ID: 1102316609

View in Genome Browser
Species Human (GRCh38)
Location 12:111893513-111893535
Sequence GACTGCTTGCTGGAACTCAC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 161
Summary {0: 1, 1: 0, 2: 0, 3: 8, 4: 152}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1102316605_1102316609 28 Left 1102316605 12:111893462-111893484 CCATTGCTAGATTAGCTCTACTG 0: 1
1: 0
2: 0
3: 3
4: 68
Right 1102316609 12:111893513-111893535 GACTGCTTGCTGGAACTCACAGG 0: 1
1: 0
2: 0
3: 8
4: 152
1102316607_1102316609 5 Left 1102316607 12:111893485-111893507 CCAAGACATTTTTGTGGCTGTCA 0: 1
1: 0
2: 0
3: 25
4: 201
Right 1102316609 12:111893513-111893535 GACTGCTTGCTGGAACTCACAGG 0: 1
1: 0
2: 0
3: 8
4: 152

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1102316609 Original CRISPR GACTGCTTGCTGGAACTCAC AGG Intronic
902209963 1:14897864-14897886 AACCGCTTGCTGAAACTAACCGG + Intronic
902369321 1:15995599-15995621 CACTGCTTCCTGGAACTCTTGGG - Intergenic
905537471 1:38734306-38734328 GACTGTTTCTTGGAACTCAAGGG + Intergenic
906225851 1:44120507-44120529 GACTCCTCGCTTGAACTCTCAGG - Intronic
906395006 1:45455280-45455302 AACTGGTTGCTGGAATTCAGGGG - Intronic
906986880 1:50692138-50692160 CACTGCATGCTCGAACTCCCGGG - Intronic
907136751 1:52146259-52146281 GACTGGTTCCAGGAACCCACAGG - Intronic
910716984 1:90243057-90243079 TACTCCTTGCTGGAAATCATGGG + Intergenic
911809049 1:102250447-102250469 CACTTTTTCCTGGAACTCACTGG - Intergenic
915049292 1:153050264-153050286 GACTGCATGCTGTAACTCTGGGG - Intergenic
916121570 1:161533001-161533023 AAGTGCTTACTGGAACCCACTGG - Intergenic
920879893 1:209869998-209870020 GACTGCTTGATGGTTCTCTCTGG + Intergenic
923763678 1:236872199-236872221 GAGAGCTTCCTGGAACTCAGAGG - Intronic
1064852453 10:19724186-19724208 GGCTGCTTAGTGAAACTCACCGG - Intronic
1065207026 10:23366610-23366632 CACTGCTGCCTGGAACTCCCAGG + Intergenic
1069334000 10:67327518-67327540 GACTGCATGCTGTAACTCTGGGG + Intronic
1070980830 10:80645583-80645605 GACTGGTTGCTCGATCTTACAGG - Exonic
1076560538 10:131360442-131360464 GACCACTGGCTGGATCTCACTGG - Intergenic
1078453122 11:11455000-11455022 GACTGCTTGCTGGTTCCCTCAGG - Intronic
1088729713 11:112670401-112670423 TACTGCTGGCTGGAAAACACTGG - Intergenic
1088775119 11:113075140-113075162 CACTGCATGCTGGACCTCTCTGG + Intronic
1089294860 11:117461414-117461436 GACTGATGGCTGGGACTCAGGGG - Intronic
1090436296 11:126689424-126689446 AAGTGCTTGCTGGAGATCACAGG + Intronic
1094090038 12:26639237-26639259 GGCTGCTTGCTGGAAGTGAGAGG + Intronic
1097696701 12:62781615-62781637 CACTGCTCGCTGAAACTCAGTGG - Intronic
1098756743 12:74373435-74373457 GACTTCTAGCTGGGACTTACAGG - Intergenic
1101098988 12:101372800-101372822 AGCTGCTTTCTGGAACTCACTGG - Intronic
1102316609 12:111893513-111893535 GACTGCTTGCTGGAACTCACAGG + Intronic
1102587659 12:113934380-113934402 GGCTGCTTACTGGAAATCTCAGG + Intronic
1103965996 12:124639737-124639759 GACTGTTGGCTGGAAGTCAAGGG - Intergenic
1106173339 13:27307896-27307918 GCCTGCTTTCTGGAACTTCCTGG - Intergenic
1106386694 13:29292423-29292445 GAGTGCTTGCTTTAATTCACAGG + Intronic
1110700193 13:78538002-78538024 GTCTCCTTGCTGCAACCCACTGG - Intergenic
1112046307 13:95601736-95601758 GCCTGCCTACTGGCACTCACTGG + Intronic
1114532323 14:23403695-23403717 GCCTCCCTGCTGGTACTCACAGG + Exonic
1120544860 14:85798754-85798776 GACCACTTGCTGTAACTCTCAGG - Intergenic
1121943407 14:98094889-98094911 GACTGCCTGCTTGAAGTTACCGG + Intergenic
1126673160 15:51134945-51134967 GACTGCTGGCTGTCCCTCACAGG + Intergenic
1128759025 15:70202775-70202797 GACTGACAGCTGGAAGTCACAGG - Intergenic
1130056437 15:80530355-80530377 TACTGCTTGCTGGGACTTACTGG + Intronic
1130537838 15:84799694-84799716 GCCTGCTGGCTGGATCTCTCTGG + Intronic
1132255442 15:100372995-100373017 GAGTGCATTCTGGAAATCACCGG + Intergenic
1132950881 16:2561974-2561996 GGCTGCTTGTGGGAACACACAGG - Intronic
1132963468 16:2638196-2638218 GGCTGCTTGTGGGAACACACAGG + Intergenic
1134410996 16:14003190-14003212 GAGTGTTGGCTGGAATTCACAGG - Intergenic
1135963009 16:27013338-27013360 GATTCCCTGCTGAAACTCACTGG - Intergenic
1136451860 16:30358209-30358231 GTCTCCTTGCTGGAACCCAAGGG + Exonic
1138791407 16:59907988-59908010 GACTCCTTGATGGAACTTATTGG + Intergenic
1139629212 16:68218135-68218157 TACTGCATCCTGGAACTCCCTGG + Intronic
1141117193 16:81319103-81319125 CACTGCATCCTGGAACTCCCGGG - Intronic
1143206166 17:5140495-5140517 CACTGCTTCTTGGAACTCATGGG - Intronic
1144218396 17:13077881-13077903 GACGGATTGCTTGAACTCAGGGG + Intergenic
1144859608 17:18292605-18292627 TACTGCCTGCTGGAACCCATAGG - Intronic
1145267375 17:21386388-21386410 CACTGCAACCTGGAACTCACAGG + Intronic
1145734374 17:27216755-27216777 CACTGCCTCCTGGAACTCCCAGG + Intergenic
1146259577 17:31412718-31412740 GCCTGCTCCCTGGGACTCACTGG - Intronic
1146814580 17:35932167-35932189 GAGTGCCCACTGGAACTCACCGG - Intergenic
1146842443 17:36165333-36165355 CACTGCTTCCTGGAACTCGTGGG + Intergenic
1146854753 17:36253292-36253314 CACTGCTTCCTGGAACTCGTGGG + Intronic
1146865867 17:36335084-36335106 CACTGCTTCCTGGAACTCGTGGG - Intronic
1146870653 17:36377184-36377206 CACTGCTTCCTGGAACTCGTGGG + Intronic
1146878011 17:36428265-36428287 CACTGCTTCCTGGAACTCGTGGG + Intronic
1146881952 17:36449369-36449391 CACTGCTTCCTGGAACTCGTGGG + Intergenic
1147068737 17:37935696-37935718 CACTGCTTCCTGGAACTCGTGGG - Intergenic
1147073536 17:37977808-37977830 CACTGCTTCCTGGAACTCGTGGG + Intergenic
1147080260 17:38015233-38015255 CACTGCTTCCTGGAACTCGTGGG - Intronic
1147085058 17:38057346-38057368 CACTGCTTCCTGGAACTCGTGGG + Intronic
1147096208 17:38139193-38139215 CACTGCTTCCTGGAACTCGTGGG - Intergenic
1147101004 17:38181312-38181334 CACTGCTTCCTGGAACTCGTGGG + Intergenic
1147867962 17:43566130-43566152 CACTGCTGGCTGGAACTCTTGGG + Intronic
1149845595 17:60007775-60007797 CACTGCTTCCTGGAACTCGTGGG + Intergenic
1150083944 17:62264358-62264380 CACTGCTTCCTGGAACTCGTGGG + Intergenic
1151946872 17:77324375-77324397 GACTCCTTGCTGGACCCCTCTGG + Intronic
1152712670 17:81881394-81881416 CACTGCATCCTGGAACTCCCGGG - Intergenic
1154943717 18:21139214-21139236 AACTGTTTGGTGTAACTCACTGG + Intergenic
1155947722 18:31875428-31875450 GCCTGCCTGCCAGAACTCACTGG + Intronic
1156012387 18:32510464-32510486 GATTGCTTGCTGGAATTCAGGGG + Intergenic
1157441872 18:47717755-47717777 CCCTGCCTGCTGGAGCTCACAGG + Intergenic
1158422777 18:57310908-57310930 GACTGCTTCCTGGAAGTTACTGG + Intergenic
1160258735 18:77270436-77270458 GACTGCATCCTGGACCTCCCGGG - Exonic
1164572159 19:29382397-29382419 GACTGCTTTTTGGTTCTCACTGG - Intergenic
1166887315 19:45969961-45969983 CACTGCTTGCTGGGACACCCAGG + Intronic
925362486 2:3289186-3289208 GCCTGCTTCCTGGACCTCTCAGG + Intronic
926424497 2:12728708-12728730 GACTGTTTGCAGGAACTCAGTGG + Intronic
929518947 2:42629750-42629772 AACTGGTTGCTGGAATTCATGGG + Intronic
929812593 2:45203749-45203771 CACTGCTTGCTGTATCTCACAGG - Intergenic
935617451 2:105101220-105101242 GACTGCCTGGTGGGCCTCACGGG - Intergenic
935848975 2:107198252-107198274 GAATACTTACTGGAACCCACAGG - Intergenic
937717669 2:125052929-125052951 GGCTGTCTGCTGGAACTCAGTGG + Intergenic
945864473 2:215161358-215161380 GCCTCCTGGCTAGAACTCACAGG + Intergenic
947396145 2:229688657-229688679 GACTGCTTCCTGGGAGACACAGG + Intronic
948548836 2:238753784-238753806 GGCTGCTTCCTGGCATTCACAGG + Intergenic
948609541 2:239158019-239158041 GACTGCATGGTGGAATTCCCCGG - Intronic
948913238 2:241016701-241016723 GAATGTTTGGTGTAACTCACTGG + Intronic
949001191 2:241614993-241615015 TTCTGCTTTCTGGAACTTACAGG - Intronic
1169595972 20:7198748-7198770 TACTGCTTCCTTGAACTCCCAGG - Intergenic
1170419954 20:16183097-16183119 TAGTGCTGGCTGGAATTCACAGG + Intergenic
1171977905 20:31607008-31607030 GGCTGCCTGCTGGAACCCAGAGG - Intergenic
1175264132 20:57692404-57692426 GGCTGGTGGCAGGAACTCACAGG + Intronic
1177188404 21:17822685-17822707 GAACACCTGCTGGAACTCACAGG - Intergenic
1178742406 21:35214311-35214333 GACTGCTTGAAGGACCTCTCTGG - Intronic
1181975364 22:26725173-26725195 TACTGCAGGCTGGAACTCCCAGG + Intergenic
1184517048 22:44969089-44969111 CACTGCTTCGTGGAGCTCACTGG + Intronic
949315895 3:2754683-2754705 GATTGCTTGCTTGAAGTCACAGG - Intronic
949567538 3:5258778-5258800 CTCTGCTGCCTGGAACTCACTGG - Intergenic
950455473 3:13090460-13090482 GCCTGAGTGCTGGGACTCACTGG - Intergenic
950698926 3:14726727-14726749 GTCTGTGTGCAGGAACTCACTGG + Intronic
952644832 3:35642594-35642616 GTCTGCATGCAGGAACTCCCTGG - Intronic
955787144 3:62552595-62552617 GATTACTGGCTGGACCTCACTGG - Intronic
959271061 3:104210786-104210808 TAGTTCTTGCTGAAACTCACTGG + Intergenic
961147644 3:124608487-124608509 GACTAGTTGCTGGAAGTCAGCGG + Intronic
962986236 3:140538493-140538515 TACTGCTTACTGCAACTCTCAGG - Intronic
968087819 3:195881836-195881858 GTCTGGGTGCTGGAAATCACAGG - Intronic
968586414 4:1418733-1418755 CACTGCAGCCTGGAACTCACAGG + Intergenic
968606060 4:1536277-1536299 GCCTGCTTGCTGTAACACTCTGG - Intergenic
969226774 4:5803743-5803765 GAGAGCTTGCTGGCACTTACAGG - Intronic
970497070 4:16637091-16637113 GTCTTCTTGCTGTAAATCACTGG + Intronic
973027581 4:45292690-45292712 GACTGCATGCTATAACTCTCAGG + Intergenic
981511989 4:145567240-145567262 GACTGCATGCTGTAACTCTGGGG - Intergenic
982436408 4:155386127-155386149 CACTGCTTCCTGGAACTCTTGGG - Intergenic
983941861 4:173542358-173542380 GAGTGGCTGCTGCAACTCACTGG + Intergenic
986714308 5:10511657-10511679 GACTGCTTTTTGGGGCTCACAGG - Intronic
992881362 5:81113665-81113687 GACAGCTTTCTGGCCCTCACTGG - Exonic
1000156751 5:158559849-158559871 GGCTGCTTGCTGGAGCGCAGCGG + Intergenic
1001421553 5:171591188-171591210 GCCTGCTTAGTGGAACTCGCAGG - Intergenic
1001608625 5:172982308-172982330 CACTGCTGCCTGGAACTCCCGGG - Intergenic
1001919685 5:175590288-175590310 GACTGCATCCAGGGACTCACTGG + Intergenic
1202776095 5_GL000208v1_random:74133-74155 GACTGCTTTGAGGAATTCACTGG - Intergenic
1015561800 6:134524212-134524234 TACTGATGCCTGGAACTCACTGG - Intergenic
1017000040 6:149990265-149990287 GACCCATTCCTGGAACTCACCGG + Intergenic
1020981986 7:15081662-15081684 GAAAGCTTGAGGGAACTCACTGG - Intergenic
1022894695 7:34738280-34738302 GAATGCCTGGTGGAATTCACAGG + Intronic
1023116437 7:36867111-36867133 GGCTACTTCCTGGGACTCACTGG - Intronic
1024804373 7:53119879-53119901 GACTGATTGCTGTTATTCACAGG - Intergenic
1026564454 7:71478387-71478409 CACTGCAGCCTGGAACTCACAGG + Intronic
1029715364 7:102322495-102322517 CACTGCTTGCTGGCAGTCCCAGG + Intergenic
1033149070 7:138897573-138897595 GACTGCTTGCAGGATCACAAAGG + Intronic
1034151970 7:148924166-148924188 CACTCCTTTCTGGAGCTCACTGG - Intergenic
1034187714 7:149191836-149191858 GACTGGTTTCCGGAAATCACTGG - Intergenic
1034560448 7:151876487-151876509 GACCGAGTGCTGGGACTCACCGG + Exonic
1035695799 8:1594903-1594925 GACTTCTTCCTGCCACTCACTGG + Intronic
1036178393 8:6561971-6561993 CACCGGTTGCTGGAACTGACGGG + Intronic
1036958469 8:13216602-13216624 GATTGCATGCTGGAGCTCTCAGG - Intronic
1038195258 8:25361139-25361161 GACGGCATGATGGAACTCACAGG - Intronic
1039044833 8:33440284-33440306 CACTGCAGGCTGGAACTCCCAGG - Intronic
1040668635 8:49659529-49659551 GACTGCATGCTGTAACTCTGGGG - Intergenic
1045835138 8:106511445-106511467 GTCTTCTTGCTGGAAATTACTGG + Intronic
1047874335 8:129118998-129119020 GAATGCTTGCTTGAACTCTGTGG + Intergenic
1056385431 9:86092785-86092807 GGCTGGTGGCAGGAACTCACAGG + Intronic
1056521233 9:87403366-87403388 GACTGCTTGCAACATCTCACTGG - Intergenic
1057083725 9:92190192-92190214 GACTGCTTCCTGGGTCTCAGGGG - Intergenic
1057489884 9:95512317-95512339 GAGTGCGTCCTGGAACCCACGGG - Intronic
1061809616 9:133154784-133154806 GACTCCTTCCTGGAACTTCCTGG - Intronic
1186122658 X:6380748-6380770 GAATTCTTGCTGGAAGTAACTGG + Intergenic
1187504410 X:19867212-19867234 GAGTCCTTGCAGGAACCCACTGG + Intronic
1190103403 X:47540551-47540573 CACTGCAGGCTTGAACTCACAGG - Intergenic
1190717500 X:53116093-53116115 GGCTGCTAGCAGGAACTCAGAGG - Intergenic
1192995191 X:76505760-76505782 GCCTCCTTGCTAGAACTCAGGGG - Intergenic
1199721248 X:150544084-150544106 AACTCCTTGTTGGAATTCACTGG - Intergenic
1200152644 X:153958816-153958838 CCCTGCTTGGTGGACCTCACCGG + Intronic
1201505542 Y:14695517-14695539 GACAGCTTGCTGGTACTGTCTGG + Intronic