ID: 1102306320

View in Genome Browser
Species Human (GRCh38)
Location 12:111807379-111807401
Sequence AAGTGTACCCACTGGGAAGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 140
Summary {0: 1, 1: 0, 2: 0, 3: 9, 4: 130}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1102306320_1102306328 14 Left 1102306320 12:111807379-111807401 CCCACTTCCCAGTGGGTACACTT 0: 1
1: 0
2: 0
3: 9
4: 130
Right 1102306328 12:111807416-111807438 GCAGAGTCCACAACAGCAGGAGG 0: 1
1: 0
2: 4
3: 17
4: 232
1102306320_1102306329 17 Left 1102306320 12:111807379-111807401 CCCACTTCCCAGTGGGTACACTT 0: 1
1: 0
2: 0
3: 9
4: 130
Right 1102306329 12:111807419-111807441 GAGTCCACAACAGCAGGAGGTGG 0: 1
1: 0
2: 1
3: 27
4: 329
1102306320_1102306333 29 Left 1102306320 12:111807379-111807401 CCCACTTCCCAGTGGGTACACTT 0: 1
1: 0
2: 0
3: 9
4: 130
Right 1102306333 12:111807431-111807453 GCAGGAGGTGGCCATGTGGGTGG 0: 1
1: 0
2: 3
3: 62
4: 518
1102306320_1102306331 25 Left 1102306320 12:111807379-111807401 CCCACTTCCCAGTGGGTACACTT 0: 1
1: 0
2: 0
3: 9
4: 130
Right 1102306331 12:111807427-111807449 AACAGCAGGAGGTGGCCATGTGG 0: 1
1: 1
2: 1
3: 43
4: 380
1102306320_1102306327 11 Left 1102306320 12:111807379-111807401 CCCACTTCCCAGTGGGTACACTT 0: 1
1: 0
2: 0
3: 9
4: 130
Right 1102306327 12:111807413-111807435 CGAGCAGAGTCCACAACAGCAGG 0: 1
1: 0
2: 0
3: 12
4: 102
1102306320_1102306332 26 Left 1102306320 12:111807379-111807401 CCCACTTCCCAGTGGGTACACTT 0: 1
1: 0
2: 0
3: 9
4: 130
Right 1102306332 12:111807428-111807450 ACAGCAGGAGGTGGCCATGTGGG 0: 1
1: 0
2: 1
3: 36
4: 323

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1102306320 Original CRISPR AAGTGTACCCACTGGGAAGT GGG (reversed) Intronic
902103073 1:14009909-14009931 ATGTGTACACACTGGGAAACCGG + Intergenic
910328278 1:86037225-86037247 AAGTGTGAACACTGGGAAATGGG - Intronic
912678535 1:111710538-111710560 AACTGGTCCCACTGGAAAGTTGG + Intronic
915180135 1:154051610-154051632 AAATGTACCATCTGGCAAGTTGG - Intronic
916513609 1:165495418-165495440 AAGTCTGCCCCCTGGGGAGTTGG + Intergenic
916533460 1:165680486-165680508 AAGTGTGCCCACTGGCATGAAGG - Exonic
917802355 1:178582071-178582093 CAGAGAACTCACTGGGAAGTGGG - Intergenic
920950840 1:210570437-210570459 CAGTGTAGCCCCTGGGAACTAGG + Intronic
1064038515 10:11936614-11936636 AAGGGCCCCCACTGGGAGGTGGG - Exonic
1067208833 10:44241987-44242009 AAGGGTTCAGACTGGGAAGTGGG + Intergenic
1071427279 10:85571588-85571610 ACATGTCCCCACTGGGAAATTGG - Intergenic
1073585573 10:104706670-104706692 AAATTTATCCACAGGGAAGTGGG - Intronic
1075433400 10:122410398-122410420 AAGTGATCTCACTGGGCAGTTGG - Intronic
1077311676 11:1891580-1891602 AAGTGCTCGCACTGGGAAGCAGG + Intronic
1077865706 11:6219505-6219527 AAGATTCCCAACTGGGAAGTAGG + Intronic
1083876961 11:65529355-65529377 AAGTGTACCCCATAGGAAATAGG + Intronic
1084377943 11:68791275-68791297 CAGTGTCCCCAAAGGGAAGTGGG - Intronic
1085896389 11:80644565-80644587 GAGTGTCCCCACTGGCAAGAAGG + Intergenic
1089898598 11:121957611-121957633 AACTGTAAGCACTGAGAAGTAGG - Intergenic
1090728649 11:129550898-129550920 AAGTGCACCAAATGGGAAGGTGG - Intergenic
1090788168 11:130068730-130068752 CAGTTTACCCACAGGGAACTGGG + Intergenic
1091564785 12:1640152-1640174 ACGTATGCCCATTGGGAAGTGGG - Intronic
1092905048 12:13093472-13093494 CAGTGAACCTACTGGGATGTGGG + Intronic
1093296413 12:17397404-17397426 GAATGTACACACTGGGATGTGGG + Intergenic
1094101534 12:26769694-26769716 AAGTGTCTCCACTGAGAAGGAGG - Intronic
1097181910 12:57176483-57176505 CACTGTACACACTGGGCAGTGGG + Intronic
1101178095 12:102177972-102177994 AAGTGTACGCACAGTGCAGTGGG - Intronic
1102077263 12:110069527-110069549 CAGTGGACCCACTGGGAAGAAGG - Intronic
1102306320 12:111807379-111807401 AAGTGTACCCACTGGGAAGTGGG - Intronic
1102355470 12:112231125-112231147 AAGTGTTGCCTCTGTGAAGTTGG - Intronic
1103465263 12:121137377-121137399 CAGCAGACCCACTGGGAAGTGGG + Intronic
1104593032 12:130099785-130099807 AAGTGTTCCCAGTGGGTAGTGGG + Intergenic
1104605113 12:130182606-130182628 AGGAGGACCCACTGGGAAATGGG - Intergenic
1104898279 12:132174795-132174817 AAGAGGACTCACTAGGAAGTGGG + Intergenic
1105638308 13:22237315-22237337 AAGTGTATCTACTAGCAAGTGGG + Intergenic
1105944809 13:25180160-25180182 AAGTGAACCCACTAGGGAGACGG - Intergenic
1106058095 13:26257577-26257599 AAGAGTACTCAGTGGGAAGCAGG + Intronic
1107293383 13:38882796-38882818 AATTGAACCCAATGGTAAGTAGG - Exonic
1109629308 13:65023783-65023805 AAAGGTACACAGTGGGAAGTTGG - Intergenic
1110700363 13:78540329-78540351 AAGTGCAGCCATTGGGAAGATGG - Intergenic
1111033373 13:82637025-82637047 AGGTGAACCCATTGGGCAGTTGG - Intergenic
1114615969 14:24068662-24068684 AAGTGTCCTCTCTGGGAAGAGGG - Exonic
1118283398 14:64449515-64449537 AAGTGCACTCACTGGGCAGAAGG + Exonic
1119153542 14:72387699-72387721 AAGTCTTCACAGTGGGAAGTAGG + Intronic
1119909643 14:78337961-78337983 CAGAGTACCCAGTGGGAAGGTGG + Intronic
1120286332 14:82506486-82506508 AAGTTTAACCAGTGGAAAGTTGG - Intergenic
1120942151 14:89958673-89958695 AAGTGTGCCAAGTGGGAAGAGGG + Intronic
1121312034 14:92940552-92940574 GAGTGAACCCACTGGGAAGAGGG + Exonic
1123189145 14:106551283-106551305 CAGAGTACCCACTGGGCACTAGG + Intergenic
1126589548 15:50325193-50325215 AAGTGTACCCCATGGTAAGTGGG + Intronic
1127214277 15:56808200-56808222 AAATGTTCCCAATAGGAAGTGGG - Intronic
1127489693 15:59450879-59450901 ACGTGTACTCAGTGGGCAGTTGG - Intronic
1132851952 16:2028783-2028805 AGCAGTGCCCACTGGGAAGTGGG - Intronic
1140037294 16:71381027-71381049 AAGTGGACCCGCTGGCAAGATGG + Intronic
1141938957 16:87261580-87261602 AAGCCTGCCCACTGGGCAGTTGG + Intronic
1143932246 17:10441052-10441074 AAGTGTACACACAGAGAACTAGG - Intergenic
1146218582 17:30998853-30998875 AATTGCAGCCACTGGGCAGTTGG + Exonic
1153245411 18:3068320-3068342 AAATGTTACCACTGGGAAGCTGG - Intronic
1153586445 18:6625667-6625689 ACGTGTTCTCACTGGAAAGTGGG - Intergenic
1154293318 18:13129455-13129477 AAGTGAAGGCACTTGGAAGTAGG + Intergenic
1157536383 18:48461269-48461291 AAGTATGCCCTCTGGGTAGTAGG - Intergenic
1157864468 18:51168779-51168801 AAGTGTACCAATTGAGAAGAGGG - Intergenic
1158041061 18:53094275-53094297 CAGTGTCCCAACTGGGAAGAAGG + Intronic
1159756975 18:72378046-72378068 ACCAGTACCCACTGAGAAGTGGG - Intergenic
1166192903 19:41187358-41187380 AAGGCTACCCACTGGGGAATGGG - Intergenic
1167526780 19:49989200-49989222 AAGTGTACAGACTAGGAAGAGGG - Intronic
1167783109 19:51613376-51613398 AATGGTTCCCACAGGGAAGTTGG + Intronic
926198939 2:10779797-10779819 AAGGGCACCCACTGGGACGCTGG - Intronic
926632950 2:15154130-15154152 TAATGTATCCACTTGGAAGTTGG + Intergenic
935089135 2:99877252-99877274 CAGTGAAGCCACTGAGAAGTGGG + Intronic
936049022 2:109209117-109209139 TACTGTTGCCACTGGGAAGTGGG + Intronic
939610149 2:144300123-144300145 AACTGTACCCATTAGGCAGTGGG - Intronic
939753598 2:146080621-146080643 ATGGGTACTTACTGGGAAGTTGG + Intergenic
946443057 2:219713255-219713277 AATTCTAGCCAATGGGAAGTAGG - Intergenic
947007460 2:225528722-225528744 AGGTGAAAGCACTGGGAAGTGGG - Intronic
949001644 2:241617939-241617961 AAATGCACCCACTGGGACCTGGG + Intronic
1170967991 20:21093341-21093363 AAGTGCCCCCACTGGTCAGTAGG + Intergenic
1173398370 20:42702056-42702078 AAGTGTGACAAGTGGGAAGTGGG - Intronic
1174706931 20:52666528-52666550 AAGTGTACAAACTTGCAAGTAGG - Intergenic
1178440296 21:32593074-32593096 AAGGGTATCCTCTGGGAAGAAGG - Intronic
1179505065 21:41834680-41834702 ACGTGCACCCTCTGGGATGTGGG - Intronic
1180018660 21:45104705-45104727 AAGCGTGCCCTCTGGGGAGTAGG + Intronic
1180869474 22:19138187-19138209 AAAAGTGCCCACTGGCAAGTGGG - Intronic
1181040019 22:20187726-20187748 CAGTTTACCCTCTGGGAAGAGGG - Intergenic
1182100912 22:27656599-27656621 AAGCCTTCCCACTGGGGAGTGGG - Intergenic
1182115003 22:27751324-27751346 CAGTTTCCCCACTGGGAAATAGG + Intronic
1182447184 22:30396840-30396862 AAGTGTGCCCACTGGGACTGAGG - Exonic
950031335 3:9855755-9855777 CTGGGAACCCACTGGGAAGTCGG + Intergenic
950474612 3:13207513-13207535 AAGGGAACCCACTGGCACGTTGG - Intergenic
950542419 3:13620385-13620407 AAGTGTCCCCGATGGGGAGTGGG + Intronic
951359898 3:21712965-21712987 AAGTGGCACCACTGGCAAGTTGG - Intronic
951680812 3:25292722-25292744 AGCTGTCCCCACTGGCAAGTGGG + Intronic
953147951 3:40295965-40295987 AGGTGTAGCCAATGGGATGTAGG - Intergenic
954863325 3:53708393-53708415 AAGTGCTTTCACTGGGAAGTGGG + Intronic
955105769 3:55896200-55896222 AAGGGTTTCCACAGGGAAGTTGG + Intronic
958572598 3:95906993-95907015 TACTGTATCCACAGGGAAGTTGG - Intergenic
961649174 3:128408888-128408910 GAAGGTACCCACAGGGAAGTTGG + Intergenic
961675239 3:128560954-128560976 AGCTGCACCCACGGGGAAGTGGG - Intergenic
961783484 3:129335389-129335411 CAGGGAACCCACTGGGAAGTTGG + Intergenic
963380421 3:144523095-144523117 AAGTGTAGCCAATGAGAATTAGG + Intergenic
964949239 3:162267353-162267375 AAGTGTTCCCTCTGGGATTTAGG + Intergenic
969404717 4:6982961-6982983 AAGTGTATACAGTGGAAAGTAGG - Intronic
969635673 4:8368281-8368303 AAGTGGCCTCACTGGGAAGATGG + Intronic
979952388 4:126909263-126909285 AATAGTATCCACTGGGAAATGGG - Intergenic
983759999 4:171394184-171394206 AAATGTATCCACTGCAAAGTAGG - Intergenic
984411570 4:179404433-179404455 AAGTTTGCCCACAGTGAAGTAGG - Intergenic
987300258 5:16590765-16590787 GTGTGTACCCACCGGGGAGTAGG - Intronic
987580139 5:19779673-19779695 AATTTTACCCACTGGGATGTTGG - Intronic
997007013 5:129829554-129829576 ACTTGCACCCACTGGGAAGCAGG - Intergenic
997377313 5:133406372-133406394 AACTGTCCCACCTGGGAAGTGGG + Intronic
997415768 5:133727453-133727475 AGGTGTGCCCAGTGGGAAGATGG - Intergenic
1002183476 5:177443144-177443166 TTGGGTACCCACTGGGATGTGGG + Intergenic
1006564855 6:34946648-34946670 AAGAGAACCAACTTGGAAGTGGG + Intronic
1006604153 6:35244192-35244214 CAGTGTCCCCTCTGGGAAATTGG - Intronic
1006797843 6:36742476-36742498 AAGGGTACAAACTGGCAAGTGGG + Exonic
1007653698 6:43439098-43439120 AAGCCTTCCCAGTGGGAAGTGGG - Intronic
1015174251 6:130289255-130289277 AAGTGTACACACTGTGCAATAGG + Intronic
1019209769 6:170395473-170395495 ATGTGTTCCCACAGGGAGGTGGG + Exonic
1023340427 7:39213787-39213809 ATGTCTGCCCACTGGGATGTTGG - Intronic
1024119349 7:46221314-46221336 ACCTGTACCCACTGGCAAGGTGG - Intergenic
1029187366 7:98748767-98748789 AAGTTGAGCCACTGTGAAGTGGG - Intergenic
1032978693 7:137255835-137255857 TGGTGTAGCCATTGGGAAGTGGG - Intronic
1038625148 8:29185222-29185244 AAGTTGGTCCACTGGGAAGTTGG - Intronic
1041442529 8:57912412-57912434 AAGTATACCCTCTGGTTAGTAGG - Intergenic
1044047795 8:87459582-87459604 AAGTGCAACTACTGGGAAGGGGG + Intronic
1048837171 8:138531029-138531051 AAGTCTATGCATTGGGAAGTTGG + Intergenic
1049992592 9:1003845-1003867 AATTGTACCCACTGGAACGTGGG - Intergenic
1050812296 9:9763679-9763701 AAGTGTACAGATTGGAAAGTGGG - Intronic
1053598273 9:39585424-39585446 CAGGGCACCCGCTGGGAAGTGGG - Intergenic
1053738685 9:41118360-41118382 ATGTGTACCCCCTGGGATATTGG - Intergenic
1054689660 9:68312955-68312977 ATGTGTACCCCCTGGGATATTGG + Intergenic
1060259870 9:122065016-122065038 GAGTGTCACCACTGGGAATTTGG - Intronic
1061231793 9:129319763-129319785 CAGTGTCCCCATTGGGAAGGTGG - Intergenic
1062027031 9:134345300-134345322 AAGTGTAGCTGCTGGGAAGGAGG + Intronic
1062269716 9:135702846-135702868 AAGAGTCCCCAGTGGGAAGTGGG + Intronic
1189695766 X:43660276-43660298 AAGGGTGGCCACTGGGAAGGGGG - Intronic
1192070575 X:67936245-67936267 CAGTGAACCTATTGGGAAGTGGG + Intergenic
1196824428 X:119730076-119730098 AAGTGTTCCCACTCGGAGGAAGG - Intergenic
1198101252 X:133424035-133424057 AAGTGTACTCACTGAAAAGTGGG - Intergenic
1200006114 X:153085461-153085483 TAGTGTAGGCATTGGGAAGTGGG + Intergenic