ID: 1102310775

View in Genome Browser
Species Human (GRCh38)
Location 12:111842656-111842678
Sequence CCGCGCGGCCGAGGGAGCAA AGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 81
Summary {0: 1, 1: 0, 2: 2, 3: 4, 4: 74}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1102310775_1102310787 19 Left 1102310775 12:111842656-111842678 CCTTTGCTCCCTCGGCCGCGCGG 0: 1
1: 0
2: 2
3: 4
4: 74
Right 1102310787 12:111842698-111842720 CCTCCGCCTCTCCCGGCTGTGGG 0: 1
1: 0
2: 1
3: 21
4: 229
1102310775_1102310785 18 Left 1102310775 12:111842656-111842678 CCTTTGCTCCCTCGGCCGCGCGG 0: 1
1: 0
2: 2
3: 4
4: 74
Right 1102310785 12:111842697-111842719 GCCTCCGCCTCTCCCGGCTGTGG 0: 1
1: 0
2: 1
3: 35
4: 360
1102310775_1102310788 20 Left 1102310775 12:111842656-111842678 CCTTTGCTCCCTCGGCCGCGCGG 0: 1
1: 0
2: 2
3: 4
4: 74
Right 1102310788 12:111842699-111842721 CTCCGCCTCTCCCGGCTGTGGGG 0: 1
1: 0
2: 2
3: 18
4: 186
1102310775_1102310789 21 Left 1102310775 12:111842656-111842678 CCTTTGCTCCCTCGGCCGCGCGG 0: 1
1: 0
2: 2
3: 4
4: 74
Right 1102310789 12:111842700-111842722 TCCGCCTCTCCCGGCTGTGGGGG 0: 1
1: 0
2: 0
3: 19
4: 137
1102310775_1102310784 12 Left 1102310775 12:111842656-111842678 CCTTTGCTCCCTCGGCCGCGCGG 0: 1
1: 0
2: 2
3: 4
4: 74
Right 1102310784 12:111842691-111842713 TGAGCAGCCTCCGCCTCTCCCGG 0: 1
1: 0
2: 2
3: 23
4: 270

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1102310775 Original CRISPR CCGCGCGGCCGAGGGAGCAA AGG (reversed) Exonic