ID: 1102305297

View in Genome Browser
Species Human (GRCh38)
Location 12:111800114-111800136
Sequence CAGGGCCTACTGGAATCTGG TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 518
Summary {0: 1, 1: 0, 2: 8, 3: 52, 4: 457}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1102305284_1102305297 17 Left 1102305284 12:111800074-111800096 CCCAGCAGCCCCTCACAACCCAA 0: 1
1: 0
2: 0
3: 21
4: 241
Right 1102305297 12:111800114-111800136 CAGGGCCTACTGGAATCTGGTGG 0: 1
1: 0
2: 8
3: 52
4: 457
1102305283_1102305297 20 Left 1102305283 12:111800071-111800093 CCTCCCAGCAGCCCCTCACAACC 0: 1
1: 2
2: 10
3: 115
4: 830
Right 1102305297 12:111800114-111800136 CAGGGCCTACTGGAATCTGGTGG 0: 1
1: 0
2: 8
3: 52
4: 457
1102305287_1102305297 8 Left 1102305287 12:111800083-111800105 CCCTCACAACCCAACAGAGATTC 0: 1
1: 0
2: 0
3: 8
4: 141
Right 1102305297 12:111800114-111800136 CAGGGCCTACTGGAATCTGGTGG 0: 1
1: 0
2: 8
3: 52
4: 457
1102305285_1102305297 16 Left 1102305285 12:111800075-111800097 CCAGCAGCCCCTCACAACCCAAC 0: 1
1: 0
2: 3
3: 50
4: 423
Right 1102305297 12:111800114-111800136 CAGGGCCTACTGGAATCTGGTGG 0: 1
1: 0
2: 8
3: 52
4: 457
1102305290_1102305297 -2 Left 1102305290 12:111800093-111800115 CCAACAGAGATTCCTCAAAGCCA 0: 1
1: 0
2: 1
3: 20
4: 213
Right 1102305297 12:111800114-111800136 CAGGGCCTACTGGAATCTGGTGG 0: 1
1: 0
2: 8
3: 52
4: 457
1102305288_1102305297 7 Left 1102305288 12:111800084-111800106 CCTCACAACCCAACAGAGATTCC 0: 1
1: 0
2: 0
3: 12
4: 167
Right 1102305297 12:111800114-111800136 CAGGGCCTACTGGAATCTGGTGG 0: 1
1: 0
2: 8
3: 52
4: 457
1102305286_1102305297 9 Left 1102305286 12:111800082-111800104 CCCCTCACAACCCAACAGAGATT 0: 1
1: 0
2: 0
3: 12
4: 146
Right 1102305297 12:111800114-111800136 CAGGGCCTACTGGAATCTGGTGG 0: 1
1: 0
2: 8
3: 52
4: 457
1102305289_1102305297 -1 Left 1102305289 12:111800092-111800114 CCCAACAGAGATTCCTCAAAGCC 0: 1
1: 0
2: 1
3: 9
4: 151
Right 1102305297 12:111800114-111800136 CAGGGCCTACTGGAATCTGGTGG 0: 1
1: 0
2: 8
3: 52
4: 457

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1102305297 Original CRISPR CAGGGCCTACTGGAATCTGG TGG Intronic
900341838 1:2193343-2193365 CTGGCCATCCTGGAATCTGGTGG - Intronic
900458838 1:2790475-2790497 CAGGGCCACCTGGAGACTGGAGG - Intronic
901844601 1:11973929-11973951 GAGGGGCTACTGGCATCTAGTGG + Intronic
903507909 1:23851846-23851868 CAGGGCTTGTTGGAATGTGGGGG + Intronic
904233002 1:29092705-29092727 CAGGGCCTACTTGAGGGTGGAGG - Intronic
904326210 1:29728275-29728297 CAGGGCCTTCTGTCCTCTGGGGG + Intergenic
904433297 1:30478983-30479005 CAGGGCCTTCTGTCCTCTGGAGG - Intergenic
904458910 1:30663875-30663897 CAGGGCCTCCAGGAAGCAGGAGG + Intergenic
904749672 1:32733783-32733805 CAGGGCCTTCTGGAAGCAGGGGG - Intergenic
906021628 1:42634350-42634372 GAGGTGCTACTGGCATCTGGTGG + Intronic
906271348 1:44481525-44481547 CAGGGCCTGTTGGGAGCTGGAGG + Intronic
909037913 1:70615422-70615444 CAGGGCCTGCTGGAGCGTGGGGG + Intergenic
909289509 1:73864591-73864613 CAGGGCTTACTTGAGGCTGGAGG + Intergenic
910753052 1:90655139-90655161 TGGGGCCTACTGGAAGGTGGAGG + Intergenic
911332702 1:96543553-96543575 GAGGGCCTACTGTATACTGGGGG + Intergenic
911374730 1:97038060-97038082 CAGGGCCTACTTGAGGGTGGAGG - Intergenic
912872247 1:113319012-113319034 CAGGGCCTATTGGGGGCTGGGGG + Intergenic
913713064 1:121506145-121506167 CAGGGCCTACTTGATTGTGGTGG - Intergenic
916033582 1:160901048-160901070 CACGGCCTACTGGAGGGTGGAGG + Intergenic
916047694 1:161013090-161013112 CAGGGCCTACTTGAGTTTAGAGG - Intronic
916242669 1:162655709-162655731 CAGGACCCACTGGAATCTGTAGG + Intronic
916278292 1:163019641-163019663 TGGGGCCTACTGGAGACTGGAGG + Intergenic
917820821 1:178762013-178762035 CAGGGCCTACTTGAGGGTGGAGG - Intronic
918681178 1:187356024-187356046 CAGGGCCTACTGAAAGGTGAAGG + Intergenic
918858709 1:189793729-189793751 CAGGGCCTACTTGAGGGTGGAGG - Intergenic
921095142 1:211879923-211879945 CAGGGCCTACTTGAAGGTGGGGG - Intergenic
921260293 1:213380313-213380335 TAGGGCCTACTGGAGAATGGAGG + Intergenic
921372255 1:214436231-214436253 CAGGGCCTACTTGAGGATGGAGG + Intronic
922033322 1:221825231-221825253 CAGGGCCCACTGAAAATTGGGGG + Intergenic
922493854 1:226040695-226040717 CAGAGGCTCCTGGAAGCTGGAGG - Intergenic
923519717 1:234726060-234726082 CAGGGGATACTGGGAGCTGGAGG + Intergenic
923822031 1:237455405-237455427 CAGGGCCTACTTGAGGGTGGAGG + Intronic
924793052 1:247270501-247270523 CAGGGCCTGCTGGGGTCTGTGGG - Intergenic
1063819285 10:9816282-9816304 CATGGCCTACTTGAAGTTGGAGG - Intergenic
1063864589 10:10350425-10350447 AAGATCCTACTGGCATCTGGGGG + Intergenic
1064084590 10:12335826-12335848 CAGGGCCCACTGGAGGGTGGAGG + Intergenic
1064366568 10:14714016-14714038 CAGGGCCTACTTGAGAGTGGAGG + Intronic
1064397222 10:14991668-14991690 AAGGGCCTATTGAACTCTGGGGG - Intergenic
1064400119 10:15014138-15014160 AAGGGCCTATTGAACTCTGGGGG - Intergenic
1064511898 10:16103767-16103789 CATGGCAGACTGGAATATGGAGG - Intergenic
1065368369 10:24956293-24956315 CAGGGCCTACTTGAGGGTGGAGG - Intergenic
1065652983 10:27913285-27913307 CAGGGCCTACTTGAAGATGGAGG - Intronic
1066190089 10:33048170-33048192 CATGGCCTGCTGGAGTCTGCTGG + Intergenic
1066269501 10:33808513-33808535 CAGGACCTACTGTAATTTGCCGG - Intergenic
1066390402 10:34973491-34973513 AAGGGCCTATTGAACTCTGGGGG + Intergenic
1066454445 10:35560926-35560948 CAAGGCTCACTGGAAGCTGGGGG + Intronic
1066462700 10:35625449-35625471 CAGGGCCTACTTGAGGATGGAGG - Intergenic
1066634974 10:37491277-37491299 CAGGGCCCACTGGAGGGTGGAGG + Intergenic
1067915358 10:50392019-50392041 CAGGGCCTACTTGAGGGTGGAGG + Intronic
1069518731 10:69100887-69100909 CAGGGACTAGAGGCATCTGGTGG - Intronic
1071379046 10:85039321-85039343 CAGGGCTTACTTGAAGGTGGAGG - Intergenic
1072107892 10:92291308-92291330 CAGGGCCTGCGGGAGTCCGGCGG - Exonic
1072150361 10:92678070-92678092 CAGGGCCTAATTGAAGGTGGAGG + Intergenic
1072450593 10:95536689-95536711 CAGTGCCTGCTGGAGTCTAGGGG - Intronic
1072561204 10:96576459-96576481 AAGGTGCTACTGGCATCTGGGGG + Intronic
1073353266 10:102834742-102834764 CAGGGTCTACTAGAACCTGAAGG + Intronic
1074004839 10:109410996-109411018 CAGGGCTTCCTGGGAGCTGGTGG - Intergenic
1074216150 10:111386277-111386299 CAGGGCCTATTGGGGGCTGGGGG - Intergenic
1075188095 10:120281575-120281597 CAGGGCCTACTTGAGAGTGGAGG + Intergenic
1075543434 10:123335306-123335328 CAGGGCCTACTTGAGGGTGGAGG - Intergenic
1075754426 10:124799874-124799896 CAGGTGCCACTGGCATCTGGTGG - Intergenic
1077589034 11:3477521-3477543 AAGGGCCTATTGAACTCTGGGGG - Intergenic
1078560229 11:12364734-12364756 TAGGTCATACTGGAATATGGTGG - Intergenic
1078659155 11:13272110-13272132 CAGGGCCCTCTGGAAGCTGTAGG - Intergenic
1080433024 11:32215919-32215941 CATGTCCTACTGGAATCTAGTGG + Intergenic
1080781126 11:35431007-35431029 CTGGTCCTCCTGGCATCTGGTGG - Intergenic
1081796920 11:45826844-45826866 CAGTGCCTCCAGGAAGCTGGGGG + Intergenic
1082260315 11:50072882-50072904 GAGGGCCTACTGCAAGGTGGAGG + Intergenic
1084010366 11:66345047-66345069 CAGCGCCTACGGGAGTCCGGCGG - Exonic
1084241050 11:67820242-67820264 CAGGACCATCTGGTATCTGGTGG - Intergenic
1084244729 11:67849144-67849166 AAGGGCCTATTGAACTCTGGGGG - Intergenic
1084811532 11:71614761-71614783 AAGGGCCTATTGGACTCTGGGGG + Intergenic
1084847464 11:71911683-71911705 AAGGGCCTATTGAACTCTGGGGG + Intronic
1085843141 11:80036942-80036964 CAGGGCATAGTGGAGACTGGTGG - Intergenic
1086132662 11:83417761-83417783 CAGGGCCTAATCGAAGGTGGAGG + Intergenic
1087360387 11:97151280-97151302 CAGGGCCTACTTGAAGGTGGAGG - Intergenic
1087873117 11:103324327-103324349 CAGGGCCTACTTGAGGGTGGAGG - Intronic
1087931403 11:103982108-103982130 CAGGGCCTACTGGGCATTGGAGG - Intronic
1088805808 11:113350973-113350995 CAGGAGCTACTGGAATCTCTAGG - Intronic
1088842613 11:113639508-113639530 GAAGGCCCACTGGAATCTCGGGG + Intergenic
1089525744 11:119095304-119095326 CACGGCCCACTGGGAACTGGAGG + Exonic
1090217067 11:124978008-124978030 CAGGGCCTACTTGAGGGTGGAGG - Intronic
1091082200 11:132681478-132681500 CAGGAACAACTGGACTCTGGGGG + Intronic
1091995431 12:4989152-4989174 CAGGTGCTACTGGCATCTGTGGG + Intergenic
1092055289 12:5503986-5504008 CCGGGCCTTTTGGCATCTGGAGG - Intronic
1092070819 12:5629890-5629912 CAAGGCATGCTGGAATCTGGAGG - Intronic
1092415293 12:8286289-8286311 AAGGGCCTATTGAACTCTGGGGG - Intergenic
1092432376 12:8419890-8419912 AAGGGCCTATTGAACTCTGGGGG - Intergenic
1092570833 12:9719620-9719642 CATGGCCTTCTGGAGGCTGGAGG + Intronic
1093239585 12:16653449-16653471 CAGAGCCTACTGGAAGTTGAAGG - Intergenic
1093497002 12:19769547-19769569 CAGGGCCTACTTGAGAGTGGAGG + Intergenic
1093600429 12:21014904-21014926 CAGGGCCTATTGGGAGTTGGGGG + Intergenic
1094132510 12:27089617-27089639 CAGGGAGTCCTGGACTCTGGAGG - Intergenic
1094181986 12:27601624-27601646 CAGGGAGTCCTGGACTCTGGAGG - Intronic
1094254577 12:28408137-28408159 CAGGGCCTACTGGGGGTTGGGGG - Intronic
1094790649 12:33910385-33910407 CAGGGATTACTTGAATGTGGAGG - Intergenic
1095705871 12:45236384-45236406 CAGGGCCTATTAGAAGGTGGGGG - Intronic
1096861449 12:54531641-54531663 CAGGGTTTTCAGGAATCTGGAGG + Intronic
1097302288 12:58031872-58031894 CAGGGCCTACTTGACAGTGGAGG - Intergenic
1098399750 12:70061911-70061933 CAGGGCCTACTTGAGGGTGGAGG + Intergenic
1098663613 12:73131654-73131676 TAGGGCCTACTTGAAGGTGGAGG + Intergenic
1098986205 12:77015030-77015052 CACGGGCTCCTGGAAGCTGGGGG - Intergenic
1099404177 12:82239675-82239697 CAGGGCCTACTTGAGGGTGGAGG - Intronic
1099975070 12:89537991-89538013 TAGGTGCTACTGGCATCTGGTGG + Intergenic
1100129091 12:91468235-91468257 CAGGGCCTACTTGAGGGTGGAGG - Intergenic
1100431294 12:94534013-94534035 CAGGGGCTCCTGGAGCCTGGAGG - Intergenic
1101597304 12:106178469-106178491 CAGGACCTGCTGGAATCCCGAGG + Intergenic
1102305297 12:111800114-111800136 CAGGGCCTACTGGAATCTGGTGG + Intronic
1102545287 12:113649920-113649942 GAGAGGCTACTGGCATCTGGTGG + Intergenic
1102769539 12:115463078-115463100 GAGGTCCTACTGGCATCTGGTGG + Intergenic
1103010941 12:117457707-117457729 CAGGTGCTACTGGTATCTTGTGG + Exonic
1103032970 12:117632692-117632714 CAGGGCCTACTTGAGGGTGGAGG - Intronic
1105313443 13:19234960-19234982 CAGGGCCTACTTGAGGCTGGAGG + Intergenic
1107330311 13:39292639-39292661 CAGGGCCTACTTGAGGGTGGAGG + Intergenic
1107544157 13:41421456-41421478 AAGGGCCTATTGAACTCTGGGGG - Intergenic
1108982574 13:56537339-56537361 CAGGGCCTACTTGAGGGTGGAGG - Intergenic
1109760010 13:66815748-66815770 CAGGGCCTACTTGAGGCTGGAGG + Intronic
1110020704 13:70466745-70466767 CAGGGCCTACTTGAGGGTGGAGG - Intergenic
1110992054 13:82054572-82054594 CAGGGCCTACTTGAGGATGGAGG + Intergenic
1111064262 13:83070418-83070440 CAGGGCCTACTTGAGGGTGGAGG - Intergenic
1111313466 13:86519673-86519695 TAAAGCCTACTGGATTCTGGTGG + Intergenic
1111683725 13:91476174-91476196 AAGGGGCTACTGGCATCTAGTGG - Intronic
1111972399 13:94930418-94930440 CAGGGCCTACTTGAGGGTGGCGG - Intergenic
1113037228 13:106063434-106063456 CAGGTAGTACTAGAATCTGGAGG + Intergenic
1113059744 13:106309430-106309452 CAGGGCCTGCTGGAGGGTGGGGG + Intergenic
1113436285 13:110294065-110294087 CAGCGCCTACTCAAACCTGGAGG - Intronic
1113692796 13:112323651-112323673 CAGTGCCTGCAGGAATCTGCAGG - Intergenic
1115391757 14:32861978-32862000 CAGGGCCTACTTGAGGGTGGAGG - Intergenic
1115479597 14:33848554-33848576 AAAGGCCTAATGGAAACTGGAGG - Intergenic
1116182574 14:41553868-41553890 CAGGACCTACTTGAGTGTGGAGG + Intergenic
1116358735 14:43965696-43965718 CAGGGACTACTGGAGGGTGGAGG - Intergenic
1116395367 14:44442308-44442330 CAGGGACTACTGGAAGCGGGAGG + Intergenic
1116553710 14:46275671-46275693 CAGGGCCTACTTGAGGGTGGAGG + Intergenic
1116578616 14:46608790-46608812 CAGGGCCTACTTGAAGGTAGAGG - Intergenic
1116695437 14:48169445-48169467 CATGGCCTCCTGGATACTGGTGG - Intergenic
1116809988 14:49530139-49530161 TGGGGCCTACTGGAGTGTGGAGG + Intergenic
1117295382 14:54374450-54374472 AAGGTTCTACTGGAATCTGGTGG + Intergenic
1117838638 14:59833688-59833710 CAGGGCCTACTTGAGGGTGGAGG - Intronic
1118598819 14:67457115-67457137 CAGGGCCTACTTGAGGGTGGAGG + Intronic
1118680428 14:68236045-68236067 CAGGGCCTACTTGAGGGTGGAGG + Intronic
1119316384 14:73699052-73699074 GGGGGTCTACTGGAATCTAGTGG - Exonic
1120523315 14:85549284-85549306 CAGGGCCTCTGGGACTCTGGGGG + Intronic
1121235745 14:92390162-92390184 CAGGGACGACTGGGCTCTGGAGG - Intronic
1121905346 14:97736708-97736730 CAGGGCCTGTTGGAATGTGGGGG - Intergenic
1121974884 14:98393764-98393786 CAGGGCCAGCTGGAACCTTGGGG + Intergenic
1127379551 15:58419261-58419283 CAGGGCCAGCTGAGATCTGGTGG - Intronic
1128744251 15:70102569-70102591 GAGGGACCACAGGAATCTGGAGG + Intergenic
1129295100 15:74595928-74595950 CAGGTCCTGCTGTACTCTGGGGG + Exonic
1129710230 15:77817107-77817129 CTGGGCCTGCTGGATCCTGGCGG - Intronic
1129956597 15:79642773-79642795 CAGGGCCTACTTGAGGGTGGAGG + Intergenic
1129965684 15:79733419-79733441 CAGGGCCTACTTGAGGGTGGAGG + Intergenic
1130189464 15:81719107-81719129 TGGGGCCTACTGGAAGGTGGAGG - Intergenic
1131047986 15:89328382-89328404 CCGGGCCCACTGTAATCAGGTGG - Intronic
1131956177 15:97738678-97738700 CAGGGCCTACTTGAGGGTGGAGG - Intergenic
1132294929 15:100727805-100727827 CACGGCCTGCTGGAATCTGAAGG + Intergenic
1132379925 15:101359240-101359262 TAGGGCCTACTGGAATTTGGGGG - Intronic
1132588623 16:716792-716814 CAGGGCCTGATGGCACCTGGGGG - Intronic
1133474295 16:6105226-6105248 CAGTGTCTACTGGCACCTGGTGG + Intronic
1134116106 16:11550021-11550043 CTGGACCTACTAGAAGCTGGAGG + Intronic
1135571275 16:23551245-23551267 CAGGGCCAAGTGGGAACTGGAGG - Intronic
1135589387 16:23694455-23694477 GAGGGGCTACTGGCATCTGCTGG - Intronic
1135833745 16:25803970-25803992 CAGAGGCTACTGGACTCTGGAGG - Intronic
1135891029 16:26357647-26357669 CAGGGCCTACTTGACCGTGGAGG + Intergenic
1135978433 16:27127173-27127195 TAGGGCCTTCTGGAATGTGGAGG - Intergenic
1136075334 16:27813246-27813268 CAGGACCTACTTGAAGGTGGAGG - Intronic
1138760688 16:59540305-59540327 CAGGGCCTACTTGAGGATGGAGG + Intergenic
1140280910 16:73554833-73554855 TTGGGCCTAATGGAATCAGGTGG - Intergenic
1141064278 16:80901355-80901377 GAGGTCATACTGGATTCTGGTGG + Intergenic
1141596159 16:85098089-85098111 CAGGAGCCACTGGAAGCTGGAGG + Intergenic
1141682058 16:85550605-85550627 CTGTGCCCACTGGCATCTGGTGG - Intergenic
1141746718 16:85931108-85931130 CAGGTGCTACTGGCATCTAGCGG + Intergenic
1141881721 16:86864587-86864609 CAGGGCCTCCTGGAGGGTGGAGG - Intergenic
1142207934 16:88792786-88792808 CAGGGACTGCTGGAAGGTGGAGG - Intergenic
1143362380 17:6382584-6382606 CAGGGCCTGGTGGCTTCTGGGGG - Intergenic
1146532171 17:33617486-33617508 CAGGGACTACTGGAGGGTGGAGG + Intronic
1146971123 17:37073230-37073252 CAGGGCCTGCTGGGAGGTGGAGG + Intergenic
1147705332 17:42421918-42421940 CTGGGCCTCCTGGAAGCGGGCGG - Intronic
1147732840 17:42614557-42614579 CAGGGCCACCTGGATGCTGGCGG - Exonic
1147740099 17:42666384-42666406 CAGGGCCACCTGGATGCTGGCGG - Exonic
1147909093 17:43844107-43844129 AAGGGACTACTGGCATCTAGGGG + Intergenic
1149133943 17:53342165-53342187 CAGGGCCTACTTGAGGTTGGAGG + Intergenic
1149220507 17:54411663-54411685 CAGGGCCTATTGGCAGGTGGAGG + Intergenic
1149255947 17:54826646-54826668 CAGGGCCTGTTGGGAGCTGGGGG + Intergenic
1150171462 17:63000067-63000089 CAGGGCCTACTTGAGGATGGAGG + Intergenic
1150894043 17:69188690-69188712 CAGGGCCTACTTAAGTGTGGAGG - Intronic
1151060714 17:71090576-71090598 CAGGGCCTACTTGAGGGTGGAGG - Intergenic
1151069811 17:71196040-71196062 CAGGGCCTACTTGAGGGTGGAGG - Intergenic
1151351577 17:73535015-73535037 CAGGACATCCTGGAATCTGGAGG + Intronic
1151530118 17:74698693-74698715 CAGGGCCTACTTGAGGATGGAGG + Intronic
1151676807 17:75602897-75602919 CAGGGCCTGCTGGAAGCGAGAGG - Intergenic
1152246252 17:79186151-79186173 CTGGGCCCAGTGCAATCTGGAGG - Intronic
1152283410 17:79398564-79398586 GAGGGGCTTCTGGCATCTGGTGG + Intronic
1152368364 17:79870340-79870362 AAGGGCCTGGTGGCATCTGGAGG + Intergenic
1153193191 18:2565332-2565354 TGGGGCCTACTGGAAGATGGAGG + Intronic
1153619917 18:6967905-6967927 CAGGGCCTGCTGGAGTGAGGTGG + Intronic
1154383316 18:13871753-13871775 CAGGGCCTGCTGGACTCTCAGGG + Intergenic
1156618736 18:38822346-38822368 CAGGGCCTACTTGAAGGTGGAGG + Intergenic
1157052524 18:44183977-44183999 TAGGGCCTACTGGAGGTTGGAGG + Intergenic
1157335189 18:46732776-46732798 CAGGGCCAACTGGGTTGTGGGGG + Intronic
1157778238 18:50414109-50414131 CAGGGCCTACTTGAGGGTGGAGG + Intergenic
1159067540 18:63586703-63586725 CAGGAAAAACTGGAATCTGGGGG + Intergenic
1159143278 18:64422716-64422738 CAGGGGCTACTGGAGAGTGGAGG - Intergenic
1159331406 18:66998662-66998684 CAGGGCCTACTTAAAGGTGGAGG + Intergenic
1159417629 18:68173374-68173396 GATGGCCTACTGGCATCTGTCGG + Intergenic
1160280905 18:77489764-77489786 CAGGGCCTACTGGAGGGTGGAGG + Intergenic
1160319657 18:77878414-77878436 CAGGGCCTACTGGAGGGTGGAGG - Intergenic
1161708068 19:5831535-5831557 CAAGGCCTGCTGGAAACTGCAGG - Exonic
1162382442 19:10339560-10339582 CAGGGCCTGCTGGACTCTGCTGG - Exonic
1163349103 19:16764146-16764168 AAGGCACTACTTGAATCTGGTGG + Intronic
1163388889 19:17017587-17017609 CAGGTGCTACTGGCATCTGGTGG - Intronic
1163764452 19:19154960-19154982 TAGGGCCTGCTGGCTTCTGGAGG - Intronic
1163966372 19:20750816-20750838 AAGGGCCTATTGAACTCTGGGGG - Intronic
1168102453 19:54148382-54148404 CTGGGCCCACTGGGAGCTGGTGG - Exonic
1168277948 19:55287373-55287395 CAGGGCCTAGGGGGACCTGGGGG + Intronic
925155779 2:1648239-1648261 CAGGGTCTACTGCAATCTATCGG - Exonic
925810920 2:7699660-7699682 CAGGGCCTACTGGAGGGTGGAGG - Intergenic
926088204 2:10033226-10033248 CCGGCCCTACTGGTACCTGGAGG - Intergenic
926562371 2:14431995-14432017 CAGGGCCAAATGGCAGCTGGGGG + Intergenic
926974288 2:18497686-18497708 GAGGTACTACTGGAATCTAGTGG - Intergenic
928593472 2:32839671-32839693 CAGGACCTACTGGTATCTGTTGG + Intergenic
930987448 2:57607762-57607784 CAGGGCCTGTTGGAGGCTGGGGG + Intergenic
931225623 2:60327157-60327179 AAGGTCATACTGGAATTTGGAGG - Intergenic
931921672 2:67023785-67023807 CAGGGCCTACTTGAGGGTGGAGG + Intergenic
932349946 2:71023607-71023629 AAGGGCCTATTGAACTCTGGGGG + Intergenic
932353441 2:71049745-71049767 AAGGGCCTACTGAACTCTGGGGG + Intergenic
932506318 2:72235392-72235414 CAGGGCCTACTTGAAGGTGGAGG + Intronic
932594612 2:73086352-73086374 AATGGCCTCTTGGAATCTGGAGG - Intronic
933512683 2:83261232-83261254 CAGGGTCTACTTGAAGGTGGAGG + Intergenic
933835651 2:86243333-86243355 CAGGGCCTGGTGGAACCTAGAGG - Intronic
934084911 2:88501966-88501988 CAGGGCCTACTGATATGAGGAGG - Intergenic
934568550 2:95353898-95353920 GAGGTGCTACTGGCATCTGGGGG + Intronic
934568840 2:95355498-95355520 CAGGGCCTGTTGGAGGCTGGGGG - Intronic
935125437 2:100218448-100218470 CAAGGCCTCCTGTGATCTGGGGG + Intergenic
935521826 2:104116136-104116158 CAGGACCTACTCGAGTGTGGAGG + Intergenic
935710919 2:105897254-105897276 TGGGGCCTACTGGAAGGTGGAGG - Intergenic
936327955 2:111521957-111521979 CAGGGCCTACGAGACCCTGGAGG + Intergenic
936857124 2:116972054-116972076 CAGGGCCTACTTGAGGGTGGAGG - Intergenic
937308796 2:120888595-120888617 CAGGGCCTACTAGGGTGTGGTGG + Intronic
938215975 2:129515634-129515656 CAGGGCCTACTTGAGGGTGGAGG - Intergenic
938623412 2:133082039-133082061 CAGGGCCTACTTGAGGGTGGAGG - Intronic
939514035 2:143143919-143143941 TGGGGCCTACTGGAGTTTGGAGG - Intronic
940217289 2:151314264-151314286 TAGGGCCTCCTCGAATTTGGAGG - Intergenic
940531443 2:154882802-154882824 CAGAGCCTACTTGAAGGTGGAGG - Intergenic
940535054 2:154930710-154930732 CAGGGCCTACTTGAAGGTGGAGG - Intergenic
940545867 2:155084427-155084449 CAGGGCCTACTTGAGAATGGAGG - Intergenic
940628665 2:156209594-156209616 CAGGGCCTACTTGAGGGTGGAGG - Intergenic
940869526 2:158848384-158848406 AAGGGCCTATTGAACTCTGGGGG + Intronic
940872202 2:158869382-158869404 AAGGGCCTATTGAACTCTGGGGG + Intergenic
940874409 2:158885370-158885392 AAGGGCCTATTGAACTCTGGGGG + Intergenic
940907186 2:159179889-159179911 CAGGGCCAAGTGGAAGTTGGGGG - Intronic
942128495 2:172851783-172851805 CAGGGCCTACTTAAAGGTGGAGG + Intronic
942198072 2:173542667-173542689 CTGGGCCTACTGGAGAGTGGAGG + Intergenic
943053542 2:182946426-182946448 CAGGGCCTACTTGAAGGTAGAGG + Intronic
943148935 2:184084862-184084884 CTGGGCCTACTTGAAGATGGAGG + Intergenic
943205483 2:184887959-184887981 CAGGGCCTACTTGAGAGTGGAGG + Intronic
944021298 2:195107696-195107718 CAGGGCCTACTTGAGAGTGGAGG + Intergenic
945342723 2:208676388-208676410 CAGGGCCTACTTGAGGGTGGAGG - Intronic
945790867 2:214304012-214304034 TGGGGCCTACTGGAAGGTGGAGG - Intronic
945798588 2:214395683-214395705 CAGGGCCTACTTGAGGGTGGAGG - Intronic
946103246 2:217345692-217345714 TGGGGCCTACTGGAAGGTGGAGG - Intronic
946469124 2:219940045-219940067 CAGGGTCCCCTGGAATCTTGGGG + Intergenic
946481607 2:220062249-220062271 GAGGTGCTACTGGCATCTGGCGG - Intergenic
946783763 2:223220806-223220828 CATGGGCTACTGGCATCTAGTGG + Intergenic
947595003 2:231405528-231405550 AAGGGCCTATTGAACTCTGGGGG + Intergenic
947953162 2:234165211-234165233 CGGGGCCTACTGGAGGGTGGAGG - Intergenic
948577928 2:238966013-238966035 CTGAGCCTACAGGAATCTCGTGG - Intergenic
1169190435 20:3655570-3655592 CAGGAGCCACTGGAAGCTGGAGG - Intergenic
1169437225 20:5603380-5603402 CAGAACCTAGTGGAATCTGGAGG + Intronic
1169901977 20:10562421-10562443 CATGGCCTGCCGGAATCTGCTGG + Intronic
1171408547 20:24930246-24930268 AAGGGCCTATTGAACTCTGGGGG + Intergenic
1171486792 20:25491315-25491337 CAGGGCATCCAGGAAGCTGGGGG - Intronic
1173120819 20:40287385-40287407 CAGGGCCTGCGTGAAGCTGGTGG - Intergenic
1173184670 20:40831323-40831345 CAAGGGCTCCTGGGATCTGGAGG - Intergenic
1173517653 20:43676274-43676296 CAGGGCCTACTTGAGGGTGGAGG - Intronic
1174680846 20:52406760-52406782 TAGGGCCTACTTGAAGGTGGAGG - Intergenic
1174982803 20:55416364-55416386 CAGGGCCTAGTGGTAACAGGTGG + Intergenic
1175159593 20:56998120-56998142 CAGGAGCTACTGGCATCTAGTGG + Intergenic
1175163156 20:57023696-57023718 CAGGAGCTACTGGGAGCTGGAGG + Intergenic
1175574759 20:60052514-60052536 CAGGGCCAACTGGCATATAGTGG - Intergenic
1178089748 21:29150082-29150104 CAGGGCCTGTTGGGAACTGGAGG - Intronic
1179567277 21:42257204-42257226 CAGGGCCCACTGGAATCTCCTGG + Intronic
1181786147 22:25228604-25228626 CAGGACCTACTGGAAGGTTGGGG + Intronic
1181987442 22:26810316-26810338 GAGGTGCTACTGGAATCTAGTGG + Intergenic
1183275364 22:36893254-36893276 AAAGGCCAGCTGGAATCTGGAGG + Intergenic
1183346725 22:37312206-37312228 CAGGGCCTTCTGGAAGGTGACGG - Intronic
1183519688 22:38289704-38289726 CAGGGCCTACTGGCATTTCCTGG + Intergenic
1184156534 22:42671206-42671228 CAGGGCCTACTTGAGGGTGGAGG + Intergenic
1184388362 22:44188922-44188944 GAGGGTCTCCTGGAAGCTGGAGG + Intronic
1184577390 22:45381528-45381550 CAGGACATAGTGGAATCTGGGGG - Intronic
1184730139 22:46367265-46367287 CAGGGACTGCTGCTATCTGGAGG + Intronic
949376384 3:3394596-3394618 CAGGGCCTACTTGAGGGTGGAGG - Intergenic
952341311 3:32449795-32449817 CAGGCACTACTGAAATCAGGGGG + Intronic
952643143 3:35622462-35622484 CAGGGCCTGCTTGAAGGTGGAGG - Intergenic
953335536 3:42091085-42091107 CAGGGCTTGCTGGGAACTGGGGG - Exonic
954538074 3:51376157-51376179 CAAGGCCTGCTGAATTCTGGGGG - Intronic
955925286 3:63998236-63998258 CAGTGCCTACTAGAAATTGGGGG + Intronic
957076184 3:75604895-75604917 AAGGGCCTATTGAACTCTGGGGG - Intergenic
957482747 3:80819504-80819526 CAGGGCCTACTTGAAGGTGAGGG + Intergenic
958074523 3:88658360-88658382 GATGGCCTACTGGCATCTGCTGG + Intergenic
958615406 3:96487781-96487803 CAGGGCCTAGTGGACGGTGGAGG - Intergenic
958645442 3:96865801-96865823 CATGGCCTACTGACATCTGGAGG + Intronic
959006842 3:101029147-101029169 TGGGGCCTACTGGAGTGTGGAGG - Intergenic
959069746 3:101691145-101691167 CAGGCCCTACTGATAGCTGGAGG + Intergenic
959128247 3:102317620-102317642 CAGGGCCTGCTTGAAAGTGGAGG - Intronic
961272252 3:125698050-125698072 AAGGGCCTACTGAACTCTGGGGG + Intergenic
961278032 3:125742910-125742932 AAGGGCCTACTGAACTCTGGGGG + Intergenic
961876382 3:130026746-130026768 AAGGGCCTACTGAACTCTGGGGG - Intergenic
961892843 3:130144903-130144925 AAGGGCCTAATGAACTCTGGGGG - Intergenic
961910591 3:130312316-130312338 CAGGGCCTACTGGAAGGTGAAGG + Intergenic
961910634 3:130312722-130312744 CAGGGCCTACTGGAAGGTGGAGG + Intergenic
962500817 3:135990264-135990286 CAGCGCCTAGTGGATTCTAGAGG - Intronic
964676379 3:159286227-159286249 CAGGGCCTACTTGAAGCTGGAGG - Intronic
965036715 3:163449334-163449356 CAGGGCCTACTTGAAAGTGGAGG + Intergenic
965096978 3:164242417-164242439 CAGGGTACACTGGAATATGGGGG - Intergenic
965686550 3:171309389-171309411 CAGGGCCTACTGGAAAGTGGAGG + Intronic
965830561 3:172782692-172782714 TGGGGCCTACTGGAAGGTGGAGG - Intronic
965922728 3:173938714-173938736 AAGGGCCTCCTCTAATCTGGAGG - Intronic
966442718 3:179964157-179964179 CAGGGCCTGCTTGAAGGTGGAGG - Intronic
967002626 3:185351183-185351205 CAGGGCCTATTTGAAGGTGGAGG + Intronic
967254674 3:187577687-187577709 CGGGGCCTACTGGAGGGTGGAGG + Intergenic
967608510 3:191476887-191476909 CAGGGCCTAGTGGAGACTGTGGG + Intergenic
967693454 3:192504176-192504198 CAGGGCCTACTTGAGAGTGGAGG + Intronic
969220938 4:5758026-5758048 TAGGTCCTACTGGATTCGGGTGG + Intronic
969749920 4:9102238-9102260 AAGGGCCTACTGAACCCTGGGGG + Intergenic
969789067 4:9479509-9479531 AAGGGCCTATTGAACTCTGGGGG + Intergenic
969793804 4:9510277-9510299 AAGGGCCTATTGAACTCTGGGGG + Intergenic
970759602 4:19468922-19468944 TGGGGCCTACTGGCATCTAGCGG - Intergenic
970875373 4:20862956-20862978 TGGGGCCTAGTGGAATGTGGAGG + Intronic
971106486 4:23530355-23530377 CAGGGTCTACTTGAAGGTGGAGG + Intergenic
972175577 4:36401822-36401844 CAGGGACTACTTGAGTGTGGAGG - Intergenic
972737163 4:41853948-41853970 CAGGGCCCACTTGAAGATGGAGG + Intergenic
972893737 4:43592835-43592857 CAGGGCCTACTTTAGGCTGGAGG + Intergenic
973585283 4:52384293-52384315 GAGGGCATACTGGATTATGGTGG - Intergenic
973694167 4:53473640-53473662 CAGGGCCTACTTGAGGGTGGAGG + Intronic
974270102 4:59639586-59639608 CAGGGACTACTTGATTGTGGAGG + Intergenic
976995406 4:91426041-91426063 CGGGGCCTATTGGGATGTGGGGG - Intronic
977127463 4:93187932-93187954 CAGGGCTTCCTGGAAACTTGGGG - Intronic
977800736 4:101227720-101227742 CAGGGCCTACTTGAAGGTGGTGG - Intronic
979018816 4:115468450-115468472 CAGGGCCTCCTGATATCTCGGGG + Intergenic
979197325 4:117935984-117936006 CAGGGCCTGTTGGGATGTGGGGG - Intergenic
979281907 4:118878193-118878215 CAGGGCCTACTTGAGGGTGGAGG + Intronic
979741929 4:124161793-124161815 CAGGGCCTACTTGAGGGTGGAGG + Intergenic
980398204 4:132243663-132243685 CAGGGCCTACTTGAGGGTGGAGG + Intergenic
980398865 4:132253432-132253454 TAGGGCCTATTGGAAGGTGGAGG - Intergenic
980456577 4:133051889-133051911 CAGGACCTACTTGAAGATGGAGG + Intergenic
981275197 4:142891357-142891379 CAGGGCCTACTTGAGAGTGGAGG - Intergenic
983486713 4:168340801-168340823 CAGGGCCTACTTGAGTGTAGAGG - Intergenic
983634438 4:169882975-169882997 CAGGGCCTCCTGAGATCTTGGGG + Intergenic
984861963 4:184248711-184248733 CAGGGCCTACTTGAGGGTGGAGG - Intergenic
984870682 4:184322344-184322366 CAGGGCCTTCTGGAGGGTGGAGG - Intergenic
985085749 4:186310654-186310676 CAGGGTCTACTTGAGACTGGGGG - Intergenic
985235185 4:187865118-187865140 CAGGGCCTGCTGGAGGGTGGGGG - Intergenic
986549955 5:8941576-8941598 CAGGGCCTACTTGAAGGAGGTGG + Intergenic
987135931 5:14899413-14899435 CAGGGCCTGTTGGGATGTGGGGG - Intergenic
987159519 5:15126716-15126738 CAGGGCCTACTTGATGGTGGGGG - Intergenic
987900691 5:24007624-24007646 CAGGGCTTACTTGAGGCTGGAGG - Intronic
988329660 5:29818900-29818922 CAGGACCTACTTGAAGGTGGAGG - Intergenic
989339934 5:40362798-40362820 AAGGGCCTACTGGAGGGTGGAGG - Intergenic
990024501 5:51168906-51168928 CAGGGCCTACTTGAGGGTGGAGG + Intergenic
990435265 5:55783992-55784014 CAGGGCCTGTTGGAAGGTGGGGG - Intronic
991151550 5:63376563-63376585 CAGCTCTTGCTGGAATCTGGTGG + Intergenic
991186088 5:63809595-63809617 TGGGGCCTACTGGAGGCTGGAGG - Intergenic
991608322 5:68425320-68425342 CAGGGACTACAGGAAACTGCTGG + Intergenic
992434432 5:76741703-76741725 CAGGGCCTACTTGAGGGTGGAGG + Intergenic
992558629 5:77928442-77928464 CAGGGCCTACTTGAGGGTGGAGG + Intergenic
993237487 5:85331929-85331951 TGGGGCCTACTTGAGTCTGGAGG - Intergenic
994310685 5:98267031-98267053 CAGGGCCTGTTGGGAGCTGGGGG + Intergenic
994469940 5:100190714-100190736 TGGGGCCTACTGGAGTGTGGAGG - Intergenic
994471298 5:100211539-100211561 CAGGGCCTACTTGAGGGTGGAGG + Intergenic
994614341 5:102084613-102084635 TAGGGCCTACTTGAAGGTGGAGG + Intergenic
994638241 5:102370039-102370061 CAGGGCCTACTTGAAGGTGGAGG + Intergenic
994765099 5:103905505-103905527 CAGGGCCTACTTGAGGGTGGAGG + Intergenic
994848140 5:105017098-105017120 CAGGGCCTACATGAAGGTGGAGG + Intergenic
995213226 5:109564688-109564710 CAGGGCCTGTTGGAAGGTGGGGG - Intergenic
995717979 5:115099176-115099198 CAGGGCCTACTTGAGGGTGGAGG - Intergenic
996180579 5:120414354-120414376 CAGGGCCTACTTGAGGGTGGAGG + Intergenic
996469403 5:123842727-123842749 CAGGGCCTACTTGAGGATGGAGG + Intergenic
997185445 5:131877352-131877374 CATGCCCAGCTGGAATCTGGAGG - Intronic
998167628 5:139853183-139853205 CAGGTCCTATTGGATTCAGGTGG - Intronic
998256350 5:140591638-140591660 CAGGGCCCAGTGGAGTCTGAGGG - Intronic
1000857469 5:166417260-166417282 CAGGGCCTGCTGAAGTCTGAGGG - Intergenic
1002602506 5:180362024-180362046 CAGGGCCCTCTGGCTTCTGGTGG + Intergenic
1004813316 6:19284743-19284765 CAGGGCCTACTTGAGAGTGGAGG + Intergenic
1006670938 6:35729202-35729224 CTGGGCCTCCTGCCATCTGGTGG + Intergenic
1007262171 6:40571568-40571590 CAGCGCCACCTGGAATCTCGAGG - Intronic
1007482497 6:42159208-42159230 AAGGTGCTACTGGCATCTGGTGG + Intronic
1007688932 6:43685466-43685488 CTGGTACTACTGGCATCTGGGGG - Intronic
1008853466 6:56052887-56052909 TGGGGCCTACTGGAAGGTGGAGG + Intergenic
1009333424 6:62455097-62455119 CAGGGCCTACTTGAGGGTGGAGG - Intergenic
1009505169 6:64468658-64468680 CAGGACCTACTTGAAGGTGGAGG - Intronic
1009874563 6:69489539-69489561 GGGGGCCTACTGGAAGGTGGAGG - Intergenic
1010024740 6:71202070-71202092 CAGTGCCTGCTGTACTCTGGGGG + Intergenic
1010080123 6:71851924-71851946 CAGGGCCTACTTGAGTCTGAAGG - Intergenic
1010096809 6:72056249-72056271 CAGGGCCTACTTGAGGATGGAGG + Intronic
1011759261 6:90542896-90542918 CAGGTACTACTGGCATCTAGTGG - Intronic
1012560761 6:100578421-100578443 AAGGGCCTACTTGAATGTGTAGG - Intronic
1012991810 6:105933830-105933852 CAGGGCCTACTTGAGGGTGGAGG - Intergenic
1014207346 6:118670384-118670406 CAGGGCCTACTTGAGGGTGGAGG - Intronic
1014685847 6:124499278-124499300 CAGGCCCTACTGGAAAATGTTGG + Intronic
1016572957 6:145535534-145535556 CTGGGTCTTCTGGAAGCTGGAGG - Intronic
1017997617 6:159546478-159546500 CAGGGCCTTTTGGACTTTGGTGG - Intergenic
1018156254 6:160988046-160988068 CAGGGCCTATTGGAAGGTGGAGG + Intergenic
1018392475 6:163350967-163350989 GTGGTCCTACTGGTATCTGGTGG + Intergenic
1019524518 7:1474730-1474752 CATGGCCTGCCGGAAGCTGGCGG - Exonic
1020307021 7:6843222-6843244 AAGGGCCTATTGAACTCTGGGGG - Intergenic
1020311497 7:6872066-6872088 AAGGGCCTATTGAACTCTGGGGG - Intergenic
1020323065 7:6954404-6954426 AAGGGCCTATTGAACTCTGGGGG - Intergenic
1020595837 7:10205892-10205914 CTGGGCCTGCTGGAATTTGTTGG + Intergenic
1020985944 7:15134456-15134478 CAGGGCCTACTTGAGGGTGGAGG - Intergenic
1021419438 7:20428892-20428914 CAGGGCCTACTTGAGAGTGGAGG + Intergenic
1021618480 7:22527091-22527113 CAGGGCCTACTTGAGGGTGGAGG + Intronic
1022514034 7:30964184-30964206 CAGGGCCAACTGGAGCCTGGCGG + Intronic
1022694895 7:32695026-32695048 CAGGGCCTACTTGAGGGTGGAGG + Intergenic
1022928075 7:35076544-35076566 CAGGGCCTACTTGAGGGTGGAGG + Intergenic
1023618047 7:42040885-42040907 CAGATGCTACTGGAATCTAGAGG + Intronic
1023812132 7:43919756-43919778 CAGGGCCACCTGGATGCTGGTGG - Intronic
1024254590 7:47531093-47531115 CAGGGCCTACTTGAGGGTGGAGG + Intronic
1025850537 7:65239897-65239919 GAGCGCCTCCCGGAATCTGGTGG + Intergenic
1026851452 7:73726058-73726080 CAGGGGCTGCTGGGGTCTGGAGG + Intergenic
1026948423 7:74331371-74331393 CAGGGCCTCCTGAGATATGGAGG + Intronic
1028758385 7:94464728-94464750 CGGGGCCTACTTGAGTGTGGAGG - Intergenic
1029020897 7:97364051-97364073 CAGGGCAGAATGCAATCTGGTGG - Intergenic
1029078175 7:97952166-97952188 AAGGGCCTATTGAACTCTGGGGG - Intergenic
1032361666 7:131261976-131261998 GAGGACCTACTGGAGTGTGGAGG + Intronic
1033493433 7:141868097-141868119 CAGGGCCTACTTGAGGGTGGAGG + Intergenic
1033871220 7:145755584-145755606 TAGGGCCTACTTGAGTGTGGAGG - Intergenic
1036239833 8:7072337-7072359 AAGGGCCTATTGAACTCTGGGGG + Intergenic
1036262044 8:7248817-7248839 AAGGGCCTATTGAATTCTGGGGG - Intergenic
1036304547 8:7590741-7590763 AAGGGCCTATTGAATTCTGGGGG + Intergenic
1036314083 8:7707356-7707378 AAGGGCCTATTGAATTCTGGGGG - Intergenic
1036355400 8:8038733-8038755 AAGGGCCTATTGAATTCTGGGGG + Intergenic
1036584971 8:10115394-10115416 CAGGGGCCACTAGAAGCTGGAGG + Intronic
1036903500 8:12689228-12689250 AAGGGCCTATTGAACTCTGGGGG - Intergenic
1036907961 8:12723645-12723667 AAGGTGCTACTGGCATCTGGTGG - Intronic
1037475690 8:19255192-19255214 CATGCCCAACTGGAAACTGGAGG - Intergenic
1037539324 8:19856231-19856253 CAAGGCCTCCTGGACTGTGGGGG + Intergenic
1038799128 8:30733386-30733408 AAGGGCCTATTGAACTCTGGGGG + Intronic
1040407612 8:47121795-47121817 CAGGGCCTACTTGAGGGTGGAGG + Intergenic
1040672759 8:49712451-49712473 CAGGGCCTATTGGAAGGTGGAGG + Intergenic
1041302392 8:56426377-56426399 CAGGGCCTACTTGAGTGTGAAGG - Intergenic
1042751665 8:72164089-72164111 CAGGGCCTACTGGAAGGTGGAGG - Intergenic
1042764229 8:72302853-72302875 CAGGGCCTACTGGAAGGTGGAGG - Intergenic
1042820115 8:72921399-72921421 CAGGTCCTGCTGAAATGTGGTGG - Intronic
1043163166 8:76871447-76871469 CAGGGCTTTCTGAGATCTGGTGG + Intergenic
1043185957 8:77150146-77150168 CAGAGCCTACTTGAGTGTGGAGG + Intergenic
1043355829 8:79411511-79411533 CAGGGCCTACTGGAGAGTGGAGG + Intergenic
1043569438 8:81585997-81586019 CAGGGCCTACTTGAGGGTGGAGG - Intergenic
1043587152 8:81782590-81782612 CAGGGCCTACTTGAAGGTGGAGG - Intergenic
1044126241 8:88461155-88461177 CAGGGCCTACTTGAGGTTGGTGG - Intergenic
1045587490 8:103555018-103555040 CAGGGCCTACTTGAGCATGGAGG + Intronic
1046731368 8:117729914-117729936 CAGGTGCTACTGGCATCTAGTGG + Intergenic
1047169118 8:122473474-122473496 CAGGGCCTACTGGAAGGTGGAGG + Intergenic
1047609537 8:126507624-126507646 CAGGGCCTACTGGAGGGTGGGGG + Intergenic
1047641937 8:126829954-126829976 CAGGGCCTACTTGAGGATGGAGG + Intergenic
1047874998 8:129126377-129126399 CAAGGCGTACTGGAATCAAGAGG + Intergenic
1048860646 8:138722397-138722419 CAGGGCCTCCTGGAAGCTGAGGG - Intronic
1049523039 8:143104517-143104539 CAGGGCGTTCTGGATTTTGGAGG - Intergenic
1049784314 8:144443378-144443400 CAGGGTCTCTGGGAATCTGGCGG - Intronic
1050293969 9:4185836-4185858 CAGACCCAACTGGAAGCTGGAGG + Intronic
1051267861 9:15326097-15326119 CAGGGCCTACTTGAGGGTGGAGG + Intergenic
1051968596 9:22860681-22860703 CAAGGCCTACTTGAAGGTGGAGG + Intergenic
1051971651 9:22895026-22895048 CAGGTGCTACTGGCATCTAGAGG + Intergenic
1055361959 9:75501144-75501166 CAGGGCCTACTTGAAGGTGGAGG - Intergenic
1055990989 9:82105352-82105374 CAGGGCCTACTTGAGGGTGGAGG - Intergenic
1056489745 9:87093823-87093845 CGGGGCCTATTGGAAGGTGGAGG - Intergenic
1056535506 9:87524222-87524244 CAGGGCATGCTGGAATGTGCAGG - Intronic
1056917169 9:90756062-90756084 AAGGGCCTATTGAACTCTGGGGG - Intergenic
1058178028 9:101760971-101760993 CAGGGCCTACTTGACGGTGGAGG - Intergenic
1058831359 9:108820205-108820227 CAGGGCCTACTTGAGGGTGGAGG + Intergenic
1059839764 9:118200769-118200791 CAGGGCCTACTTGAGGGTGGAGG - Intergenic
1061560985 9:131403010-131403032 CAGGACCTACTGGAAAAAGGAGG + Intronic
1062224082 9:135439214-135439236 AAGGGCCTATTGAACTCTGGGGG - Intergenic
1062622163 9:137428026-137428048 CAGAGCCTCCTGGAACCTGTGGG - Exonic
1185730177 X:2455280-2455302 CGGGGCCTGCTGGAAGGTGGAGG + Intronic
1186052091 X:5607581-5607603 CAGGGCCTACTTGAGGATGGAGG + Intergenic
1186445584 X:9625546-9625568 AAGGCCATACTGGAATCCGGAGG + Intronic
1186584229 X:10854811-10854833 CAGAGACTACTGGCATCTAGTGG - Intergenic
1186632395 X:11364190-11364212 CAGGGCCTACTTGAGGGTGGAGG + Intronic
1187683723 X:21795419-21795441 TAGGGCCTACTGGAGGGTGGAGG - Intergenic
1187746425 X:22414214-22414236 CAGGGCCTACTTGAGGGTGGAGG + Intergenic
1188172573 X:26945978-26946000 CAGGGCCTACTTGAGGGTGGAGG - Intergenic
1188356892 X:29202846-29202868 CAAGGCCTACTTGAAGGTGGAGG + Intronic
1188738658 X:33749960-33749982 CAGGGCCTACTTGAGGATGGAGG - Intergenic
1189095665 X:38136395-38136417 CAGGGCCTACTTGAGGGTGGAGG - Intronic
1189190628 X:39099913-39099935 CAGGGCCTATTGGAGGGTGGAGG - Intergenic
1189388331 X:40555563-40555585 CAGGGCCTACTCGAGGGTGGAGG + Intergenic
1189571236 X:42300089-42300111 CAAGGCCTACTGGAGGGTGGAGG - Intergenic
1189611231 X:42738341-42738363 CAGGGCCTACTTGAGGGTGGAGG + Intergenic
1190167925 X:48088550-48088572 CAGGGCCTACTTGAGAGTGGAGG + Intergenic
1190327037 X:49212889-49212911 CAGGCCCTAGGGTAATCTGGAGG + Intronic
1190517940 X:51243952-51243974 CAGGGCCTGCAAGAATCTAGTGG + Intergenic
1190678807 X:52806352-52806374 CTGGGCCTACTGGACTGCGGGGG + Intergenic
1191206439 X:57838733-57838755 CAGAGCCTACTTGAAAGTGGAGG - Intergenic
1192042108 X:67633290-67633312 CAGGGCCTACTTGATGGTGGAGG - Intronic
1192338997 X:70246741-70246763 CAGGGCCTACTTGAGAGTGGAGG + Intergenic
1192354825 X:70391773-70391795 CAGGGCCTACTTGAGGGTGGAGG - Intronic
1192407311 X:70899657-70899679 CAGCACCTCCTGTAATCTGGAGG + Intronic
1193085167 X:77442409-77442431 CAGGGCCTACTTGAAGGTGGAGG - Intergenic
1193429361 X:81382084-81382106 CAGGACCTACTGGAGGGTGGAGG - Intergenic
1193557932 X:82979447-82979469 CAGGGCCTACTTGAAGCTGGAGG + Intergenic
1193851738 X:86545389-86545411 CAGGGCCTACTTGAGGGTGGAGG + Intronic
1194234428 X:91364692-91364714 CAGGGCCTACTTGAGGGTGGAGG + Intergenic
1195124868 X:101798259-101798281 CAGGGCCTACTGGGGGGTGGAGG + Intergenic
1195280252 X:103326530-103326552 CAGGGCCTACTTGAGGGTGGAGG + Intergenic
1195629416 X:107038806-107038828 CGGGGCCTACTTGAAGGTGGAGG + Intergenic
1195768324 X:108320259-108320281 AAGGGCCCACTTGAATTTGGTGG + Intronic
1196281331 X:113826411-113826433 TGGGGCCTACTTGAAGCTGGAGG - Intergenic
1196579943 X:117367075-117367097 CAGGGCCTACTTGAAAGTGGAGG - Intergenic
1197107797 X:122736421-122736443 CAGGGCCTACTTGAGGGTGGAGG + Intergenic
1197913175 X:131507561-131507583 CAGGGCCTACTTGAGGGTGGAGG - Intergenic
1198269559 X:135042520-135042542 CAGGGCCTACTTGAAGTTGGAGG - Intergenic
1198837722 X:140821837-140821859 CAGGGCCTACTTGAGGATGGAGG - Intergenic
1198945463 X:142008166-142008188 CAGGGCCTACTTGAGGGTGGAGG - Intergenic
1199217024 X:145271612-145271634 CAGGGCCTAATTGAAGGTGGAGG + Intergenic
1199886281 X:152024856-152024878 CAGGGCCTCCTCAAATGTGGAGG - Intergenic
1200604867 Y:5250600-5250622 TGGGGCCTACTGGAAGGTGGAGG + Intronic
1201552956 Y:15238004-15238026 GAGGTGCTACTGGCATCTGGTGG - Intergenic
1201713502 Y:17017794-17017816 CAGGGCCTACTTGAGGTTGGAGG + Intergenic