ID: 1102304967

View in Genome Browser
Species Human (GRCh38)
Location 12:111798000-111798022
Sequence CTTCAGGCTTAGAATTATGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 114
Summary {0: 1, 1: 0, 2: 0, 3: 3, 4: 110}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1102304967_1102304973 17 Left 1102304967 12:111798000-111798022 CCTGCATAATTCTAAGCCTGAAG 0: 1
1: 0
2: 0
3: 3
4: 110
Right 1102304973 12:111798040-111798062 TCCGATGTCTCCATAACTCTGGG 0: 1
1: 0
2: 0
3: 2
4: 73
1102304967_1102304972 16 Left 1102304967 12:111798000-111798022 CCTGCATAATTCTAAGCCTGAAG 0: 1
1: 0
2: 0
3: 3
4: 110
Right 1102304972 12:111798039-111798061 ATCCGATGTCTCCATAACTCTGG 0: 1
1: 0
2: 1
3: 2
4: 49

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1102304967 Original CRISPR CTTCAGGCTTAGAATTATGC AGG (reversed) Intronic
901969847 1:12898911-12898933 CTTCAGACTCAGGACTATGCAGG - Intronic
902015325 1:13302869-13302891 CTTCAGACTCAGGACTATGCAGG + Intergenic
902414980 1:16233158-16233180 CATCAGACTGAGAATTATCCCGG - Intronic
902571591 1:17350629-17350651 CTTCAGCCTTGGATTTCTGCAGG - Intronic
907362319 1:53928337-53928359 CTTCATGCTCAGAACAATGCTGG + Intronic
907437691 1:54459911-54459933 CTTCTGGCTGAGATTTGTGCAGG + Intergenic
908850834 1:68374129-68374151 CTTCAAGCTTGGAATTAGGTTGG + Intergenic
909298332 1:73980059-73980081 GTTCAGGCTGATAATTATGAAGG + Intergenic
910104681 1:83618967-83618989 GTTCAGATTTAGAATTAAGCTGG + Intergenic
912216049 1:107613944-107613966 CTTCTAGCTTAGAATTATTTAGG + Intronic
913019390 1:114772453-114772475 CCTCAGGCTTTTAATTTTGCAGG + Exonic
916383896 1:164245405-164245427 CTTCAGCCTGAGAATTACACTGG - Intergenic
916617540 1:166458092-166458114 CTTCAGGCCTTGAATAATGTTGG - Intergenic
1066699309 10:38110031-38110053 CTTTTGGCTTAGAATTATCTTGG - Intronic
1069102573 10:64341502-64341524 CTACATGTTTAGCATTATGCTGG + Intergenic
1070059906 10:72971872-72971894 CTTTAGGATTAGAGTTTTGCTGG + Intergenic
1073521951 10:104140307-104140329 CTTGAACCTTAGAATTATGGAGG + Intronic
1074937961 10:118204851-118204873 CTTTAGGCTCAGAGTTTTGCTGG - Intergenic
1076043728 10:127273973-127273995 ATTCAGCCTGAGAATTAAGCTGG + Intronic
1082946570 11:58767717-58767739 GTTTAGGCTGAGAATTATACTGG - Intergenic
1084049565 11:66590973-66590995 CTGCAGGCTCAGAATTTTGTGGG + Exonic
1084472857 11:69373348-69373370 CTTGAGGTTTAGAGTCATGCTGG - Intergenic
1086764957 11:90685428-90685450 TTTCCGGCTTAAAATTAGGCAGG + Intergenic
1086906159 11:92420221-92420243 CTTCTGCCTTAGAATTTTACTGG + Intronic
1087035721 11:93754252-93754274 CTTCAGCCTTAGATAAATGCAGG + Intronic
1090385165 11:126354089-126354111 CTCCAGGCCTGGAATTAAGCTGG - Intergenic
1098130731 12:67347420-67347442 CTTGGGCCTTAGAATTATGGTGG + Intergenic
1100682962 12:96948986-96949008 TTTCAGGCTTAGTTTTCTGCAGG + Intronic
1102304967 12:111798000-111798022 CTTCAGGCTTAGAATTATGCAGG - Intronic
1104296560 12:127520547-127520569 CTTCATGGTTACATTTATGCAGG + Intergenic
1106993150 13:35448483-35448505 CTTCAGACTTTGAAATATGCAGG + Intronic
1107355964 13:39567154-39567176 GTTCAGGCACAGAATTAAGCAGG + Intronic
1108941176 13:55955335-55955357 ATTCAAACTTAGAATTATGTGGG - Intergenic
1110460716 13:75742412-75742434 CTTCTTGCTTAGAATTACCCTGG - Intronic
1111045996 13:82813480-82813502 ATTCAGGCTTAGATTTGGGCGGG - Intergenic
1111858393 13:93669747-93669769 CTTCAGGCTAACATTTTTGCAGG + Intronic
1113096124 13:106665827-106665849 CCTCATGATTAGAATTATTCGGG + Intergenic
1114739014 14:25075267-25075289 CTTCAGGCTGAGAATGAGCCTGG + Intergenic
1117787071 14:59297147-59297169 CTTCAGTCCTAGAATCATGGGGG - Intronic
1118022344 14:61730766-61730788 TTTCATGCCTAGAATAATGCCGG + Intronic
1119500756 14:75125753-75125775 TTTCAGCCTTAAAAGTATGCTGG + Intronic
1119963630 14:78888176-78888198 CTTCAGGCTTTGATTTATTTAGG + Intronic
1130719310 15:86371363-86371385 CTTCATGCACAAAATTATGCAGG - Intronic
1132370325 15:101293261-101293283 CTCCAGGCTTTGATTTATTCAGG + Intronic
1138972029 16:62156860-62156882 CTTATGGCTTAGAAATATTCAGG + Intergenic
1139633984 16:68246920-68246942 CCTCAGACTTAGAACTCTGCAGG - Intronic
1142306146 16:89287037-89287059 CCTCAGGCTTACAATTGTGGAGG + Intronic
1142859313 17:2751196-2751218 CTTTAGGATTAGAATTTTCCAGG - Intergenic
1143753060 17:9045147-9045169 CTTCAGGCTAGGAATCATTCTGG - Intronic
1146248915 17:31319592-31319614 CTTGAAGCTTAGAATAAAGCTGG + Intronic
1153055226 18:939239-939261 CTACAGGCGTACATTTATGCAGG - Intergenic
1155390122 18:25326684-25326706 CTTCATGCTTGGAATTAACCAGG - Intronic
1156578167 18:38343787-38343809 CTTCAGTATCAGAATTACGCTGG - Intergenic
1158721885 18:59932329-59932351 TTTCAAGCTTGGAATTATTCTGG + Intergenic
1159737013 18:72112749-72112771 CTTCAGGCTAAGAAAATTGCTGG - Intergenic
926381209 2:12291888-12291910 CCTCAGGCTTAGAAGTTGGCTGG - Intergenic
930433138 2:51306033-51306055 CTGTATGCTTAGAACTATGCTGG - Intergenic
930525787 2:52527695-52527717 CTTCAGGCAGAGAATTAAGTTGG + Intergenic
935657753 2:105439325-105439347 CTGCAGGCTTAGAATTGTTGTGG - Intergenic
936920718 2:117685902-117685924 CTTCAGGCTTAAATCTAGGCTGG + Intergenic
937029051 2:118722807-118722829 CTTCTGGCCTAGAATAAAGCAGG + Intergenic
937367136 2:121271526-121271548 CTTCAGGCTAAAAATTAATCTGG + Intronic
941007282 2:160261134-160261156 CTTCAGGCTTAGGAGAAAGCAGG - Intronic
946271224 2:218595957-218595979 CTTCAGGCTTGCAATTATTGAGG - Exonic
1171059629 20:21943882-21943904 GTGCAGGCTTAGAATTAAGGAGG + Intergenic
1179262074 21:39766107-39766129 CAATAGGCTTAGAATTATTCTGG + Intronic
949898096 3:8785259-8785281 CTGCAGACTCTGAATTATGCAGG - Intronic
950418053 3:12879866-12879888 CTTCAGGCTCTGAATCATGGTGG - Intergenic
953255072 3:41282338-41282360 CTTTTGGCTTAGAATTATCTTGG - Intronic
964559572 3:157979086-157979108 TTTCATGCTGAGAATAATGCAGG - Intergenic
965012235 3:163108367-163108389 CCTCAGCCTTACAATTATGGTGG + Intergenic
965542590 3:169884848-169884870 CTTAAGACTTACAAGTATGCAGG - Intergenic
966728751 3:183132749-183132771 CTTCAGGCTGAATATGATGCTGG + Intronic
966988109 3:185200886-185200908 CATCAGGGTTAGGATTTTGCGGG + Intronic
971683640 4:29735123-29735145 CATCATGTTTAGAAATATGCTGG + Intergenic
972043650 4:34637087-34637109 CTTCAGGCTTGAACCTATGCAGG - Intergenic
978574818 4:110179130-110179152 CTGGAGGCCTAGAATTATGAAGG - Intronic
978854446 4:113378084-113378106 CTTCAGGCTTTGAGTTACACAGG + Intronic
979854592 4:125615932-125615954 CCACAGGCTGAGAATGATGCTGG + Intergenic
980332007 4:131422598-131422620 CTTCAGGATCAGGATGATGCTGG - Intergenic
980631067 4:135434291-135434313 TTTCAGACTGAGAATGATGCTGG + Intergenic
988849801 5:35169337-35169359 CTTCAGGCTTATAAATATCTGGG + Intronic
990881371 5:60542845-60542867 CTTCTGGCTTAGAGTTACCCAGG + Intergenic
1000734633 5:164883822-164883844 CTTCAGACTTAGAGTTAAGGTGG - Intergenic
1007352118 6:41281630-41281652 CCTCAGGCTTAGAATTCCCCAGG + Intronic
1012143046 6:95647540-95647562 CTTCTTGCTTAGAATTGTGTTGG - Intergenic
1012859536 6:104543214-104543236 CTTCAAACTTAGAATTCTTCAGG - Intergenic
1013183086 6:107734201-107734223 CTTGAGGAGTAGAATGATGCTGG - Intronic
1015203282 6:130606111-130606133 GCTCAGGCATAGAACTATGCAGG + Intergenic
1016133780 6:140512065-140512087 CTGCAGGCTGAGAAATATGAGGG - Intergenic
1016445093 6:144123431-144123453 CTTCTGGCTTAGGATTCAGCTGG + Intergenic
1017301064 6:152858560-152858582 CTTCAGCATTGGAATTATGCTGG - Intergenic
1022581512 7:31559804-31559826 CTTGAGCCTTAGACTTAGGCTGG + Intronic
1024426169 7:49228948-49228970 ATTCAGGCTAAGAATTAGGGAGG - Intergenic
1026381301 7:69802166-69802188 CTTCAGGCTAAGATTTAGTCAGG - Intronic
1027987006 7:85305997-85306019 CTTCAAACTTAGAGTTATGTAGG + Intergenic
1030122389 7:106122744-106122766 CTGCAGGGTTAGAATTAGGAGGG - Intergenic
1030293520 7:107896001-107896023 CTACATGCATAGAATTATGCTGG - Intronic
1039666829 8:39542965-39542987 CTTTAGTATTAGAATGATGCTGG + Intergenic
1039934365 8:42028306-42028328 CTTCACGCTCAGAATTGGGCAGG - Intronic
1046114923 8:109773417-109773439 CTTCAGGATCAGGATGATGCTGG + Intergenic
1053606660 9:39666849-39666871 CTTCAGTCTTTGAACTCTGCAGG - Intergenic
1053864580 9:42423479-42423501 CTTCAGTCTTTGAACTCTGCAGG - Intergenic
1054246875 9:62675555-62675577 CTTCAGTCTTTGAACTCTGCAGG + Intergenic
1054560995 9:66710089-66710111 CTTCAGTCTTTGAACTCTGCAGG + Intergenic
1054865154 9:69992724-69992746 CTTCGGGGTTAGAAATATGATGG - Intergenic
1058095667 9:100857401-100857423 CTTCAGGCATAGAATGGTGATGG + Intergenic
1058389077 9:104473664-104473686 CTTCAGGTTGATGATTATGCTGG - Intergenic
1059599479 9:115760914-115760936 TTTCAGGCTCAGAATTGTGGAGG - Intergenic
1187772475 X:22715893-22715915 CTTTAAGCTTAGAATTATTAAGG - Intergenic
1187793222 X:22973385-22973407 TTTATAGCTTAGAATTATGCAGG + Intergenic
1188236232 X:27734470-27734492 CTTCAGACTTTGAAATATGGTGG - Intronic
1190137248 X:47808048-47808070 CATCAGGCTTTGAGTTCTGCTGG + Intergenic
1191144919 X:57155586-57155608 CTTCAGGCTGAGAAAAAAGCAGG + Intergenic