ID: 1102301956

View in Genome Browser
Species Human (GRCh38)
Location 12:111777648-111777670
Sequence CGGGGTGCCCGTGGAGGAGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 286
Summary {0: 1, 1: 0, 2: 2, 3: 19, 4: 264}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1102301956_1102301965 3 Left 1102301956 12:111777648-111777670 CCTTCTCCTCCACGGGCACCCCG 0: 1
1: 0
2: 2
3: 19
4: 264
Right 1102301965 12:111777674-111777696 AGGAGCTGACTTTCAGAGTCGGG 0: 1
1: 1
2: 1
3: 10
4: 210
1102301956_1102301967 18 Left 1102301956 12:111777648-111777670 CCTTCTCCTCCACGGGCACCCCG 0: 1
1: 0
2: 2
3: 19
4: 264
Right 1102301967 12:111777689-111777711 GAGTCGGGGAGTAAACACCCAGG 0: 1
1: 0
2: 0
3: 6
4: 87
1102301956_1102301966 4 Left 1102301956 12:111777648-111777670 CCTTCTCCTCCACGGGCACCCCG 0: 1
1: 0
2: 2
3: 19
4: 264
Right 1102301966 12:111777675-111777697 GGAGCTGACTTTCAGAGTCGGGG 0: 1
1: 0
2: 1
3: 11
4: 103
1102301956_1102301964 2 Left 1102301956 12:111777648-111777670 CCTTCTCCTCCACGGGCACCCCG 0: 1
1: 0
2: 2
3: 19
4: 264
Right 1102301964 12:111777673-111777695 GAGGAGCTGACTTTCAGAGTCGG 0: 1
1: 0
2: 2
3: 22
4: 198

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1102301956 Original CRISPR CGGGGTGCCCGTGGAGGAGA AGG (reversed) Intronic
900307703 1:2019220-2019242 CGGGGGGCGGGGGGAGGAGAGGG + Intergenic
900318840 1:2072609-2072631 CTGGGGGCCCGTGTAGGAGGTGG + Intronic
900430831 1:2602498-2602520 GGGGGTGCCCGTGGTGGAGGTGG - Intronic
900538262 1:3189746-3189768 TGGGATTCCCCTGGAGGAGAGGG + Intronic
901815574 1:11791576-11791598 GGGGGTGCTCAAGGAGGAGAGGG - Intronic
902409115 1:16202450-16202472 TGTGCTGCCCGTGGAGGAGCTGG + Exonic
903768524 1:25749825-25749847 AGGGGTGGCTGTGGAGGACAAGG - Intronic
904297145 1:29527293-29527315 CCTGGTGACCCTGGAGGAGAAGG + Intergenic
904832226 1:33312462-33312484 GGGGGTGCCCTTGGAGTAGGAGG + Intronic
906532292 1:46530718-46530740 TGGTGTGCCCGTGGAGGAAGCGG + Intergenic
910396022 1:86794530-86794552 CGGGGTGGGGGTGGGGGAGATGG - Intergenic
910769513 1:90816946-90816968 CAGGGTGGTGGTGGAGGAGATGG - Intergenic
911104271 1:94117749-94117771 CGTGGAGACCGTGGAGTAGAAGG - Intronic
912993438 1:114510938-114510960 CGCGGTGCTGGTGGAGGAGGAGG - Exonic
915558694 1:156674412-156674434 TGGGGAGGACGTGGAGGAGAGGG - Intronic
915625388 1:157111332-157111354 CAAGGAGCCAGTGGAGGAGAAGG - Intergenic
915934259 1:160081610-160081632 CGGGGGGCCCGTGGGGGGGGCGG + Exonic
918139946 1:181711757-181711779 TGGGGTGCCCAAGGAGCAGAAGG + Intronic
920315120 1:205071294-205071316 AGGGGTACCTGTGGAGCAGATGG + Intronic
921366297 1:214377958-214377980 CCGGGTTCCCATGGACGAGAGGG - Exonic
922572409 1:226641945-226641967 CAGGGTGGCCGTGGAGCTGATGG + Exonic
922596841 1:226820403-226820425 CAGGGAGCCCGTGGTTGAGAAGG + Intergenic
923026857 1:230211269-230211291 CAGGGTCCTGGTGGAGGAGATGG + Intronic
923276732 1:232403224-232403246 GGGTGTGCCCATGGAGCAGAGGG + Intronic
924562296 1:245166851-245166873 GGAGGTGACCGTGGAGGAGAGGG + Intronic
1063822832 10:9856772-9856794 CAGGGTGGCCTTGGAGTAGAAGG - Intergenic
1063958692 10:11288243-11288265 AGAGGTGGCCTTGGAGGAGAGGG + Intronic
1066641085 10:37554840-37554862 CTGGGTCCCCGTGTTGGAGAAGG + Intergenic
1067717274 10:48699193-48699215 CAGGGTGACCATGGAGAAGAGGG + Intronic
1072503729 10:96043862-96043884 CGGGGCTCCCGGGGAGGAGCAGG + Intronic
1072728224 10:97827884-97827906 CGGGGCTCCTGTGGAAGAGACGG - Intergenic
1074377091 10:112949930-112949952 CGGGGTGGGAGAGGAGGAGAAGG - Intergenic
1075093375 10:119455802-119455824 CGGCGTGCCCCTCGAGGAGAAGG - Intronic
1075345189 10:121676708-121676730 CGGGGTGCCAGTGGGGCTGAAGG + Intergenic
1075953366 10:126501390-126501412 AGGGGTGCACGTGTAGGTGAAGG + Intronic
1076496676 10:130901919-130901941 CGGGGAGCCTCTGGAGGAGCTGG + Intergenic
1076605542 10:131687061-131687083 CGGGGCGCCAGGGGAGGGGAGGG - Intergenic
1076767178 10:132642584-132642606 CGGAGTGACAGGGGAGGAGAGGG - Intronic
1077299533 11:1840660-1840682 CGGGGTGGCCGGGGAGGGGCTGG - Intronic
1077478729 11:2803155-2803177 CTGGGTGCCCGTGGGGGGGGGGG - Intronic
1077889792 11:6410864-6410886 CGGGGAGGCCGAGGAGGAGGAGG - Exonic
1081979479 11:47257632-47257654 CGAGGTGCCTATGGAGGGGAGGG + Intronic
1083196340 11:61090825-61090847 AGGGGTGCCTGTGGAAGAGGAGG + Intergenic
1083681136 11:64352405-64352427 GGGGGTGCCAGGGGAGGAGCTGG - Intronic
1083698009 11:64455546-64455568 CGGGGTGTCTGTAGTGGAGAGGG + Intergenic
1084706819 11:70820534-70820556 CGAGGTGGCCGTGGAGCAGACGG + Intronic
1085525800 11:77162800-77162822 AGTGGGGCCCATGGAGGAGAGGG + Intronic
1088481666 11:110300967-110300989 CTGGGTGCCGGTGGAGCAGGGGG + Intergenic
1089122356 11:116146275-116146297 CGGGGTGGACCTGGAGGAGCAGG - Intergenic
1089622471 11:119729544-119729566 GGGGGCGGCGGTGGAGGAGAGGG + Intergenic
1090188113 11:124751560-124751582 AGGGCTGGCCGTGGAGGTGAAGG - Exonic
1090246779 11:125221806-125221828 CGGGGTGGTCGGGGAGGAGGAGG - Intronic
1090626679 11:128614510-128614532 GGGGGTGCGGGTGTAGGAGACGG + Intergenic
1091282830 11:134391637-134391659 TGGGGTGCTGGAGGAGGAGATGG + Exonic
1092810401 12:12266966-12266988 CGGGGCGCCGGGGGAGGAGGCGG - Intronic
1097072312 12:56364092-56364114 GAGGGTGCCCTTGGAGGAGGTGG - Intergenic
1097768075 12:63548321-63548343 CTGGGTGCCGGTGGAGGGGGCGG - Intergenic
1098758010 12:74389569-74389591 CGGGGTGGACCTGGAGGAGTGGG + Intergenic
1101038894 12:100733923-100733945 GGGGGTGGCTGGGGAGGAGAGGG + Intronic
1101469009 12:104977671-104977693 CCGGGAGCACGTGGAGAAGAAGG - Intergenic
1102053987 12:109882516-109882538 CGGGGGGCCAGGGGAGGAAATGG + Intergenic
1102301956 12:111777648-111777670 CGGGGTGCCCGTGGAGGAGAAGG - Intronic
1103595567 12:122022644-122022666 CGGGGTGCGCGGGGAGGAGACGG - Intronic
1104553896 12:129782448-129782470 TGGGGTGCCCGTGGGGGTGGCGG + Intronic
1104651822 12:130540253-130540275 TGGGTTGCCAGTGGATGAGAAGG + Intronic
1104663184 12:130627164-130627186 CGTGGTGGTGGTGGAGGAGATGG - Intronic
1104957745 12:132474670-132474692 CGGGGTCACCGCGGAGGAGGGGG - Intergenic
1104957755 12:132474693-132474715 CGGGGTCACCGCGGAGGAGGGGG - Intergenic
1104957843 12:132474902-132474924 CGGGGTCACCGCGGAGGAGGGGG - Intergenic
1104957892 12:132475015-132475037 CGGGGTCACCGCGGAGGAGGGGG - Intergenic
1104958066 12:132475410-132475432 CGGGGTCACCGCGGAGGAGGGGG - Intergenic
1105209288 13:18248206-18248228 GGGTGTGCCCGTGGGGCAGATGG - Intergenic
1111123043 13:83879351-83879373 CGGGGTGCCTGCGGTGGGGAAGG + Exonic
1111869859 13:93817774-93817796 CTGGGAGCCCCTGGAGGGGAAGG + Intronic
1113422104 13:110178940-110178962 AGGGGTCCCCCTGGAGGACAGGG - Exonic
1113868247 13:113543133-113543155 CGGGGGGCACGGGGAGGAGGTGG - Intronic
1113930720 13:113967590-113967612 TGAGGTGCCCATGTAGGAGAAGG + Intergenic
1115850663 14:37587902-37587924 AGGGGTCCCCGGGGAGGGGAGGG - Intergenic
1118058080 14:62103638-62103660 CTGGGAGCCAGTGAAGGAGAGGG - Exonic
1118771486 14:68945613-68945635 CAGGGTGGCAGTGTAGGAGAGGG + Intronic
1119171930 14:72542179-72542201 TGGGGTTCCAGTGGTGGAGATGG + Intronic
1119647295 14:76356994-76357016 GGGGGTGCATGTGGAGGAGAGGG - Intronic
1119740071 14:77008364-77008386 CCTGGTGCCCGAGAAGGAGAGGG - Intergenic
1121050552 14:90816603-90816625 CGGGGTGGGCATGGAGGACAGGG + Intergenic
1121714857 14:96066221-96066243 TGGGATGCGCGTGGAGGACAAGG + Intronic
1125727535 15:41875695-41875717 CTGGGTGGCAGTGGAGGTGAGGG + Intronic
1126761158 15:51971468-51971490 CTGGGTGTCGGTGGAGCAGACGG - Intronic
1129106999 15:73317550-73317572 AGGGGTGCAGGTGGAGGAGAAGG + Intergenic
1129326115 15:74801045-74801067 GGGCGTGATCGTGGAGGAGAAGG + Exonic
1129468630 15:75738262-75738284 CGGAGTGCCCGGGACGGAGACGG + Intergenic
1131035141 15:89217204-89217226 GGCGGTGGCCGTGGCGGAGAGGG - Exonic
1131372062 15:91890785-91890807 CAGGTTGACCCTGGAGGAGAAGG + Intronic
1132317501 15:100900645-100900667 CAGGGTGTTCGTGGAGGAGCAGG + Exonic
1132460864 16:53896-53918 AGGGGCGGCCCTGGAGGAGACGG + Exonic
1132599673 16:767986-768008 AGGGGGGCGCGTGGAGGAGGAGG + Intronic
1132656722 16:1044561-1044583 CTGGGAGCCCAGGGAGGAGAGGG + Intergenic
1132700565 16:1220418-1220440 CGGGGAGCCTGGGGAGGCGAAGG + Exonic
1133018539 16:2955821-2955843 GGAGGGGCCCGTGGAGGAGGGGG + Intergenic
1134683704 16:16144180-16144202 AGCGGTGCCTGTGGAAGAGAAGG + Intergenic
1137404143 16:48176724-48176746 TGGGATTCCAGTGGAGGAGACGG - Intronic
1138561338 16:57802458-57802480 CGGGCTGGCCGAGGAGGAGGCGG - Exonic
1139806168 16:69566530-69566552 CGGGGTGACGGTGGAGGGGGCGG + Intronic
1141225141 16:82107856-82107878 CTGGGGTCCAGTGGAGGAGAGGG - Intergenic
1141946674 16:87315522-87315544 CCGTGTGCCCCTGGAGGTGATGG - Intronic
1142399192 16:89850462-89850484 CGGGGGTCCCGAGGAGGAGGAGG + Exonic
1142427940 16:90010771-90010793 CGGCGTGGCCCTGGATGAGAGGG - Intronic
1143670514 17:8392975-8392997 CGGGATGCCCCTGGGGGAGCAGG - Exonic
1144770281 17:17755765-17755787 CTGGGTGCCAGGGGAGGAGCTGG - Intronic
1145764854 17:27451602-27451624 CCGGGTGAGAGTGGAGGAGAGGG - Intergenic
1150225760 17:63523637-63523659 GCGGGTCCCCCTGGAGGAGAAGG - Intronic
1151584911 17:75003137-75003159 CGGGGTGGGGGCGGAGGAGAGGG - Intronic
1151668499 17:75558844-75558866 CGGGGTGCGGATGGAGGAGGTGG - Intronic
1151668525 17:75558924-75558946 CGGGGTGCGGATGGAGGAGGTGG - Intronic
1151668532 17:75558944-75558966 CGGGGTGCGGATGGAGGAGGCGG - Intronic
1151668539 17:75558964-75558986 CGGGGTGCGGATGGAGGAGGCGG - Intronic
1151668546 17:75558984-75559006 CGGGGTGCAGATGGAGGAGGCGG - Intronic
1151668552 17:75559004-75559026 CGGGGTGCGGATGGAGGAGGCGG - Intronic
1152269727 17:79317116-79317138 GGGGGTGGCCGTGGGGGAGATGG - Intronic
1152531750 17:80922974-80922996 CGGGGTGTCCGGGAGGGAGAGGG - Intronic
1153944855 18:10009516-10009538 GGGGTAGCCCGTGGAAGAGACGG + Intergenic
1154354057 18:13611389-13611411 CGGGGTGGCCGTGGTGGAAAGGG - Intronic
1154451045 18:14474985-14475007 CGGGGTGGGGGTGGAGGTGAGGG - Intergenic
1155007497 18:21741507-21741529 CGGGGGGCCCGTGAGGGAGTTGG - Exonic
1157304576 18:46507751-46507773 GGGGGTGCTGGTGGAGGTGAGGG - Intronic
1160427480 18:78788103-78788125 TGGGGTGGCCATGGAGGAAAGGG - Intergenic
1160927894 19:1555830-1555852 CGAGGTGGCCGTGGAGAAGGCGG + Exonic
1161281674 19:3448999-3449021 CGAGATGCCTGTGGAGGGGATGG - Exonic
1161317437 19:3624227-3624249 CTGGGTGCCCGTGGGGGAGCAGG + Intronic
1161769267 19:6222501-6222523 CCGGCTGCCCAAGGAGGAGAAGG - Exonic
1162097802 19:8321289-8321311 CGGGGTGCGCGGGGCGGACAGGG - Exonic
1162386127 19:10361648-10361670 GGGTGTGTCCGTGGAGGAGGTGG - Intronic
1163342983 19:16721663-16721685 GGCGGGGTCCGTGGAGGAGAGGG + Intronic
1163356586 19:16816060-16816082 TGTGGTGCCTGTGGAAGAGATGG - Exonic
1163442437 19:17328716-17328738 CGGGGCGCCGGAGGAGGAGGAGG - Exonic
1163444709 19:17339555-17339577 CGTGGGGCCCGTGGAGCAGGAGG + Exonic
1163474338 19:17516229-17516251 CGAGCTGCCTGTGGAGGAGGCGG + Exonic
1164526126 19:29014893-29014915 TGAGGTGCCCGTGGAGTTGAGGG - Intergenic
1164722870 19:30444930-30444952 CGAGCTGCCCATGAAGGAGAAGG + Exonic
1164817640 19:31217308-31217330 CGGGGTGAACGAGGGGGAGATGG + Intergenic
1165224090 19:34342023-34342045 TGGGGTGCCCGTGGTGGAGGGGG - Exonic
1165818796 19:38661075-38661097 AGCGGAGCCCGTGGAAGAGATGG + Intronic
1168105029 19:54161234-54161256 CGGGGAGCAGGTGGAGAAGAGGG + Exonic
1168337604 19:55605391-55605413 CGGGGTTCCCGTAGAAGAGGCGG + Intronic
925161489 2:1687238-1687260 CAGGGTGCCCGGGGAGGAGAGGG - Intronic
925419830 2:3703341-3703363 CGGGGAGCCCGGGCAGGTGAGGG - Intergenic
925933170 2:8727258-8727280 CGGCGTGCGCCTGGAAGAGAAGG + Intronic
926423320 2:12718788-12718810 GGGAGAGCCCGGGGAGGAGAGGG + Intronic
927991928 2:27454050-27454072 CCGGGGGGCCTTGGAGGAGAAGG - Exonic
930018430 2:46986469-46986491 AGGGGAGCCTGTGGTGGAGACGG + Intronic
930056014 2:47252669-47252691 AGGGGTGGCCCTGGAGGATAAGG - Intergenic
933142566 2:78812392-78812414 CGAGGTGACCCTGGAGGAGCTGG - Intergenic
933367460 2:81371582-81371604 AAGGGTGCCAGTGTAGGAGATGG - Intergenic
934522198 2:95026484-95026506 CGGGGTGGGGGTGGAGGAGATGG + Intronic
935936000 2:108183592-108183614 CAGGGAGGCAGTGGAGGAGAAGG - Intergenic
936144493 2:109970723-109970745 CGGCGTGCCCTTTGAGGGGAAGG + Intergenic
936181177 2:110268683-110268705 CGGCGTGCCCTTTGAGGGGAAGG + Intergenic
936200194 2:110400746-110400768 CGGCGTGCCCTTTGAGGGGAAGG - Intergenic
936428073 2:112436176-112436198 CTGGGTGCCCGAGGACGAGCAGG - Intergenic
937080583 2:119136958-119136980 TGGGGGGCCCTTGGAGGAAAGGG + Intergenic
944606483 2:201356059-201356081 GGGGGTGCCAGGGGAGGAGTTGG + Intronic
945251555 2:207769482-207769504 GGGGGCTCCCGAGGAGGAGAGGG - Exonic
946386254 2:219386205-219386227 CAGGGTACCCGTGGGGAAGAGGG - Intronic
947066149 2:226227700-226227722 TGGGGTGGCCTTGGAGGACAAGG + Intergenic
947914713 2:233823690-233823712 CGGGGTGCAAGCGGAGGGGATGG + Intronic
1168800936 20:642746-642768 CGGGGTGCGGGTGGACGAGCCGG + Intergenic
1168947164 20:1770730-1770752 GGTGGTGCCCGTGGAGAAGAGGG + Intergenic
1170912013 20:20582071-20582093 CGGGGAGGCCATGGAGGAGCTGG - Intronic
1170971688 20:21122825-21122847 TGGTGTGCCCGTGGAGGGCATGG + Intergenic
1171290457 20:23979919-23979941 GGGTGTGCCCGTGGGGCAGATGG - Intergenic
1172201915 20:33132601-33132623 CTGGGTGCCCCTGGTGGGGAGGG + Intergenic
1172603272 20:36198004-36198026 AGGGGTGCCCTTGGGGGAGGGGG - Exonic
1173729167 20:45316814-45316836 CGGGGTGTAGGTGAAGGAGAAGG - Exonic
1173752372 20:45487466-45487488 GGGGGTGGCAGTGGAGGCGAAGG - Intergenic
1174246877 20:49188229-49188251 CGGAGTGGCCGTGGAGGAGGCGG + Exonic
1175768248 20:61606078-61606100 AGGGCTGCCCGTGCAGGTGATGG + Intronic
1176121413 20:63455990-63456012 TGGGGGGCCCGTGAAGCAGAGGG - Intronic
1176121443 20:63456059-63456081 TGGGGGGCCCGTGAAGCAGAGGG - Intronic
1176179127 20:63741357-63741379 TGGGGTGGCTCTGGAGGAGATGG - Exonic
1176373001 21:6073781-6073803 CTTGGGGCCCGTGGAGGGGAAGG - Intergenic
1176390155 21:6159079-6159101 CGGGCCTCCCGTGGAGGAAAGGG - Intergenic
1177387409 21:20425883-20425905 CCGGGAGCCCCTGGAGAAGAAGG - Intergenic
1179733311 21:43379161-43379183 CGGGCCTCCCGTGGAGGAAAGGG + Intergenic
1179750476 21:43464462-43464484 CTTGGGGCCCGTGGAGGGGAAGG + Intergenic
1180258319 21:46649401-46649423 CTGGGTGCCCCTGGAGGGGCAGG + Intronic
1180766971 22:18351091-18351113 GGGTGTGCCCGTGGGGCAGATGG + Intergenic
1180779342 22:18511288-18511310 GGGTGTGCCCGTGGGGCAGATGG - Intergenic
1180812059 22:18768608-18768630 GGGTGTGCCCGTGGGGCAGATGG - Intergenic
1180868455 22:19133082-19133104 GGGGCTGCCCCTGGAGGACAGGG - Exonic
1181198214 22:21202852-21202874 GGGTGTGCCCGTGGGGCAGATGG - Intergenic
1181401530 22:22652952-22652974 GGGTGTGCCCGTGGGGCAGATGG + Intergenic
1181703491 22:24634049-24634071 GGGTGTGCCCGTGGGGCAGATGG + Intergenic
1182119401 22:27776909-27776931 GGGGGAGCCGGTGGGGGAGAGGG + Intronic
1182351349 22:29701791-29701813 CAGGGTGCAGGTGGAGGGGATGG - Intergenic
1182358178 22:29731990-29732012 CGGGGTGGACGTTGAGGAGGAGG - Intronic
1183386193 22:37516167-37516189 CCGGGTGCTCGAGGAGGAGCGGG - Exonic
1184728693 22:46361100-46361122 CAGGGTGGCCGTGGAAGGGACGG - Exonic
1184942187 22:47777119-47777141 CGTGGTGACCGTGGCGGAGTGGG - Intergenic
1185051279 22:48555632-48555654 CGGGGTGCCCGTGGCGTGGGGGG - Intronic
1203228593 22_KI270731v1_random:91985-92007 GGGTGTGCCCGTGGGGCAGATGG + Intergenic
949877305 3:8634659-8634681 GTGGGTGTCCATGGAGGAGAAGG + Intronic
962853080 3:139322484-139322506 CAGGGTGCCTGTGGAGGTGGTGG + Intronic
964834303 3:160920328-160920350 CTGGGAGCCTGGGGAGGAGAAGG - Intronic
968522255 4:1039368-1039390 TGGGGGCCCCGTGGAGGGGAAGG + Intergenic
968551389 4:1225522-1225544 CGCGGCGTCTGTGGAGGAGACGG - Exonic
968750067 4:2384188-2384210 CGAAGTACCCGGGGAGGAGAGGG - Intronic
969116034 4:4871427-4871449 CCGCGTGCCCTTGTAGGAGAGGG + Intergenic
969663807 4:8545456-8545478 GGGGCTGTCCGGGGAGGAGAAGG - Intergenic
972918180 4:43905457-43905479 CGGGGTGGACATGGAGGAGCAGG - Intergenic
973037152 4:45420481-45420503 CTGGGTGCCCGTGGAGCAGGGGG - Intergenic
973339033 4:48985927-48985949 CGGGGTGCTCTGCGAGGAGAAGG - Intergenic
976871310 4:89797063-89797085 TGGGGTGGAGGTGGAGGAGAAGG - Intronic
980464203 4:133152140-133152162 CAGGGTGGCGGTGGAGGAAAGGG - Exonic
984811107 4:183797375-183797397 CTGGGCGCCCGGGGAGGCGAGGG + Intergenic
985540797 5:486534-486556 GTGGGTGTCCCTGGAGGAGATGG - Intronic
985641839 5:1067092-1067114 AGGGGTGCCTGAGGAGGAGTGGG - Intronic
985688688 5:1295152-1295174 CGGGGTCCGCGCGGAGGAGGCGG + Intergenic
998266177 5:140669384-140669406 TGGGGAGCCTGTGGAGGAGCTGG + Exonic
1000138880 5:158381990-158382012 GGGTGTGCCTGTGGAGGAGAGGG - Intergenic
1001937447 5:175715462-175715484 GGGGGAGCCCCTAGAGGAGAAGG + Intergenic
1002057359 5:176606139-176606161 CAGGGTCCCCAAGGAGGAGAAGG - Intronic
1002394351 5:178941516-178941538 GTGAGTGCCTGTGGAGGAGATGG + Intronic
1002715622 5:181224776-181224798 CGTGGTGCCATTGGAGGAGGTGG + Exonic
1003881347 6:10482757-10482779 CCGGGTGCCGGCGGAGGAGGGGG + Intergenic
1005561481 6:27045564-27045586 CTGGGTGCCCGTGGAGTAGGGGG - Intergenic
1006302133 6:33199338-33199360 AGGGGTGGCCCAGGAGGAGAAGG + Exonic
1006304694 6:33211892-33211914 GGGGGTGCCGGAGGAGGTGACGG + Exonic
1007209994 6:40185742-40185764 GGGGCTGCCTCTGGAGGAGAAGG + Intergenic
1007473578 6:42105499-42105521 AGGGGAGCCCGTGGAGGTGAAGG - Exonic
1007582204 6:42966303-42966325 CAGGGGGCCCATGGAGCAGAAGG + Exonic
1010200112 6:73274945-73274967 GCGGGTGCCCCTGGAGGAGGTGG + Intronic
1011325974 6:86150428-86150450 TGGGGTGGACCTGGAGGAGAAGG + Intergenic
1012744796 6:103072107-103072129 CGGGGGGCTTGGGGAGGAGATGG + Intergenic
1013173994 6:107662121-107662143 CGGGGTGGCTGAGGAGGGGAAGG - Intergenic
1013792709 6:113855214-113855236 GGGGGTGACGGTGGGGGAGACGG - Intergenic
1014330234 6:120055387-120055409 CGGGGTACCCCTGTAGGAGCTGG - Intergenic
1015773550 6:136792310-136792332 CGGCGTGCCCTCGGGGGAGAGGG - Exonic
1017233766 6:152098846-152098868 AGGGGCATCCGTGGAGGAGACGG + Exonic
1017395911 6:153999940-153999962 CTGGGTGTCCCTGGAGGACAAGG - Intergenic
1019060463 6:169254030-169254052 CGGGGTGCAGGAGGAGGAGACGG - Exonic
1019481565 7:1269463-1269485 CGGGGTGGCCGTCGCCGAGAAGG - Intergenic
1019514382 7:1433303-1433325 CGGGGCCCCCGTGGAGGGAAAGG - Intronic
1019610879 7:1936080-1936102 CAGGGTGCCCCTGAAGGAGCAGG - Intronic
1020092670 7:5350171-5350193 CGGGCTGTCCGTGGATGAGCTGG - Intronic
1021686719 7:23193761-23193783 CTGGGTGCCGGTGGAGCAGGGGG + Intronic
1022540928 7:31134870-31134892 TGGGGTGCCGGTGGAAGAAAGGG + Intergenic
1025263370 7:57437639-57437661 CGAGGTGCCCAAGGTGGAGAGGG - Intergenic
1026774067 7:73220392-73220414 CGTGGGGCCCGTGCAGGCGACGG + Intergenic
1027014924 7:74773778-74773800 CGTGGGGCCCGTGCAGGCGACGG + Intergenic
1027073107 7:75172175-75172197 CGTGGGGCCCGTGCAGGCGACGG - Intergenic
1029068134 7:97872517-97872539 CGGGGTGTCCGGGGCGGAGCAGG + Exonic
1029139753 7:98401208-98401230 CGGGGTGGGCGGGGAGGAGGCGG + Intergenic
1029746511 7:102518043-102518065 GGGGGCGCCCCTGGAGGAGCGGG + Intergenic
1029764448 7:102617022-102617044 GGGGGCGCCCCTGGAGGAGCGGG + Intronic
1031991616 7:128202502-128202524 CTGGGGGCCCCTGGAGGACAGGG + Intergenic
1034088806 7:148345175-148345197 CGGGGTTCACATGGAGGAGACGG + Intronic
1034147439 7:148884864-148884886 AGTGGTGCCCGGGGAGGGGAGGG + Intergenic
1035326768 7:158070794-158070816 GGAGGTGCCCGTGGTGGTGAAGG + Intronic
1035746896 8:1967482-1967504 GGGGGTGCCCAGGGAGGAGGGGG - Intergenic
1036705501 8:11043373-11043395 CTGGGTGGCCCAGGAGGAGATGG - Intronic
1037822197 8:22140435-22140457 CGGGGTGCCTGTGGAAGATCTGG - Intronic
1039470345 8:37809573-37809595 AGGGGGCCCCTTGGAGGAGAAGG + Intronic
1039842864 8:41306513-41306535 CGAGGTCCCTGTGGAGGGGAGGG - Intronic
1047423936 8:124728696-124728718 CGGGCGGCCGGGGGAGGAGAGGG - Intergenic
1049060212 8:140270734-140270756 TGGCGTGCCCGGGGAGGAAAGGG + Intronic
1049122846 8:140755417-140755439 CGGTGTGGCCGCGGAGTAGAGGG - Intronic
1049373663 8:142279260-142279282 AGGGCTGCCCGTGGAGAGGAAGG + Intronic
1049412374 8:142478977-142478999 TGGGGTGGCCGTGGAGTAGCGGG + Intronic
1049473364 8:142786005-142786027 GGGGATGTCCCTGGAGGAGATGG + Intronic
1049620910 8:143597951-143597973 CGGGGGGCCCGGGCAGGGGACGG - Exonic
1053003377 9:34589900-34589922 CGCGGGGCCCGTGGCGGGGAGGG - Intronic
1053313400 9:37033898-37033920 CAGGGTGACCCTGGAGGAGGAGG - Intronic
1057441816 9:95088980-95089002 GGGGCTGCCCCTGGAGGTGAGGG + Intergenic
1058903510 9:109462086-109462108 CTGGGTGCTCGTGGAAGAGTGGG + Intronic
1059438630 9:114290476-114290498 CCAGGTGCCAGGGGAGGAGATGG - Intronic
1060302950 9:122386579-122386601 GGGGGTGCCAGTGGTAGAGATGG - Exonic
1060429140 9:123533847-123533869 CACAGTGGCCGTGGAGGAGAGGG - Intronic
1061045428 9:128162440-128162462 TGGAGTGGCCGTGGAGGGGAGGG + Intronic
1061293521 9:129665566-129665588 CGAGGCGCGCGGGGAGGAGAGGG + Intergenic
1062487400 9:136786351-136786373 TGGAGTGCCCGTCCAGGAGACGG - Intergenic
1062676959 9:137752336-137752358 CGGGGAGTCCGAGGAGGAGCAGG + Exonic
1062689958 9:137836558-137836580 AGGGGTCCCCGTAGAGGAGTGGG - Intronic
1185456134 X:311752-311774 CGGGGTGCCCGAGGAGCTCAGGG - Intronic
1185462767 X:340180-340202 CGGGGTGAGAGGGGAGGAGACGG + Intronic
1185476608 X:419315-419337 CGAGGTGCCCGGGGAGGCGGCGG - Intergenic
1192216631 X:69163886-69163908 TGGGGTGGCTTTGGAGGAGAGGG + Intronic
1200126790 X:153819025-153819047 CGGGGCGCCCTAGGCGGAGAGGG + Intronic