ID: 1102297451

View in Genome Browser
Species Human (GRCh38)
Location 12:111747957-111747979
Sequence TTCACCTGATTCCAAGGCCC GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 152
Summary {0: 1, 1: 0, 2: 1, 3: 13, 4: 137}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1102297440_1102297451 26 Left 1102297440 12:111747908-111747930 CCTGGGGTATGAGCCCCCAGCCA 0: 1
1: 0
2: 1
3: 24
4: 217
Right 1102297451 12:111747957-111747979 TTCACCTGATTCCAAGGCCCGGG 0: 1
1: 0
2: 1
3: 13
4: 137
1102297445_1102297451 6 Left 1102297445 12:111747928-111747950 CCAGCAAGTAGAGAACCCAGAGT 0: 1
1: 0
2: 1
3: 17
4: 111
Right 1102297451 12:111747957-111747979 TTCACCTGATTCCAAGGCCCGGG 0: 1
1: 0
2: 1
3: 13
4: 137
1102297447_1102297451 -9 Left 1102297447 12:111747943-111747965 CCCAGAGTCAAAGGTTCACCTGA 0: 1
1: 0
2: 1
3: 8
4: 139
Right 1102297451 12:111747957-111747979 TTCACCTGATTCCAAGGCCCGGG 0: 1
1: 0
2: 1
3: 13
4: 137
1102297448_1102297451 -10 Left 1102297448 12:111747944-111747966 CCAGAGTCAAAGGTTCACCTGAT 0: 1
1: 0
2: 0
3: 13
4: 93
Right 1102297451 12:111747957-111747979 TTCACCTGATTCCAAGGCCCGGG 0: 1
1: 0
2: 1
3: 13
4: 137
1102297442_1102297451 12 Left 1102297442 12:111747922-111747944 CCCCAGCCAGCAAGTAGAGAACC 0: 1
1: 0
2: 0
3: 12
4: 158
Right 1102297451 12:111747957-111747979 TTCACCTGATTCCAAGGCCCGGG 0: 1
1: 0
2: 1
3: 13
4: 137
1102297441_1102297451 13 Left 1102297441 12:111747921-111747943 CCCCCAGCCAGCAAGTAGAGAAC 0: 1
1: 0
2: 3
3: 14
4: 167
Right 1102297451 12:111747957-111747979 TTCACCTGATTCCAAGGCCCGGG 0: 1
1: 0
2: 1
3: 13
4: 137
1102297444_1102297451 10 Left 1102297444 12:111747924-111747946 CCAGCCAGCAAGTAGAGAACCCA 0: 1
1: 0
2: 1
3: 6
4: 120
Right 1102297451 12:111747957-111747979 TTCACCTGATTCCAAGGCCCGGG 0: 1
1: 0
2: 1
3: 13
4: 137
1102297443_1102297451 11 Left 1102297443 12:111747923-111747945 CCCAGCCAGCAAGTAGAGAACCC 0: 1
1: 0
2: 2
3: 7
4: 175
Right 1102297451 12:111747957-111747979 TTCACCTGATTCCAAGGCCCGGG 0: 1
1: 0
2: 1
3: 13
4: 137

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1102297451 Original CRISPR TTCACCTGATTCCAAGGCCC GGG Intronic
900438221 1:2641297-2641319 TGCACCTGATGTCCAGGCCCAGG - Intronic
901814356 1:11785365-11785387 TTCACCTGTTTCCAAGGGGCTGG - Intronic
902266602 1:15271379-15271401 TTCCCCTGGTTGCAGGGCCCTGG - Intronic
902827779 1:18988873-18988895 CTTACCTGAGTCCAAAGCCCAGG - Intergenic
905108438 1:35577485-35577507 TTTCTCTGATTCCAGGGCCCTGG - Intronic
905318443 1:37098339-37098361 GTCACCTGACTCCAAAGCCTTGG - Intergenic
906310826 1:44753058-44753080 CTCACCTGAGCCCATGGCCCTGG - Intronic
906810962 1:48826533-48826555 TTCATCTGATTCCTAGGCTCTGG - Intronic
908791760 1:67789792-67789814 TTCCTCTGAGTCCAAGGCCTGGG - Intronic
909747769 1:79120108-79120130 TACACCTGAATCCAAAGCCTGGG + Intergenic
915980482 1:160416950-160416972 TTGACCTGCTCCCAAGGCCCAGG - Intronic
916118152 1:161505636-161505658 ATCCCCTGCTTCCAGGGCCCAGG - Intronic
917643404 1:177006074-177006096 TTCACCTGAATGCTAGGCCCTGG + Intronic
919060820 1:192630007-192630029 TTCACTTTCTGCCAAGGCCCGGG - Intergenic
920668438 1:207983787-207983809 TTCTCCTGTGTCCAAGTCCCAGG - Intergenic
1066540508 10:36441808-36441830 TTCACAGGATTGCAGGGCCCTGG - Intergenic
1068866323 10:61898939-61898961 TTCATCTGATTACAAGGCTGCGG + Intergenic
1076248310 10:128964855-128964877 GTCAACTGATGCCTAGGCCCAGG + Intergenic
1076434406 10:130430308-130430330 TTAACCAAATTCCCAGGCCCAGG - Intergenic
1076523403 10:131095056-131095078 GTCAGCTGATTCACAGGCCCTGG + Intronic
1077979179 11:7282386-7282408 TGCAACTGATTCCATGGTCCTGG + Intronic
1078087916 11:8245285-8245307 CTCACCAGAGTCCAAGTCCCTGG - Intronic
1079609554 11:22414998-22415020 TTTCCTTGATTCCAAGGACCAGG - Intergenic
1081545914 11:44071413-44071435 GTCTCCTGATTCCCAGGCCAGGG - Intronic
1087085520 11:94214191-94214213 CTCACCTGAGTCCCAGCCCCTGG - Intergenic
1087566737 11:99869222-99869244 TTCACCAAATTCACAGGCCCAGG - Intronic
1088820715 11:113454464-113454486 CTCATCTGATTCCAAAGCCCTGG + Intronic
1089388994 11:118087143-118087165 TTCCCTGGAGTCCAAGGCCCTGG - Intronic
1089586092 11:119510704-119510726 TTCACCCAATTCCAAGAGCCAGG - Intergenic
1091317304 11:134623708-134623730 TTCACCAGATCCCAAGCCCTAGG + Intergenic
1096502000 12:52069925-52069947 CTCACCAGATCCCACGGCCCCGG - Intronic
1096749380 12:53748919-53748941 CCCACCTGAGTCCCAGGCCCTGG - Intergenic
1099428671 12:82553977-82553999 TTCACCCTATCCCAAAGCCCAGG - Intergenic
1102297451 12:111747957-111747979 TTCACCTGATTCCAAGGCCCGGG + Intronic
1102727395 12:115077783-115077805 CTCACCTGCTGCCAGGGCCCAGG + Intergenic
1103006065 12:117421250-117421272 TCCACCTGCCTCCAAGACCCAGG - Intronic
1103469367 12:121167620-121167642 TTCAGGTAACTCCAAGGCCCAGG + Exonic
1103783125 12:123412826-123412848 CAGGCCTGATTCCAAGGCCCGGG - Exonic
1106432849 13:29697740-29697762 TCCACCTGTTTCCAAAGTCCTGG + Intergenic
1106523751 13:30521377-30521399 CTCCCCTGACTCCAAGCCCCTGG + Intronic
1106644082 13:31614341-31614363 CTCACATGCTACCAAGGCCCAGG + Intergenic
1107152530 13:37128680-37128702 TTAACCTGACTACAAGGTCCTGG - Intergenic
1108033007 13:46256488-46256510 TTCATCTGGTTTCAAGGCCTGGG - Intronic
1109482866 13:62979235-62979257 TTCACCTGACTACCTGGCCCTGG + Intergenic
1115654446 14:35429926-35429948 TTCCCCTGAAGACAAGGCCCGGG - Intergenic
1118486913 14:66223140-66223162 TTTATCTGACTCCAAAGCCCTGG - Intergenic
1119003174 14:70901565-70901587 TTCATCTGATTCCAGCCCCCAGG + Intergenic
1122080079 14:99261041-99261063 TTCACCCGATTCCAAAGAACGGG + Intronic
1122232949 14:100316181-100316203 CTCACCTGGATCCAAGGCACAGG - Intergenic
1127358634 15:58225745-58225767 TCCTCCTGTTGCCAAGGCCCAGG - Intronic
1128591280 15:68899731-68899753 CACACCTGATTCCAAGGCCATGG - Intronic
1128889429 15:71317678-71317700 TTCACATGATTCCAAGGAAGAGG + Intronic
1130137766 15:81196220-81196242 TCCACCTGTCTCCAAAGCCCAGG - Intronic
1130736897 15:86559865-86559887 GTCTCCTGCTTCCAAAGCCCAGG - Intronic
1131530560 15:93187735-93187757 TCCATCTGATTCCAGAGCCCAGG - Intergenic
1135781700 16:25308742-25308764 TTACCCTGATTCCAAAGCCAGGG - Intergenic
1136069632 16:27780014-27780036 TTCTCCAGCTTCCAAGCCCCCGG + Exonic
1139732245 16:68956485-68956507 TTCACCTGTTCCCAAGGGTCTGG + Intronic
1140474206 16:75230617-75230639 TTCAGCTGACTCCTAGGCACGGG - Intronic
1140610411 16:76592107-76592129 TTCACCTGGTTCCAAAAGCCTGG - Intronic
1141612487 16:85190584-85190606 TTAACAGGACTCCAAGGCCCAGG + Intergenic
1141780008 16:86153030-86153052 GACAGCTGATGCCAAGGCCCTGG + Intergenic
1143252647 17:5534592-5534614 TCCACCTGAGTCCCAGGCCCTGG + Intronic
1144425312 17:15135709-15135731 AGCACCTGAGTCCCAGGCCCTGG + Intergenic
1145086674 17:19948212-19948234 TCCACCTGCTTCCAAGTCCTTGG - Intronic
1146603448 17:34237976-34237998 TTCACCTGGTTGCATGGCCTTGG + Intergenic
1150774423 17:68067873-68067895 TTCAGGTGATTCTAGGGCCCCGG - Intergenic
1150834289 17:68550717-68550739 TCCCCGTGATCCCAAGGCCCAGG - Intronic
1151868814 17:76822638-76822660 TCCACCTCATTCTAAAGCCCAGG - Intergenic
1153967807 18:10197331-10197353 TCCAGCTGACTCCAAGGCCAAGG - Intergenic
1155531705 18:26773911-26773933 TTGCTCTGATTCCAAGGTCCCGG - Intergenic
1157290031 18:46403167-46403189 TTCACAAGATTCCAATGGCCTGG - Intronic
1158036471 18:53037706-53037728 TCCACCTGATTTCAAAGACCGGG - Intronic
1158415754 18:57248483-57248505 TACAGTTGATTCCCAGGCCCTGG + Intergenic
1164950434 19:32332131-32332153 TTCACTAGATTCTAAGGTCCAGG + Intergenic
1168621907 19:57886278-57886300 GTCACCTGACTCCAGGGCCAAGG - Intronic
926121957 2:10246163-10246185 TTCATCCAATTCCATGGCCCAGG - Intergenic
927310891 2:21629988-21630010 TTCTGCTTATTCCAGGGCCCTGG - Intergenic
930710683 2:54548522-54548544 TTTCCCTGATTCCAAGCCCTGGG + Intronic
931108382 2:59083101-59083123 ACCACCTGGTTCCAAAGCCCAGG + Intergenic
931135545 2:59395523-59395545 TTCACATGATCCAAAAGCCCAGG - Intergenic
931166521 2:59754851-59754873 TGAAGCTGATTCCAAGGCCCTGG - Intergenic
932615197 2:73227096-73227118 TTCACCTGGCTCCATGGTCCAGG - Exonic
934946526 2:98546442-98546464 TTCCCCTGATCCCACAGCCCTGG - Intronic
937905619 2:127051426-127051448 TTCAGCTGCTTCCCCGGCCCAGG - Intronic
941254174 2:163207072-163207094 TTAACATGATTCCAATGCCAGGG - Intergenic
944983564 2:205149680-205149702 TTCATATGTTTCCAAGTCCCAGG - Intronic
945325626 2:208479283-208479305 TTCACCTTATTAAAAGACCCAGG - Intronic
946218373 2:218204261-218204283 ATCACTTGAGTCCAGGGCCCAGG + Intergenic
946339497 2:219058703-219058725 TTCCCCTCAGACCAAGGCCCTGG - Intronic
947970944 2:234324055-234324077 TTCAGCTGATTCCATAGTCCAGG - Intergenic
1168857478 20:1018899-1018921 TTTACCTGAAACCAAGGTCCAGG - Intergenic
1173458783 20:43225118-43225140 GTCACGTGTTTCCAAAGCCCTGG + Intergenic
1175958892 20:62625147-62625169 AACACGTGAATCCAAGGCCCAGG + Intergenic
1176215367 20:63945253-63945275 TTGGCCTGATCCCAGGGCCCAGG - Intronic
1178242723 21:30921340-30921362 TGCACCTCATTCCAAGTCCAGGG + Intergenic
1181580736 22:23826816-23826838 CTCAGCTGTTTCCCAGGCCCGGG - Intronic
1183346089 22:37309151-37309173 TCCACCCGAGTCCAAGGCCTAGG - Intronic
1183546665 22:38457845-38457867 GTCTCCTGATGCCAAGTCCCTGG + Intergenic
950964891 3:17139258-17139280 ATCAACAGATTCCACGGCCCTGG + Intergenic
953227894 3:41037162-41037184 TGCACTTGATTCCAAGGCTCAGG + Intergenic
953754186 3:45632485-45632507 AGCACTTCATTCCAAGGCCCAGG - Intronic
953835962 3:46344366-46344388 ACTACCTGATTCCAAGGCACAGG - Intergenic
954553725 3:51502657-51502679 TTCCCCTGCCTCCTAGGCCCTGG - Intergenic
954996367 3:54885410-54885432 TTTTCCTGATTCCAAGGCAAAGG + Intronic
955487434 3:59448781-59448803 ATAACCTGATTCCTAGGCCCAGG + Intergenic
961666357 3:128495659-128495681 ACCACCCGATCCCAAGGCCCTGG + Intergenic
963082120 3:141403629-141403651 TTCAATTGATTCCAAGGCCTGGG - Intronic
965835334 3:172845263-172845285 TTCACCTGTTTTCAAGTCCAAGG - Intergenic
966236182 3:177704279-177704301 TTCACCTGTTTGAAAGGCACAGG - Intergenic
971350698 4:25853365-25853387 TTCACCTGTTTCAAAGTCTCAGG + Intronic
971590449 4:28461200-28461222 TTTACTTGATTGAAAGGCCCAGG + Intergenic
974828207 4:67155971-67155993 TTCATCTGAGTTCAAAGCCCAGG - Intergenic
979773399 4:124558127-124558149 ATCAACTCATTGCAAGGCCCAGG - Intergenic
986945937 5:13019723-13019745 TTCACCTTATTCCAAAACCAGGG - Intergenic
992762124 5:79959948-79959970 TTCCCCTGATTCCAAGACCCTGG + Intergenic
996688912 5:126316617-126316639 TTAACCTGATGCCTAGTCCCTGG + Intergenic
997194879 5:131972620-131972642 TTCACATGATTACAGGGCACTGG + Intronic
999113935 5:149145070-149145092 TACACTTGATTCCATGACCCAGG + Intronic
1001800998 5:174543962-174543984 CTCACCTGACTCCAAGCCCAGGG + Intergenic
1002089139 5:176794213-176794235 TTCCCCTAATGCCAAGGACCAGG - Intergenic
1004065761 6:12242306-12242328 CTCGCCTGATTGCAAGGACCAGG + Intergenic
1008233637 6:49016256-49016278 TTCAAGTCATTCCAAGGTCCGGG - Intergenic
1014484076 6:121977746-121977768 TTCTCCTGACTCTCAGGCCCTGG - Intergenic
1015629273 6:135215296-135215318 TTTCCTGGATTCCAAGGCCCTGG + Intronic
1016078735 6:139829812-139829834 TTGTAATGATTCCAAGGCCCTGG - Intergenic
1016496509 6:144668652-144668674 TTCACCTGATGGCAAGGGCAGGG + Intronic
1017822217 6:158057651-158057673 CTCAACTGGTTCCAAAGCCCAGG - Intronic
1023813234 7:43928503-43928525 TTCACCTGCTTCAAAGTCCTAGG - Intronic
1024527102 7:50358016-50358038 TTCACCTGGTTGCAAGCCCCTGG + Intronic
1027217241 7:76191900-76191922 TGCCCAGGATTCCAAGGCCCTGG - Intergenic
1028902344 7:96115644-96115666 TTCACCTGGTCCTCAGGCCCTGG + Intergenic
1033588298 7:142790349-142790371 ATCACCAGATTCAAAGGCCTGGG + Intergenic
1034297127 7:149983947-149983969 TTCCCCTTATCCCAAGCCCCTGG - Intergenic
1040323767 8:46330986-46331008 GGCACCTTATTCCAAAGCCCTGG - Intergenic
1042339260 8:67661766-67661788 TTCCCCTTCTTCCCAGGCCCTGG + Intronic
1042843491 8:73147875-73147897 TTCAGTGGATTCCATGGCCCTGG + Intergenic
1044371909 8:91421805-91421827 TTCACTTAATTCCCATGCCCTGG + Intergenic
1047061696 8:121234269-121234291 CTTATCTGTTTCCAAGGCCCTGG - Intergenic
1051227669 9:14918989-14919011 TTCTCCTGCCTCCAAGTCCCTGG - Intergenic
1059284787 9:113163015-113163037 TCCACCTTATTCCCAGCCCCTGG + Exonic
1059708753 9:116848047-116848069 TTCACCTGGGTTCAAGGCGCTGG + Intronic
1061056330 9:128224755-128224777 TTCACCTGTCTCCAAGGCTAAGG - Intronic
1061736482 9:132663946-132663968 TTCACCTGATTTACAGACCCAGG + Intronic
1061823298 9:133240513-133240535 TACTCCTCATTCCCAGGCCCAGG + Intergenic
1062438022 9:136555462-136555484 TTCACCTGAATCCCAGGGGCTGG - Intergenic
1062544303 9:137054708-137054730 TTCACCTCAGTACAGGGCCCAGG - Intergenic
1192151018 X:68712520-68712542 CTCACCCCCTTCCAAGGCCCTGG - Intronic
1192226510 X:69231881-69231903 TGGATCTGATTCCAAGGCCAGGG + Intergenic
1195328504 X:103777303-103777325 TTCCCTTGGTTCCAAGGCCCTGG + Intronic
1195433051 X:104811001-104811023 TTCAAATGCTTGCAAGGCCCAGG - Intronic
1198113228 X:133521304-133521326 TACACCTTCTCCCAAGGCCCTGG - Intergenic