ID: 1102299465

View in Genome Browser
Species Human (GRCh38)
Location 12:111760463-111760485
Sequence CCTAACCTGATCCCCAGGGG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 143
Summary {0: 1, 1: 0, 2: 1, 3: 9, 4: 132}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1102299456_1102299465 15 Left 1102299456 12:111760425-111760447 CCCACTTTGAGAAGCGAGGGTGA 0: 1
1: 0
2: 1
3: 7
4: 104
Right 1102299465 12:111760463-111760485 CCTAACCTGATCCCCAGGGGAGG 0: 1
1: 0
2: 1
3: 9
4: 132
1102299453_1102299465 28 Left 1102299453 12:111760412-111760434 CCTTGTTTTGGGACCCACTTTGA 0: 1
1: 0
2: 2
3: 10
4: 141
Right 1102299465 12:111760463-111760485 CCTAACCTGATCCCCAGGGGAGG 0: 1
1: 0
2: 1
3: 9
4: 132
1102299457_1102299465 14 Left 1102299457 12:111760426-111760448 CCACTTTGAGAAGCGAGGGTGAG 0: 1
1: 0
2: 0
3: 16
4: 253
Right 1102299465 12:111760463-111760485 CCTAACCTGATCCCCAGGGGAGG 0: 1
1: 0
2: 1
3: 9
4: 132

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1102299465 Original CRISPR CCTAACCTGATCCCCAGGGG AGG Intronic
900456769 1:2778678-2778700 CCTCCTCTGATCCCCAGGAGGGG + Intronic
900550029 1:3250064-3250086 CCTGGGCTGGTCCCCAGGGGCGG - Intronic
900641614 1:3690390-3690412 CCTACCATGATCTCCAGGGCCGG + Intronic
900656853 1:3762833-3762855 CCTCACCTGCTCCCCTGGAGTGG - Intronic
900954965 1:5881109-5881131 CCTACCCTCAGCCCTAGGGGAGG + Intronic
901199357 1:7457908-7457930 CCGACCCAGATACCCAGGGGAGG + Intronic
904879316 1:33682943-33682965 CCCCACCTTTTCCCCAGGGGAGG + Intronic
904917568 1:33981399-33981421 CCTTACCTGATGCCCAAAGGGGG - Intronic
906668674 1:47639245-47639267 CCCATCCTGATCCTCAGGTGAGG + Intergenic
907390995 1:54158202-54158224 TCTCTCCTGGTCCCCAGGGGAGG + Intronic
909075697 1:71047932-71047954 CCTATCCTGATCGCCTGGGTTGG + Intergenic
910757466 1:90707817-90707839 TCTTACCTTATCCCCAGGGCTGG - Intergenic
912476063 1:109935745-109935767 CCCAGCCAGATCTCCAGGGGAGG + Intergenic
916294388 1:163201381-163201403 CCTATCCTCTTCCCCAGGGTTGG + Intronic
1062941049 10:1421747-1421769 CCTAAAGTGAACCCCAGGGCAGG + Intronic
1062967421 10:1618629-1618651 CATCACCTGAGCCCCAGGGATGG - Intronic
1063211668 10:3886405-3886427 CCTAAACAGCTCCCGAGGGGAGG - Intergenic
1063674174 10:8125174-8125196 CCTCAACTGATCCCCAGGTCTGG + Intergenic
1064221869 10:13447968-13447990 CCTAAGCTGCCCCCCAGGAGTGG - Intronic
1065382260 10:25102251-25102273 CCTAACCTCTACCCCAGGGCAGG - Intergenic
1068220866 10:54043873-54043895 CATTACCTGATCTCCAGGCGAGG - Intronic
1074870144 10:117569878-117569900 GCTCAACTGATCCCCAGGGTGGG - Intergenic
1080165226 11:29227676-29227698 CCTAACCTGATCCACTGAGAAGG + Intergenic
1080652293 11:34232531-34232553 CCTAACCTAATCCCCAGCAAGGG + Intronic
1083210608 11:61182844-61182866 GCTGATCTGATCCCCAGGGTTGG - Intergenic
1084480751 11:69418707-69418729 CCTACCCTGACTCCCAGGGCAGG + Intergenic
1087008856 11:93494889-93494911 CCTAACCTGGTCCCCAAGGAAGG + Intronic
1092360637 12:7833413-7833435 CCTAACCTAACCCCCGGGTGGGG + Intronic
1092862860 12:12734606-12734628 AATAACCTGATCCACAGGGATGG - Intronic
1094268540 12:28585886-28585908 CCCAACCTGATCCCCAAGGGAGG + Intergenic
1102111273 12:110367086-110367108 CCTAACCTGAAGCCCACGGAGGG + Intergenic
1102299465 12:111760463-111760485 CCTAACCTGATCCCCAGGGGAGG + Intronic
1102310712 12:111842450-111842472 CCTAGCCTCATCCCCAGCTGGGG - Intronic
1102902709 12:116650838-116650860 CCAAACCATATCACCAGGGGTGG - Intergenic
1105060545 12:133146362-133146384 CCTACTCTGTTCCCCAGGGAGGG - Intronic
1105283351 13:18983051-18983073 CCCAACCTGATCCCAAGGAGTGG - Intergenic
1111090493 13:83439630-83439652 CCTGCCCCGATCCCTAGGGGTGG - Intergenic
1119396113 14:74327447-74327469 CCTTTCCTGATCCGCAGGGATGG + Intronic
1119473457 14:74913124-74913146 CCTACCCTGATCCCAAGCTGTGG - Intronic
1121238311 14:92409628-92409650 CCTAACATGCTCCCCAGGATAGG + Intronic
1122369401 14:101220947-101220969 CCTAATTTGATCCCCAAGGCCGG + Intergenic
1122687902 14:103518692-103518714 CAGACCCTGATCCCCAGGGGTGG + Intergenic
1123123774 14:105930198-105930220 CCGACCCTCATCCCTAGGGGAGG - Intronic
1123123802 14:105930294-105930316 CCAACCCTCATCCCCAGGGAAGG - Intronic
1123123829 14:105930390-105930412 CCAACCCTCATCCCCAGGGGAGG - Intronic
1123123845 14:105930438-105930460 CCAACCGTCATCCCCAGGGGAGG - Intronic
1123716896 15:23040110-23040132 CCTCGCCTGTTCCTCAGGGGCGG + Intergenic
1123756832 15:23403495-23403517 CTTAATCAGATCCCCACGGGAGG - Intergenic
1124012046 15:25846538-25846560 TCTACCCTCATGCCCAGGGGTGG - Intronic
1128053818 15:64685003-64685025 CCCAACCTGCTCCCAATGGGAGG - Exonic
1129160577 15:73745413-73745435 CCTTCCCTGATCCCCAGCTGAGG + Intronic
1129513213 15:76139985-76140007 CCTAGCCTGAACCCCAAGGCTGG + Intronic
1132571437 16:646095-646117 CGTAACCAGAGCCCCTGGGGCGG + Intronic
1132781305 16:1627595-1627617 CCTAACCTGCAGCCCAGGGCGGG - Intronic
1132797270 16:1731240-1731262 AATCACCTGAACCCCAGGGGCGG + Intronic
1132826960 16:1909930-1909952 CCCAGCCCTATCCCCAGGGGAGG + Intergenic
1133103739 16:3494120-3494142 CTTAACAGAATCCCCAGGGGAGG + Intronic
1134106590 16:11489700-11489722 CCTCAGCTGATCCCCTGAGGAGG + Intronic
1134517252 16:14897132-14897154 CCCAAGCTGACCCCCTGGGGTGG - Intronic
1134704919 16:16295786-16295808 CCCAAGCTGACCCCCTGGGGTGG - Intergenic
1134962622 16:18416328-18416350 CCCAAGCTGACCCCCTGGGGTGG + Intergenic
1134966919 16:18498927-18498949 CCCAAGCTGACCCCCTGGGGTGG + Intronic
1135690975 16:24537625-24537647 CATAACCTAATCTGCAGGGGGGG - Intergenic
1138271711 16:55700319-55700341 CCCACCCTGTTCCCCTGGGGAGG - Intronic
1140871634 16:79112052-79112074 ACTTGCCTGATCCCCAGGGCTGG + Intronic
1156444470 18:37225002-37225024 CCAAACCTGATCCCCATGATGGG + Exonic
1157763573 18:50281962-50281984 CCGAACATCAACCCCAGGGGGGG + Intergenic
1157797690 18:50590144-50590166 CCTATCTTGATGCCCAGGGCAGG + Intronic
1157818493 18:50748512-50748534 CCTGGCCTGAGCCCCAGGAGAGG - Intergenic
1160241074 18:77123710-77123732 CCTGACCTGCTCACCAGGAGAGG - Intronic
1162386944 19:10365476-10365498 CCCAACCTGAACCCCCAGGGCGG + Intronic
1164883661 19:31759131-31759153 CCTCACCTGATCCTCAGAGGTGG + Intergenic
1167436252 19:49480460-49480482 GCTCACCTGCTCCCCAGGGCGGG - Exonic
1168710104 19:58494681-58494703 CCTCAACTGATCCTCAGGGCTGG - Intronic
926120360 2:10238308-10238330 CCTTACCTGACTCCCAGGTGTGG - Intergenic
927504409 2:23603729-23603751 CCTGGCCTGCTCCCCAGGGCTGG - Intronic
932469179 2:71942822-71942844 CCTAGCCTGTTCTCCAGTGGTGG + Intergenic
932672506 2:73750773-73750795 CATATCCTAACCCCCAGGGGCGG + Intergenic
935413320 2:102788408-102788430 GCTCACCTGGTCCCCTGGGGTGG + Intronic
935665661 2:105509905-105509927 CTTAGCCTGATCCCATGGGGAGG - Intergenic
937826064 2:126369729-126369751 TCCAGCCTGATCTCCAGGGGTGG - Intergenic
937908411 2:127063927-127063949 CCTCACCTGTTCCACAGGGACGG + Exonic
938292551 2:130157758-130157780 CCTGTCTTGATCCCCAGGGCAGG + Intronic
938464002 2:131515211-131515233 CCTGTCTTGATCCCCAGGGCAGG - Intergenic
939402859 2:141716954-141716976 CCCAGCATGATCCACAGGGGGGG + Intronic
944120218 2:196232425-196232447 CCTAGCCTGATACACAGTGGGGG + Intronic
945498809 2:210542920-210542942 CCTAGCCTGATCCACAGGGAAGG + Intronic
946230081 2:218285903-218285925 CCAAACCTCATCCCTAGTGGAGG - Exonic
946364263 2:219238856-219238878 CCTAACCTGGGGCCCAGGGAAGG + Intronic
947526514 2:230879765-230879787 CCCATCCTGGTCCCCAGGGCAGG - Intergenic
947571465 2:231238907-231238929 CCTTTCCAGCTCCCCAGGGGTGG + Intronic
1169068902 20:2709744-2709766 CCCAACCTGGTGCCCCGGGGGGG - Intronic
1169093625 20:2876337-2876359 CCTAACCTCCTCCCCAGAGATGG + Intronic
1170901883 20:20471712-20471734 CCTGCCCTGGCCCCCAGGGGAGG + Intronic
1171407025 20:24918350-24918372 CCTAGCCTGCTCCGCAGCGGCGG - Intergenic
1175926302 20:62473250-62473272 CCTGACCTGACCCACCGGGGCGG + Intronic
1177318577 21:19492602-19492624 CATAACTTGATTCCCAAGGGTGG + Intergenic
1179623846 21:42636368-42636390 CCTCACATCATCCCCTGGGGCGG + Intergenic
1179917178 21:44485130-44485152 CATAACCTGGTGCCCAGGGCTGG - Intergenic
1182015866 22:27039238-27039260 CCTGCCCTCAGCCCCAGGGGTGG + Intergenic
1183401200 22:37605673-37605695 CCTACCCTGATCCCCAGTTTGGG + Intergenic
1184080349 22:42214926-42214948 CCAAAGCTGCTCCCCTGGGGGGG + Exonic
1184090628 22:42291286-42291308 TCCAGCCTGAGCCCCAGGGGAGG + Intronic
1184800318 22:46754930-46754952 CCTCACCAGATGCCCAGCGGTGG - Intergenic
951407436 3:22317636-22317658 CCTACCCTTATTCCTAGGGGAGG - Intronic
953244944 3:41182568-41182590 TCTAACCTGGGCCCCAGGTGAGG - Intergenic
954301291 3:49702066-49702088 CCTCACCTGACCTCCAGTGGTGG + Exonic
954303236 3:49712397-49712419 CCTTTCCTGATCCCCAGGCCAGG + Intronic
955226200 3:57062415-57062437 CCTAGCCTGAGCCCGAGTGGGGG - Intronic
956127368 3:66023626-66023648 CCTAACCTTTACCCCAGGAGTGG - Intronic
960697737 3:120412350-120412372 CTTAACCTCATCCACAAGGGAGG - Intronic
962386191 3:134934447-134934469 CCTCAATGGATCCCCAGGGGAGG + Intronic
966292852 3:178380377-178380399 CCCACCCTAATCCCCAAGGGTGG - Intergenic
966874008 3:184311213-184311235 CCTTACCTGATTTCCAGTGGTGG + Intronic
968915079 4:3493773-3493795 ACTCACCTGATCCTCAGGGGTGG - Exonic
974845997 4:67351693-67351715 CCTAAGCAGCTCCCCAGTGGAGG + Intergenic
975718496 4:77228208-77228230 CATAGCATGATCCACAGGGGAGG + Intronic
982565904 4:156986478-156986500 CCTGAACTCCTCCCCAGGGGTGG + Intergenic
984584798 4:181551100-181551122 CATAACCTGCTTCCCAGGGGTGG - Intergenic
991412239 5:66357134-66357156 CCTTACCTGCTCTCTAGGGGTGG - Intergenic
998434672 5:142097330-142097352 CCTAACCTTATCCCCAAGTTGGG - Intergenic
999364023 5:151009676-151009698 CCTAACCTGGTCCCCAGGATAGG - Intergenic
999550001 5:152676284-152676306 CCCATCCTCCTCCCCAGGGGAGG + Intergenic
1000203591 5:159035962-159035984 CCTTTCCTGACCCCCAGTGGTGG + Intronic
1001247768 5:170117928-170117950 TCAAACCTGCTCCCCAGAGGGGG - Intergenic
1003604675 6:7548373-7548395 CCTCACCTCAGCCCCAGGAGGGG + Intronic
1003661393 6:8065324-8065346 CCCAATCTGCTCCCCAGAGGTGG - Intronic
1018715641 6:166530501-166530523 CATAAACTGACCCCCTGGGGAGG - Intronic
1022513903 7:30963558-30963580 CCTAGCCTCATCCACAGGGCTGG - Intronic
1022992095 7:35718696-35718718 CCCAACCTTATCCCCACAGGAGG + Intergenic
1023968915 7:44977676-44977698 ACAAACCTGGTCCCCAGTGGGGG + Intronic
1035652594 8:1280106-1280128 CCTTAACTGATCCCCAGATGTGG + Intergenic
1036665141 8:10732772-10732794 CCTAACCTGGTGCCCGGGCGCGG - Intronic
1039455623 8:37704017-37704039 CCTACCCTGGACTCCAGGGGTGG - Intergenic
1047723977 8:127668791-127668813 CTTGACCTGATTCCCAGGGAAGG + Intergenic
1049517025 8:143065317-143065339 TCTGTCCTGTTCCCCAGGGGAGG - Intergenic
1055169331 9:73235998-73236020 CCAGCCCTGATCCCCAGGAGAGG - Intergenic
1055483613 9:76734725-76734747 CCTAACCTGAGCTCTAGGTGTGG + Intronic
1058138248 9:101331034-101331056 CCTAACCTCATCCACGAGGGAGG + Intergenic
1059433057 9:114261239-114261261 CCAAGCCTGATCCCCAGGCCTGG + Intronic
1061793864 9:133072143-133072165 CCCAATCTGGTCACCAGGGGTGG + Intronic
1062710564 9:137972992-137973014 CCCCACCTGACCCCCAAGGGTGG - Intronic
1190124531 X:47692036-47692058 CCTAACCATATCACCAGGGATGG + Intergenic