:5656159-5656181 GGTCTTCTGACTCCAAGGCCAGG - Intronic
970134464 4:12906951-12906973 ATCCACCTGATACCAAAGCCTGG + Intergenic
973592316 4:52455034-52455056 GTTATCCTGATACCAAAGCCTGG - Intergenic
977461780 4:97334657-97334679 GATCACCTGTTTCCAAGCCTTGG - Intronic
979136937 4:117121483-117121505 GTTAAAATCATTCCAAGGCCAGG - Intergenic
980434662 4:132754322-132754344 GTTCACCTGATTACATGTACTGG + Intergenic
983064595 4:163193962-163193984 GTTCATCTGTTTCCATGGCTTGG - Intergenic
983617857 4:169727726-169727748 GTTCAGATGGTTCCAGGGCCTGG + Intergenic
985813012 5:2103956-2103978 GCTCACCTGACTCCAAAGCCAGG + Intergenic
986945938 5:13019724-13019746 ATTCACCTTATTCCAAAACCAGG - Intergenic
989376091 5:40762839-40762861 GTTGACCTAACTCCAAGACCTGG - Exonic
992230060 5:74655039-74655061 GCTCACCTGCTCCCATGGCCTGG - Intronic
993227956 5:85193450-85193472 GTTCACATGATTGCATTGCCAGG - Intergenic
994847071 5:105003046-105003068 GTTATCCTGATACCAAAGCCTGG - Intergenic
996749378 5:126873656-126873678 GGTCTCCTGGTTCCATGGCCAGG + Intronic
997897246 5:137730200-137730222 GTCTATCTGACTCCAAGGCCTGG + Intronic
999904846 5:156129408-156129430 GTCCATCTGACTCCAAGGCCTGG + Intronic
1001110612 5:168893221-168893243 GTTCACCTGATTCAAAAGGATGG + Intronic
1001800997 5:174543961-174543983 GCTCACCTGACTCCAAGCCCAGG + Intergenic
1002304203 5:178273837-178273859 GTGCATCTGACTCCAAAGCCAGG - Intronic
1004355579 6:14927525-14927547 TGTCACCTGATTCCAAGACAGGG + Intergenic
1005465953 6:26113511-26113533 GTTCTCCTCAATCCAAGGCCAGG - Intergenic
1007382424 6:41499450-41499472 GTTTACCTGCCTCCAAGGCCTGG + Intergenic
1010667348 6:78646157-78646179 GTTATCCTGATTCCAAAGCCTGG - Intergenic
1012184092 6:96191738-96191760 GTTATCCTGATACCAAAGCCTGG + Intronic
1016458404 6:144256439-144256461 ATTAACCTGATTCCAAAGACTGG - Intergenic
1016496508 6:144668651-144668673 CTTCACCTGATGGCAAGGGCAGG + Intronic
1017051772 6:150400061-150400083 GTTCACCTGAATCCCAAGCAGGG - Exonic
1017856915 6:158357660-158357682 GTTCCTCTGATGCCGAGGCCTGG + Intronic
1019990205 7:4684759-4684781 GTGCACCTGTTTCCACGGCAGGG - Intronic
1024118115 7:46211935-46211957 GTTCACCCTATGCCAAGCCCTGG + Intergenic
1024915744 7:54497617-54497639 GTTTCCCTGATGCCAGGGCCAGG + Intergenic
1026155562 7:67822744-67822766 GTTCACATCTTTCTAAGGCCAGG - Intergenic
1026361510 7:69605178-69605200 GATCACCAGATTCCAAGATCTGG - Intronic
1032519026 7:132528666-132528688 GTCCACCTGTTTACAATGCCTGG + Intronic
1033588297 7:142790348-142790370 AATCACCAGATTCAAAGGCCTGG + Intergenic
1036917051 8:12814257-12814279 GTTCTGCTGATTCCAAGGGGTGG + Intergenic
1037561928 8:20083139-20083161 CTGCACCTGATTTCAAGTCCAGG + Intergenic
1037903258 8:22700649-22700671 GAACTCCTGATTCCCAGGCCAGG - Intergenic
1038173604 8:25161234-25161256 GATGTCCTGATTCCAAGCCCTGG + Intergenic
1038230222 8:25692705-25692727 GTTCAAGTGATTCCAAGCCTTGG - Intergenic
1038521992 8:28241885-28241907 GGTGATTTGATTCCAAGGCCAGG - Intergenic
1038571639 8:28667613-28667635 GTGCTTCTGATTCCAAAGCCTGG - Intronic
1038692342 8:29774663-29774685 GTTCATCTGACACCAATGCCAGG + Intergenic
1038777839 8:30546910-30546932 GGTCACCTGCCTCCCAGGCCTGG + Intronic
1040829430 8:51661009-51661031 CTTCCCCTGACTCCAAGGCCGGG - Intronic
1041871825 8:62643549-62643571 GTGCAGCTTAATCCAAGGCCTGG + Intronic
1042793910 8:72639167-72639189 GTTCATCAGTTTCCAAGGTCAGG - Intronic
1044619202 8:94172657-94172679 GTTCATCTGCTTCCAAATCCAGG + Intronic
1050475883 9:6040760-6040782 TATCACCTGATACCAAAGCCAGG - Intergenic
1051237924 9:15021415-15021437 GTTCAGATGGTTCCAGGGCCTGG - Intergenic
1051371982 9:16366482-16366504 CTTGAGCTTATTCCAAGGCCAGG + Intergenic
1051679793 9:19595557-19595579 GTTTTCCTGCTTCCAAAGCCCGG + Intronic
1052313622 9:27094011-27094033 GCTTTTCTGATTCCAAGGCCTGG + Intergenic
1058664302 9:107296187-107296209 GTGCACCTGGTTCCAAAGTCTGG + Intronic
1059763374 9:117360700-117360722 GCCAACCTGATTTCAAGGCCTGG + Intronic
1060825476 9:126685225-126685247 TTCCATCTGCTTCCAAGGCCTGG - Intronic
1061081026 9:128370427-128370449 GTTTACCTGCTTACAAGGCAGGG + Intergenic
1061780664 9:132994372-132994394 CTTCTCCTGATTCCAAGAGCTGG - Intergenic
1186452751 X:9687113-9687135 GTTCACCTGATTCGAATATCTGG + Intronic
1186646706 X:11514472-11514494 GTTCTGCTGATGCCACGGCCAGG - Intronic
1189993188 X:46613736-46613758 TATCTCCTGTTTCCAAGGCCTGG - Intronic
1191859282 X:65652729-65652751 GTTCTCCTGACTCCCAGGCTAGG - Intronic
1192226509 X:69231880-69231902 CTGGATCTGATTCCAAGGCCAGG + Intergenic
1193733543 X:85130127-85130149 ATTATCCTGATTCCAAAGCCTGG - Intergenic
1196505836 X:116440666-116440688 GTTTACCTGGCTCCAATGCCTGG + Intronic
1199910573 X:152282377-152282399 GTTCAATTGATCCCAGGGCCAGG - Intronic
1200247454 X:154533713-154533735 GTTCACCTGGTTCAAGGGCATGG + Intronic
1201489296 Y:14524172-14524194 GATCACCTGATACCTAGACCAGG - Intronic