ID: 1102299375

View in Genome Browser
Species Human (GRCh38)
Location 12:111759827-111759849
Sequence CAAATGGCCCAAATTCAAAT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 258
Summary {0: 1, 1: 0, 2: 3, 3: 16, 4: 238}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1102299375 Original CRISPR CAAATGGCCCAAATTCAAAT GGG Intronic
901110290 1:6787975-6787997 TAAATGGCCAAAATACAAAAGGG - Intronic
903042877 1:20544574-20544596 CAAACAGCCCAATTTCAAAATGG + Intergenic
903411572 1:23148060-23148082 CAAATGCCCCAAATTAAAATAGG + Intronic
905153624 1:35953814-35953836 CAAATGACCCAATTTAAAAATGG - Intronic
907678547 1:56541540-56541562 CAAGTGGCCCAAAGGCTAATAGG + Intronic
907989665 1:59567372-59567394 TAAACAGCCCAAATACAAATTGG - Intronic
908379296 1:63579879-63579901 CAAATAACCTAATTTCAAATGGG - Intronic
909716172 1:78709721-78709743 CAAATGACCCAATTTAAAAGTGG + Intergenic
910185356 1:84532889-84532911 CAAATTGCAAAAAATCAAATTGG + Intergenic
910193474 1:84618232-84618254 CAAATGGGCAAAATGCAAGTTGG + Intergenic
910322969 1:85970079-85970101 AAAATGCCCCAAAATAAAATAGG - Intronic
910784046 1:90974762-90974784 CAAATGAACCTAATTAAAATGGG - Intronic
910990406 1:93049931-93049953 CAAATTGCCCAATTTAAAAATGG - Intergenic
911903016 1:103528930-103528952 GAAATGACCCAAATTCTCATCGG + Intronic
912090396 1:106066385-106066407 CAAATAGCCCAATTAAAAATGGG + Intergenic
912412138 1:109486853-109486875 CTAAAGGCTCAGATTCAAATGGG + Intronic
914403406 1:147345137-147345159 TAAATGGGCTAAATGCAAATTGG + Intergenic
916755745 1:167768748-167768770 CAAATGGCCCCCATTCAATGAGG + Intronic
917381672 1:174417255-174417277 CAATGGGCCACAATTCAAATTGG - Intronic
918767198 1:188501394-188501416 AAAATGGCCCAAATTTTCATAGG - Intergenic
919470138 1:197968325-197968347 CAACTGACCCAAATTAAAAATGG - Intergenic
921585606 1:216942742-216942764 CAAATGGCCCCATTAAAAATTGG - Intronic
921730388 1:218571541-218571563 CAAATGGCCCACATTCAAGAAGG + Intergenic
922343037 1:224672804-224672826 AAAGTGGCCCTAATACAAATAGG + Intronic
922385956 1:225082780-225082802 CAGATGGGCCAATTTTAAATAGG + Intronic
923146969 1:231204940-231204962 TAATTGGCCCATATTCACATGGG - Intronic
923869857 1:237979896-237979918 AAAATGGCCTAAATTCCAACAGG + Intergenic
924699268 1:246434460-246434482 CAAATGACCCCAATACAAAATGG + Intronic
1064952491 10:20869538-20869560 GAAACAGCCCAAACTCAAATTGG - Intronic
1065439456 10:25735926-25735948 CAAATGACCCAATTAAAAATGGG + Intergenic
1066667159 10:37795298-37795320 CAAATGAACCATATTCAAAGAGG + Intronic
1069378095 10:67814671-67814693 CAAATAACCCAAATGCAAAATGG + Intronic
1070098882 10:73366407-73366429 CAAATTACCCAAATTAAAAATGG + Intergenic
1073081225 10:100862247-100862269 CAAATGTCCCAGATTCATGTTGG + Intergenic
1075957843 10:126539207-126539229 CTAAAGGCGCTAATTCAAATGGG - Intronic
1076436520 10:130448890-130448912 AAAATGGCCCAATTTAAAAATGG - Intergenic
1076810352 10:132883348-132883370 CAAATGGCCCATAAGCACATGGG + Intronic
1078286973 11:9966713-9966735 CAAATAGCCCAATTTCAAAATGG + Intronic
1078829558 11:14966488-14966510 CACAAGGCCCTAATTCCAATAGG + Intronic
1080170441 11:29295689-29295711 CAAATGGCTCAACTATAAATGGG + Intergenic
1080258915 11:30324022-30324044 CAATTGGCCCAAAGGCAAAGAGG - Intronic
1080906449 11:36550557-36550579 TAGATGACCCAAATTCAACTTGG + Intronic
1087184245 11:95170050-95170072 CAAATGGGACAAATTCATACTGG + Exonic
1088148760 11:106717541-106717563 AAAAATGTCCAAATTCAAATAGG + Intronic
1088745500 11:112801053-112801075 CAAAGGGCCCAAATAGAAAGGGG + Intergenic
1089669277 11:120041683-120041705 CAAATGACCCAATTTTAAAATGG + Intergenic
1090310909 11:125738043-125738065 AAAATGTCCCAAATTCGAAGAGG + Intergenic
1091358281 11:134955024-134955046 CAATTTGCCCAAATTCACACGGG - Intergenic
1091561040 12:1613738-1613760 CAAATCTCCCAAATGTAAATTGG + Intronic
1093076855 12:14768061-14768083 CAAATGTTCAAAATTCAAAAGGG + Intronic
1095684989 12:45023454-45023476 CAAATGGACCTATTTCCAATAGG + Intronic
1097831247 12:64226230-64226252 CAAATTGCCCAATTAAAAATTGG - Intergenic
1098453988 12:70651805-70651827 CAAATGTCCCAGATTCCAATAGG + Intronic
1098722221 12:73914546-73914568 TATATGGCCCATAATCAAATTGG - Intergenic
1099698486 12:86053739-86053761 CAAATGGTCCAATTAAAAATGGG + Intronic
1099723624 12:86397096-86397118 CAAATGTTCCAAATACTAATGGG - Intronic
1100230244 12:92599851-92599873 TAAATGCTCCAATTTCAAATGGG + Intergenic
1100649712 12:96571987-96572009 CCCATGGCCCAATTTGAAATAGG - Intronic
1101041872 12:100763573-100763595 CAAATGGCTGACTTTCAAATGGG + Intronic
1102299375 12:111759827-111759849 CAAATGGCCCAAATTCAAATGGG + Intronic
1102772143 12:115487272-115487294 AAAATAGCCCAAAGTAAAATGGG + Intergenic
1104649252 12:130519769-130519791 CAAATTGCCTAAATACAAATGGG + Intronic
1106984304 13:35326944-35326966 CAAATAGCCCAATTTAAAAATGG + Intronic
1107039074 13:35930275-35930297 CAAATGGGCATATTTCAAATAGG + Intronic
1109532542 13:63669514-63669536 CAAATAGCCCAATTTAAAAATGG + Intergenic
1111063110 13:83049991-83050013 CAAATCACCCAACTTCAAATGGG + Intergenic
1111736546 13:92147656-92147678 TAAATCGCCCAAATTCTGATGGG - Intronic
1114997798 14:28379008-28379030 CAAATAACCCAACTTAAAATGGG + Intergenic
1116514695 14:45790849-45790871 CATATTGACCAAATTCAAAAGGG + Intergenic
1120256717 14:82129659-82129681 CAACTGTCCCAAAGTCAAAAAGG - Intergenic
1120276555 14:82382228-82382250 CAAATGGCCCAATTAAAAACTGG + Intergenic
1120493573 14:85206136-85206158 CTAAGGGCCCAACATCAAATAGG - Intergenic
1124069777 15:26380552-26380574 CAGATGGCCACAATTAAAATAGG + Intergenic
1124113180 15:26812335-26812357 CAAATGTCCCAATTAAAAATTGG + Intronic
1124204158 15:27703136-27703158 AAAAGGGCCAAAATCCAAATGGG - Intergenic
1124928425 15:34095334-34095356 CAAATGTTTCAACTTCAAATAGG + Intronic
1132420421 15:101661234-101661256 TAAATGGCACAAACTCAAAGAGG - Intronic
1140756063 16:78067887-78067909 TAAATGGCTCAAATACATATTGG + Intergenic
1144074933 17:11708787-11708809 CAAATTGCCCAAATACATAATGG - Intronic
1144532308 17:16051140-16051162 AAAATGGACAAAATTAAAATAGG - Intronic
1144901695 17:18599453-18599475 CAAGTGGCCCACATTGATATTGG - Intergenic
1144929377 17:18846607-18846629 CAAGTGGCCCACATTGATATTGG + Intronic
1146460065 17:33039256-33039278 CACATGGACCAAATTCCATTAGG + Intronic
1148695384 17:49555446-49555468 CAGATGGCCCAAATCCCAGTAGG + Intergenic
1148752205 17:49951804-49951826 CAAACACCCCAAATTCAAGTCGG + Intergenic
1150022126 17:61628015-61628037 CAAATAACCCAATTTTAAATGGG - Intergenic
1150025706 17:61672076-61672098 CACATGGACCAAATTCTAACAGG + Intergenic
1203189865 17_KI270729v1_random:171306-171328 CAAATGGCTCAACATCGAATCGG - Intergenic
1153094060 18:1381425-1381447 CATAAGCCCCAAATTCAAGTGGG - Intergenic
1153450845 18:5226582-5226604 TAAATTGCTCAAAGTCAAATAGG + Intergenic
1154496656 18:14966214-14966236 CAATTTGCCCAAATTCACATGGG + Intergenic
1156635461 18:39022823-39022845 CAAGGGGCCCACATTAAAATGGG - Intergenic
1156945303 18:42822294-42822316 TAAATGGCCCTAATTATAATTGG + Intronic
1159637010 18:70817168-70817190 CAAACTGCCAAAATTCAAAAAGG + Intergenic
1165099384 19:33429797-33429819 CAAATGTCCCGATTGCAAATGGG + Intronic
925678161 2:6388181-6388203 TAAATGTCCCAATTTCAGATAGG - Intergenic
928191443 2:29173595-29173617 CAAAAGGCACAATTTCAAAGTGG - Intronic
930871102 2:56171898-56171920 CAAATGGCATAAATGCAAACAGG + Intergenic
932064709 2:68542461-68542483 CAAATTACCCAATTTGAAATTGG + Intronic
933053735 2:77634301-77634323 AAAATAGCCCAATTTAAAATGGG - Intergenic
933429370 2:82156057-82156079 AAAATTTCCCAAAATCAAATTGG - Intergenic
933456078 2:82521192-82521214 GAAGTGGCCTACATTCAAATTGG - Intergenic
933787560 2:85855759-85855781 CAAATAGCCCAATTAAAAATGGG + Intronic
934650315 2:96087408-96087430 CAAATGGTCCAATTTAAAAATGG + Intergenic
935231820 2:101105297-101105319 CAAATGACCCAATTAAAAATAGG + Intronic
936736327 2:115447236-115447258 TAAATGTCCCCATTTCAAATGGG - Intronic
937176178 2:119938013-119938035 CAAATGCCCAACATTCATATTGG - Intronic
939061453 2:137426956-137426978 CAAATAGCCCAATTTTAAAAGGG + Intronic
939910112 2:147971432-147971454 CAAATAACCCAAATTAAAAATGG + Intronic
941411198 2:165159272-165159294 CAAATGACCCAATTTAAAACTGG - Intronic
941922194 2:170862501-170862523 GGATTGGCCTAAATTCAAATGGG - Intergenic
942571418 2:177319018-177319040 CAAATAGCCCAAATTAAAAATGG + Intronic
943481153 2:188419532-188419554 CAAATGGCCCAATTAAAAAATGG - Intronic
943483742 2:188454625-188454647 CAAAAGGGTCTAATTCAAATTGG + Intronic
944302877 2:198144652-198144674 AAAATGGCCCAGATAAAAATTGG + Intronic
944489934 2:200248077-200248099 CAAATTGCCCAAAGTCACATAGG - Intergenic
945444742 2:209922972-209922994 CAAATTGCCCAATTTAAAGTGGG - Intronic
945478554 2:210317226-210317248 CAAATACCCCGAATTGAAATAGG + Intergenic
946594323 2:221289396-221289418 CATATAACCCAAATTCAAAGTGG + Intergenic
948498939 2:238376937-238376959 CAAATGCCCCAGTTTCAAAATGG - Intronic
1168730568 20:75704-75726 CAAATGGTCAAAAATCAAAGGGG + Intergenic
1169854299 20:10086728-10086750 CAATGGGCCCAAGTGCAAATGGG - Intergenic
1171078418 20:22152473-22152495 CAAATGGCCCAAGCTCCAAGTGG + Intergenic
1171309934 20:24137957-24137979 CAAAAGCCCCAACTTCATATTGG - Intergenic
1172180965 20:33003195-33003217 AAAATGGCCTAAAATCACATTGG - Intronic
1173528548 20:43751055-43751077 CAAATTTCCCATCTTCAAATGGG + Intergenic
1178820314 21:35968897-35968919 CAAGTCCCCCAAATTCAATTTGG - Intronic
1179125862 21:38589857-38589879 AAAATGACCCCAATTCAAAATGG - Intronic
1183141864 22:35949743-35949765 CAAATGGCCCAATTATAAAATGG - Intronic
1184713421 22:46266799-46266821 CAAACAGCCCAAATTTAAAGTGG - Intergenic
950321156 3:12054617-12054639 CAAATTGTCCAGATTAAAATAGG - Intronic
951431167 3:22608724-22608746 TAAATTGCCCAAAGTCAGATGGG + Intergenic
955667190 3:61363157-61363179 CAAATAACCCAAATTTAAAATGG + Intergenic
957478022 3:80752273-80752295 CAAAAGGCCCAAATTCATAGCGG + Intergenic
959675249 3:109027990-109028012 CATATATCCAAAATTCAAATAGG + Intronic
959819206 3:110712352-110712374 CAAAGGGCTCAAATACATATAGG + Intergenic
964229371 3:154445583-154445605 CAAATAGACCTAATTCATATGGG - Intergenic
966161956 3:176977994-176978016 CAGGTGGTCCAAATTCAGATTGG + Intergenic
966759664 3:183406392-183406414 CAAATGACCCAATTTAAAAATGG - Intronic
969899656 4:10337247-10337269 TCAATGGCTCAATTTCAAATGGG - Intergenic
970136951 4:12935801-12935823 TAAATGGACCTAATTAAAATGGG - Intergenic
970944637 4:21676518-21676540 CAACTAGTCCAAATTCAAAATGG + Intronic
971430307 4:26558273-26558295 AAAATGGACCAAATTAGAATTGG - Intergenic
971889626 4:32502285-32502307 CAAATGACCCAAATAGAAATTGG + Intergenic
972283427 4:37624768-37624790 AAAATGGCCCAAATTCCTAAGGG + Intronic
972460816 4:39300442-39300464 AGAATGGCCAAAATTCAAAACGG + Intronic
973547142 4:51993289-51993311 CTAGTTGCCCAAATTCATATAGG - Intergenic
973755262 4:54067673-54067695 CAAATGGCTCAAAACCAAACTGG + Intronic
974277804 4:59748521-59748543 CAAATAACCCAATTTAAAATTGG + Intergenic
974720906 4:65736983-65737005 CAAAGGGCCCCACTTAAAATTGG + Intergenic
975062858 4:70024652-70024674 AAAATGCCCCAAATGCAAACAGG - Intergenic
975242204 4:72073790-72073812 GAAATGGTATAAATTCAAATTGG + Intronic
975575929 4:75862461-75862483 CAAATAGCCCAATTTAAAAATGG + Intronic
977211626 4:94224762-94224784 CAACTTGCCCAAAGTCATATAGG - Intronic
977719346 4:100221979-100222001 CAAATGGGTAAAATTCAAAAAGG - Intergenic
978385984 4:108175714-108175736 CAAATGTCCTAAATTAAAAGTGG + Intergenic
979731370 4:124027088-124027110 CCAATGGCCCAATGACAAATAGG - Intergenic
981125773 4:141104641-141104663 TCAATGTCCCAAATCCAAATTGG + Intronic
981445736 4:144836384-144836406 CAAATAACCCAATTTAAAATGGG - Intergenic
981821980 4:148897634-148897656 CAAATGCACCCATTTCAAATGGG + Intergenic
982196072 4:152915811-152915833 CAAATGGCTCAATTTGAAATGGG + Intronic
985470393 5:39151-39173 CAAATGACCCAATTAAAAATGGG + Intergenic
986818006 5:11433848-11433870 TAAAGGTACCAAATTCAAATAGG + Intronic
988657204 5:33225447-33225469 AGAATGACCCAAATTCAAAGAGG - Intergenic
989288651 5:39734674-39734696 CAAATAGCCCAATTAGAAATTGG - Intergenic
989986482 5:50705024-50705046 CAAATGGGCAAATTTCAAACTGG + Intronic
990524817 5:56614635-56614657 GAAATGGGACAAATACAAATAGG - Intergenic
991604075 5:68382803-68382825 CAAATGACCCCATTTCACATTGG + Intergenic
991949486 5:71933623-71933645 CAAATTGCCCCAATTGAGATAGG - Intergenic
994715716 5:103319098-103319120 CAAATAACCCAACTTCAAAATGG - Intergenic
994876222 5:105425012-105425034 CAAACTGTCAAAATTCAAATGGG - Intergenic
999738179 5:154528337-154528359 ATTATGGCCCAAATTCTAATGGG - Intergenic
999856059 5:155595462-155595484 CAAATTGCCCTCATTCACATGGG - Intergenic
1002965542 6:1962713-1962735 CAAATGACCCAATTTAAAAATGG - Intronic
1003621120 6:7701167-7701189 TAAATTGCCAAAATTCAATTTGG + Intergenic
1004076269 6:12346840-12346862 CAATTAGCCTAAGTTCAAATTGG + Intergenic
1005115245 6:22328877-22328899 GAAATTGCCCCAATGCAAATGGG - Intergenic
1005445002 6:25913608-25913630 AAAATGGCCAAAATGCACATGGG + Intronic
1007384831 6:41513448-41513470 CAGAAGACCCAAATTCAACTTGG + Intergenic
1009293176 6:61909757-61909779 CATTTTGCCCAAATACAAATTGG + Intronic
1010505809 6:76657773-76657795 CAAATAACCCAATTACAAATTGG + Intergenic
1010869966 6:81025130-81025152 CAATTGGAGCAAATTCCAATTGG - Intergenic
1011203200 6:84861075-84861097 CAAAAGGCCTAACTTGAAATGGG - Intergenic
1012542475 6:100377602-100377624 CAAAAGGCCCATATTCAAATAGG + Intergenic
1014144586 6:117982895-117982917 GTAATGGCCCAAAATCAGATTGG - Intronic
1016212396 6:141554179-141554201 CAAATAACCCAATTTAAAATTGG + Intergenic
1017573365 6:155773019-155773041 CAAATAACCCAACTTAAAATTGG - Intergenic
1017606372 6:156138813-156138835 CAAATGACCCATCTTAAAATTGG - Intergenic
1018919203 6:168159650-168159672 TAAATGGCCCAAATTTACAGAGG - Intergenic
1019885684 7:3902940-3902962 CAAATGGCCTAATTTTAAAATGG + Intronic
1020110103 7:5443183-5443205 AAAATGGTCCCAATTAAAATGGG - Intronic
1020579963 7:9984721-9984743 CAAATAACCCAATTTAAAATGGG - Intergenic
1021047050 7:15936320-15936342 CATATGGGACATATTCAAATGGG + Intergenic
1021700356 7:23313720-23313742 AAGATGGCCCAAATCCAAGTGGG + Intronic
1022551953 7:31249233-31249255 CTAATGGATCAAATTTAAATGGG - Intergenic
1022893590 7:34726172-34726194 CAAATAGCCCAATTAAAAATGGG + Intronic
1022962989 7:35447871-35447893 CAAATGGGCCAGATTTGAATAGG - Intergenic
1023144020 7:37131184-37131206 TAAATGCCCCAAAGTCAAATGGG + Intronic
1024087324 7:45905522-45905544 CAAATAGCCCAATTAAAAATAGG + Intergenic
1027385267 7:77653568-77653590 CAAATGGAATAAATGCAAATGGG + Intergenic
1027595233 7:80164716-80164738 TAAATGCCCCAAATTAAAAGAGG - Intronic
1028001710 7:85506414-85506436 AAATTTGCCCAAATTTAAATGGG + Intergenic
1028193901 7:87882629-87882651 CAAATGGCCCAATTTAAAAATGG + Intronic
1028260833 7:88662418-88662440 CAAATGGCAAATATGCAAATGGG - Intergenic
1029003241 7:97178688-97178710 CAAATAGCCCAATTTAAAAATGG - Intronic
1029803085 7:102970437-102970459 CAAAGGTAACAAATTCAAATTGG - Intronic
1030661442 7:112223484-112223506 GAAGAGGCCCAAATCCAAATGGG + Intronic
1030805842 7:113917516-113917538 AAAATGACCCAAATATAAATAGG - Intronic
1030918482 7:115348227-115348249 GAAATGGCTCATATTCAACTTGG + Intergenic
1031388164 7:121178608-121178630 CATGTGTCCCAAATTAAAATTGG + Intronic
1031574220 7:123396350-123396372 CAACTGGAACAAATTCAAAAGGG - Intergenic
1031998751 7:128250536-128250558 CAACTTGCCCAAAGTCAAACAGG - Intronic
1034586398 7:152097161-152097183 CAAATGGCACAATTTTAAAATGG + Intronic
1035248698 7:157582313-157582335 CAAATGACCCAACTAAAAATGGG + Intronic
1036950488 8:13134537-13134559 TAAATGGGGCAAATACAAATAGG + Intronic
1041578467 8:59428238-59428260 CAGTCTGCCCAAATTCAAATTGG - Intergenic
1042557906 8:70049412-70049434 CAAATGGAGCAAATTCAATATGG - Intergenic
1043369086 8:79570145-79570167 CAAATGGCCCCAAATCAGAATGG + Intergenic
1044119132 8:88372738-88372760 CAAATAACCCAATTTAAAATGGG - Intergenic
1044133425 8:88555706-88555728 CAAATAGCCCAATTTAAAAATGG - Intergenic
1048388419 8:133935707-133935729 CAAACAGCCCAAATTAAAACAGG - Intergenic
1051098787 9:13497390-13497412 CAAATAGCCCAAAATAAAAATGG + Intergenic
1051130216 9:13851980-13852002 CAAATGCCCCATTTTCCAATAGG + Intergenic
1051136928 9:13933092-13933114 CAAAGGGGGCAAATTCAAATAGG + Intergenic
1051364614 9:16312668-16312690 CAAATAGCCCAATTAGAAATAGG - Intergenic
1051696413 9:19772530-19772552 CAAATAGCCCAATTTAAAAATGG + Intronic
1051983592 9:23055233-23055255 CAAATAACCCAATTTCAAAATGG + Intergenic
1052144728 9:25035166-25035188 CAAATAACCCAATTTAAAATGGG + Intergenic
1052661977 9:31444954-31444976 CAAATGGCCCACTTTAAAAATGG + Intergenic
1053190010 9:36057089-36057111 CAAATGGCTCACTTCCAAATAGG - Intronic
1054973667 9:71118139-71118161 CAAATGGGTAAATTTCAAATGGG - Intronic
1054987637 9:71280834-71280856 CAAATGGCACACATTCAAGGAGG + Intronic
1055505721 9:76946656-76946678 AAAATGCCCAAAAATCAAATAGG - Intergenic
1055752906 9:79527225-79527247 AAAATGTCACAAATCCAAATAGG + Intergenic
1056474686 9:86942457-86942479 CAAATGTCCAAAATTCCAAAAGG + Intergenic
1056510837 9:87303973-87303995 CAAATGACCCAATTTTAAAAAGG + Intergenic
1057362295 9:94384647-94384669 CAAATGACCCAATTTAAAAATGG - Intronic
1057900660 9:98945448-98945470 CTAATCCCCCAAATTCAAAGGGG - Intronic
1057926606 9:99157618-99157640 CAAATGGCCCAATTAAAAATTGG + Intergenic
1061511127 9:131061440-131061462 CAAATAGCCCAAATTCTCAATGG - Intronic
1186340375 X:8639279-8639301 CAAATCCCACAAATTTAAATAGG + Intronic
1186841106 X:13485417-13485439 CAATTTGCCCAAAGTCACATAGG - Intergenic
1187059984 X:15776719-15776741 CAAATGACCCAAATTCCACAAGG - Exonic
1189442694 X:41051363-41051385 CAAATGGCCCAACTTAAAATGGG + Intergenic
1189933417 X:46039196-46039218 AAACTGGCCAAAATTCAAAGTGG - Intergenic
1189956128 X:46276670-46276692 CAAATGACCCAATTACAAATTGG + Intergenic
1190386710 X:49888851-49888873 CAAATGCCCTTAAATCAAATTGG - Intergenic
1190900970 X:54672773-54672795 CAAATGGCTGAAATGAAAATGGG - Intergenic
1192039138 X:67598662-67598684 CTAATGGTCCAAAGGCAAATAGG - Intronic
1192273680 X:69608825-69608847 AAAATGAGCCAATTTCAAATAGG + Intergenic
1192540018 X:71960192-71960214 CAAATCACCCAATTACAAATGGG - Intergenic
1196393624 X:115235205-115235227 CACATTGCTCAAATTGAAATAGG - Intergenic
1197038439 X:121905805-121905827 CATATTGACTAAATTCAAATGGG + Intergenic
1197093712 X:122570256-122570278 CAAATTTCCCAATTTCACATGGG - Intergenic
1197175843 X:123485098-123485120 CATATGCCCCAAATTGTAATGGG - Intronic
1200816133 Y:7534842-7534864 CAAATGGGTGCAATTCAAATAGG + Intergenic
1200987069 Y:9312865-9312887 CAAATGGCCAAAAAGCACATGGG + Intergenic
1200987108 Y:9313408-9313430 CAAATGGCCAAAAAGCACATGGG + Intergenic