ID: 1102305006

View in Genome Browser
Species Human (GRCh38)
Location 12:111798226-111798248
Sequence GCTCACCTCCTCCTTGGCGA TGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 161
Summary {0: 1, 1: 0, 2: 1, 3: 14, 4: 145}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1102305006_1102305013 9 Left 1102305006 12:111798226-111798248 CCATCGCCAAGGAGGAGGTGAGC 0: 1
1: 0
2: 1
3: 14
4: 145
Right 1102305013 12:111798258-111798280 CAGTGCTCTGGAAACATTCTTGG 0: 1
1: 0
2: 1
3: 13
4: 181
1102305006_1102305015 13 Left 1102305006 12:111798226-111798248 CCATCGCCAAGGAGGAGGTGAGC 0: 1
1: 0
2: 1
3: 14
4: 145
Right 1102305015 12:111798262-111798284 GCTCTGGAAACATTCTTGGCGGG 0: 1
1: 1
2: 2
3: 10
4: 131
1102305006_1102305016 16 Left 1102305006 12:111798226-111798248 CCATCGCCAAGGAGGAGGTGAGC 0: 1
1: 0
2: 1
3: 14
4: 145
Right 1102305016 12:111798265-111798287 CTGGAAACATTCTTGGCGGGAGG 0: 1
1: 0
2: 0
3: 7
4: 95
1102305006_1102305017 21 Left 1102305006 12:111798226-111798248 CCATCGCCAAGGAGGAGGTGAGC 0: 1
1: 0
2: 1
3: 14
4: 145
Right 1102305017 12:111798270-111798292 AACATTCTTGGCGGGAGGTGAGG 0: 1
1: 0
2: 0
3: 16
4: 165
1102305006_1102305011 -3 Left 1102305006 12:111798226-111798248 CCATCGCCAAGGAGGAGGTGAGC 0: 1
1: 0
2: 1
3: 14
4: 145
Right 1102305011 12:111798246-111798268 AGCACTTGGGGCCAGTGCTCTGG 0: 1
1: 0
2: 1
3: 12
4: 175
1102305006_1102305014 12 Left 1102305006 12:111798226-111798248 CCATCGCCAAGGAGGAGGTGAGC 0: 1
1: 0
2: 1
3: 14
4: 145
Right 1102305014 12:111798261-111798283 TGCTCTGGAAACATTCTTGGCGG 0: 1
1: 0
2: 2
3: 18
4: 223

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1102305006 Original CRISPR GCTCACCTCCTCCTTGGCGA TGG (reversed) Exonic