ID: 1102298822

View in Genome Browser
Species Human (GRCh38)
Location 12:111756844-111756866
Sequence GCTGTGGGACGTGCTTGCTC TGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 123
Summary {0: 1, 1: 0, 2: 2, 3: 7, 4: 113}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1102298809_1102298822 29 Left 1102298809 12:111756792-111756814 CCCTCTCTCTCTGCCTGTGGGAA 0: 1
1: 0
2: 2
3: 65
4: 649
Right 1102298822 12:111756844-111756866 GCTGTGGGACGTGCTTGCTCTGG 0: 1
1: 0
2: 2
3: 7
4: 113
1102298810_1102298822 28 Left 1102298810 12:111756793-111756815 CCTCTCTCTCTGCCTGTGGGAAT 0: 1
1: 0
2: 3
3: 31
4: 461
Right 1102298822 12:111756844-111756866 GCTGTGGGACGTGCTTGCTCTGG 0: 1
1: 0
2: 2
3: 7
4: 113
1102298812_1102298822 16 Left 1102298812 12:111756805-111756827 CCTGTGGGAATCTGGACACATTT 0: 1
1: 0
2: 1
3: 20
4: 211
Right 1102298822 12:111756844-111756866 GCTGTGGGACGTGCTTGCTCTGG 0: 1
1: 0
2: 2
3: 7
4: 113

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1102298822 Original CRISPR GCTGTGGGACGTGCTTGCTC TGG Exonic
900818693 1:4869908-4869930 GCTGTGGGATCTGCTTGCTGGGG - Intergenic
900959372 1:5909466-5909488 GCTGTGAGACCTGCTGGCCCAGG - Intronic
901445663 1:9306406-9306428 GCTGTGGGAGGTGCATGGACCGG + Intronic
904287217 1:29460446-29460468 GCTGTGGGCAGTGTCTGCTCTGG + Intergenic
906231600 1:44169408-44169430 GCTCTGGGAAGTGCATGCTTTGG + Intergenic
906924815 1:50103929-50103951 GCTGTTGCACGTGAATGCTCTGG + Intronic
906996933 1:50806470-50806492 GCTGTGGTATGTGCTTCCACTGG - Intronic
907045931 1:51300011-51300033 GCTGTTGAAGGTGCTTCCTCAGG - Intronic
913217567 1:116633236-116633258 GAGGTGGGAAGTGCTTGATCCGG - Intronic
915520167 1:156437222-156437244 GCTGTGGGAGGTATTTGTTCTGG - Intergenic
917205424 1:172566030-172566052 GCAGTGGGAGGGGCTTGCACAGG + Intronic
921060111 1:211578459-211578481 GCTGTCGGACGTGCTGGCGCTGG - Exonic
922563948 1:226589163-226589185 GCTTTGGGAGGTGCTGGGTCTGG - Intronic
1062793950 10:328128-328150 GCTGTGCGTCCTCCTTGCTCAGG - Intronic
1067848048 10:49738512-49738534 GCACTGAGACGTGCTTTCTCTGG + Intronic
1070776351 10:79112136-79112158 GCAGTGGGACGTGCTGGCAGTGG + Intronic
1074288295 10:112119169-112119191 GCTGGGGGTGGGGCTTGCTCAGG - Intergenic
1076285133 10:129288165-129288187 GCTGTGGGTTGTGCTTGCTGGGG + Intergenic
1076513316 10:131027562-131027584 GCTGTGGGTGGTGCTTGGCCAGG - Intergenic
1080302347 11:30798547-30798569 GCTGAGGGTTGTGTTTGCTCAGG - Intergenic
1094495548 12:30987222-30987244 GGTGTGGGAGGTGCCAGCTCAGG + Intronic
1096526595 12:52213586-52213608 GCTGTGCCACCTGCTGGCTCAGG + Intergenic
1096867566 12:54573996-54574018 GCTCTGGGACAGGCTTACTCTGG + Intronic
1096972851 12:55681570-55681592 GCTGTGGGACCTGCGCCCTCTGG + Exonic
1099969838 12:89489568-89489590 TCTGTGGGACATTATTGCTCAGG - Intronic
1101275941 12:103201339-103201361 GCTTTGTGAAGTGCTTGCTTTGG + Intergenic
1102298822 12:111756844-111756866 GCTGTGGGACGTGCTTGCTCTGG + Exonic
1102557259 12:113735372-113735394 GCTCAGGGACGTGTTTGATCAGG + Intergenic
1103328011 12:120134462-120134484 GCTGTGGGCCGAGCCTGCGCTGG - Intronic
1107939981 13:45374837-45374859 GCTTTGGGACCCGCTGGCTCAGG + Intergenic
1107948796 13:45443719-45443741 CCTTTGGGAGGTGCTTGCTTTGG + Intergenic
1111851707 13:93584045-93584067 ACTGAGGCACATGCTTGCTCAGG - Intronic
1113839432 13:113350414-113350436 GCTGTGGGATGTGTGTGCTATGG - Intronic
1121455750 14:94038058-94038080 GCTGCAGGACAGGCTTGCTCTGG + Intronic
1121792548 14:96709975-96709997 GCTGTGGGACCTGCAGGCTGGGG - Intergenic
1121808942 14:96862056-96862078 GCGGAGGGAGGTGGTTGCTCTGG - Intronic
1123058015 14:105581569-105581591 CCTGTGGGCCGTGCTTGTGCTGG + Intergenic
1129062829 15:72873919-72873941 GCTGGGCCACGTGCCTGCTCTGG + Intergenic
1129822676 15:78615536-78615558 GCTGTGTGACCAGCTTGCTTTGG - Intronic
1130294871 15:82639303-82639325 GCTGTGTGTGGTGGTTGCTCCGG - Intronic
1131258373 15:90875986-90876008 GCTGTTGGCCTTGTTTGCTCAGG + Intronic
1134046608 16:11105650-11105672 GCTGGGGGAAGTGCTAGCTTTGG - Intronic
1136672717 16:31873064-31873086 CCTCTGGGCCGTGCTGGCTCAGG - Intergenic
1137557747 16:49483507-49483529 GCCCTGGTCCGTGCTTGCTCGGG + Intergenic
1138098976 16:54236370-54236392 GCTCTGGGAGGCCCTTGCTCAGG + Intergenic
1138627547 16:58264544-58264566 GCTGCGGGAGGTGCTTCATCTGG + Intronic
1140353129 16:74281518-74281540 GCTGTGGGAGTGGCTTTCTCTGG - Intergenic
1140475179 16:75236223-75236245 GCTCTGGGACGAGCCGGCTCTGG + Intronic
1142860172 17:2756181-2756203 GCTGTGGGTGGTGCCTTCTCGGG - Intergenic
1144809343 17:17988764-17988786 GCTGTGGGCCGTGGTGGCTTAGG + Intronic
1145777467 17:27539363-27539385 GCTGAGGGAAGTGCTGGCCCAGG - Intronic
1147743641 17:42682502-42682524 GCTGAGGCACGCGCTTGCGCGGG + Intronic
1150311183 17:64130294-64130316 GATGTGGGAGGGGCTGGCTCGGG + Intronic
1151937196 17:77269843-77269865 GCTGTGGGACGAGATTGCTCAGG - Intergenic
1152136121 17:78504717-78504739 GCCGGGGGACGCGCTTGCTGGGG + Intronic
1157618400 18:49001433-49001455 GCTCAGGGCCGAGCTTGCTCAGG + Intergenic
1159887898 18:73927017-73927039 CCTGTGGGACAAGTTTGCTCTGG - Intergenic
1162392904 19:10400200-10400222 TCTGTGGGCCCTGCTTGCTGGGG - Intronic
1163215206 19:15871400-15871422 GCTATGGGAGGTGCTTGAGCAGG - Intergenic
1163535113 19:17872412-17872434 GCTGTGGGTCGGGCTGGCTCGGG + Exonic
1164280384 19:23763345-23763367 GCTGCGTGAAGAGCTTGCTCAGG - Intronic
1166096330 19:40541585-40541607 GCTGAGGGAGGTACTGGCTCGGG + Intronic
1167521901 19:49960252-49960274 GAAGTGGGAGGTGCTTGGTCTGG + Exonic
1167523483 19:49970470-49970492 GAAGTGGGAGGTGCTTGGTCTGG - Intergenic
1168239374 19:55081570-55081592 GCTGCGGGACGGGCGTTCTCTGG + Intronic
925635060 2:5934729-5934751 GCTGGGGGACATGGGTGCTCTGG + Intergenic
927894945 2:26775630-26775652 GCTGACTGTCGTGCTTGCTCAGG - Exonic
929040539 2:37740080-37740102 GCTGTGGGACAGGCCTGCCCTGG - Intergenic
931407353 2:61992451-61992473 CCTGTGGGATGTTCTTGGTCAGG + Intronic
939989247 2:148861833-148861855 CCTGTGGGAGGTGCTGTCTCTGG + Intergenic
940846758 2:158650686-158650708 GCAGTGGGAAGTGGGTGCTCAGG - Intronic
943667953 2:190630274-190630296 GCAGTGAGACGAGATTGCTCTGG - Intergenic
946245126 2:218383037-218383059 TCTCTGGGAGGTGCTTGCTGTGG - Exonic
948894055 2:240920059-240920081 GCTGGGGGACCTGCTGGCCCAGG + Exonic
948997391 2:241589589-241589611 GCTGTGGGACAACCTTGCTGGGG + Intronic
1175362983 20:58429338-58429360 GCTGTTGGACCTGCTACCTCAGG + Intronic
1175794856 20:61765231-61765253 GCTGTGGGAGGTCCATCCTCGGG - Intronic
1176143014 20:63553496-63553518 GCGGTGGGAGGAGCCTGCTCTGG + Intronic
1176265457 20:64206827-64206849 ACTGTGGGACGTGCTGGCCCAGG + Intronic
1182599755 22:31451863-31451885 TCTGTGTGAAGTGCTTTCTCTGG + Intronic
1183409553 22:37646920-37646942 GCTGTGGCAGGTGCCTGATCCGG + Exonic
1184347774 22:43923995-43924017 GGTGCGGGGCGTGCTCGCTCAGG - Exonic
963674774 3:148296369-148296391 GCGGTGGGAGGTGCTTGCTCTGG - Intergenic
963838198 3:150078620-150078642 GGTGTTGCACGTGTTTGCTCTGG - Intergenic
964565787 3:158051151-158051173 GCTGTGAGCTCTGCTTGCTCTGG - Intergenic
965796776 3:172448435-172448457 GCTCTGGGACGTGACTGCGCTGG + Exonic
968581783 4:1398697-1398719 GCTGTGGGGCTGGCTTGGTCTGG + Intergenic
972829469 4:42798110-42798132 GCTGTGTGAGGTGCAAGCTCTGG + Intergenic
975401713 4:73945570-73945592 GATGTTGGACCTGCTTTCTCTGG + Intergenic
986336514 5:6759528-6759550 GCTGTGGGGTGAGCTTGCCCAGG + Intergenic
989167161 5:38443612-38443634 ATTGTGGGAAGTGTTTGCTCCGG + Intronic
992866589 5:80962053-80962075 GCTGTGGGAGGTGCTAGCAATGG + Intronic
999098043 5:148998785-148998807 GCTGCTGGAAGTGCTGGCTCTGG - Intronic
1000040099 5:157479104-157479126 GCTGTGGGTCATCCTTGCTGTGG - Exonic
1003638841 6:7859495-7859517 GATGTGTGCCGTGCTTCCTCTGG + Intronic
1006837084 6:37005574-37005596 GCAGTGGGAGGAGCCTGCTCGGG - Intergenic
1007816488 6:44528854-44528876 GTTGTGGGATGTGCTTGCCCAGG - Intergenic
1011990869 6:93515756-93515778 GCTGTGGGAAGTGATTGCATGGG + Intergenic
1013508317 6:110820861-110820883 GCTGTGGCACGATCTTGCTGTGG - Intronic
1022843910 7:34191153-34191175 GCTGTGGGACATGCTGGCCTAGG - Intergenic
1023286902 7:38630388-38630410 GCTTTGGGCTGTGCTTGCTACGG + Intronic
1025231019 7:57203379-57203401 GCTGCGAGAGGTGCGTGCTCGGG - Intergenic
1025929345 7:65981961-65981983 GCTGTGGGAGGTGCGATCTCGGG - Exonic
1026010965 7:66635841-66635863 GCTGTGGGAGCTGCTAGCTGGGG - Intronic
1026016228 7:66672948-66672970 GCTGTGGGAGCTGCTAGCTGGGG - Intronic
1028780706 7:94732948-94732970 GCTTTGGGATTTGTTTGCTCTGG - Intergenic
1034879142 7:154750394-154750416 ACTGTGGGATGTGGTTGCTACGG - Intronic
1044865022 8:96562469-96562491 CCTGTGGGACTTGGTAGCTCTGG + Intronic
1045294588 8:100862217-100862239 GCAGTGGGAGGTGCCTGCTGTGG - Intergenic
1045470184 8:102505426-102505448 GCTGTGGGAGGGGATTGCTGGGG - Intergenic
1048888031 8:138924346-138924368 GCTGTGGGAGGTTCCAGCTCAGG - Intergenic
1049827179 8:144676680-144676702 GATCTGGGACGAGCTTCCTCTGG - Intergenic
1057696087 9:97323894-97323916 GCTCTTGGACGTGCGTGCTGGGG + Exonic
1059068562 9:111110412-111110434 GCTCTGGGATGGGCTGGCTCTGG - Intergenic
1060410167 9:123394922-123394944 GCTGTGGGACCTGGCTGCCCGGG + Intronic
1060873356 9:127060663-127060685 GCTTTGGGACTTGCTGTCTCTGG + Intronic
1062412137 9:136430944-136430966 GCTGTGGGAGATGCCTGCCCTGG + Intronic
1186515971 X:10166375-10166397 GCTGCTGCACGTGCTTGCTAGGG - Intronic
1186952760 X:14645655-14645677 GCTGTGGTGTGTTCTTGCTCTGG - Intronic
1186965597 X:14783388-14783410 GCTGTGGGAAGTGCTTCATTGGG - Intergenic
1195002429 X:100654938-100654960 GCAGTGTGACTAGCTTGCTCAGG - Intronic
1197608061 X:128607392-128607414 GCAGTGGCAACTGCTTGCTCGGG + Intergenic
1199221869 X:145325985-145326007 GCTATTTGACGTGCTTGCTCTGG + Intergenic