ID: 1102326785

View in Genome Browser
Species Human (GRCh38)
Location 12:111992554-111992576
Sequence TCTTATATTTAGAAGATGTT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 395
Summary {0: 1, 1: 0, 2: 0, 3: 25, 4: 369}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1102326785_1102326790 17 Left 1102326785 12:111992554-111992576 CCAAACATCTTCTAAATATAAGA 0: 1
1: 0
2: 0
3: 25
4: 369
Right 1102326790 12:111992594-111992616 AGTGTTTAGGGATGTGGCTGAGG 0: 1
1: 0
2: 7
3: 32
4: 316
1102326785_1102326788 5 Left 1102326785 12:111992554-111992576 CCAAACATCTTCTAAATATAAGA 0: 1
1: 0
2: 0
3: 25
4: 369
Right 1102326788 12:111992582-111992604 GGTATTCTGCTAAGTGTTTAGGG 0: 1
1: 0
2: 2
3: 18
4: 182
1102326785_1102326787 4 Left 1102326785 12:111992554-111992576 CCAAACATCTTCTAAATATAAGA 0: 1
1: 0
2: 0
3: 25
4: 369
Right 1102326787 12:111992581-111992603 AGGTATTCTGCTAAGTGTTTAGG 0: 1
1: 0
2: 5
3: 29
4: 306
1102326785_1102326789 11 Left 1102326785 12:111992554-111992576 CCAAACATCTTCTAAATATAAGA 0: 1
1: 0
2: 0
3: 25
4: 369
Right 1102326789 12:111992588-111992610 CTGCTAAGTGTTTAGGGATGTGG 0: 1
1: 0
2: 1
3: 15
4: 160

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1102326785 Original CRISPR TCTTATATTTAGAAGATGTT TGG (reversed) Intronic
900213076 1:1466996-1467018 TTTTATAGTTTGAAGATTTTAGG + Intronic
900225617 1:1532421-1532443 TTTTATAGTTTGAAGATTTTAGG + Intronic
903116185 1:21180436-21180458 TCGTATTTTTAGAAGAAGTAGGG + Intergenic
903308662 1:22434283-22434305 TCTAAGATTTTGAAGATTTTTGG + Intergenic
904043216 1:27595988-27596010 TTGTCTATTTAGAAGGTGTTGGG + Intronic
904302637 1:29564930-29564952 TCTTATATTTGGGAGATGAAAGG + Intergenic
906649049 1:47497785-47497807 TATTATATTTAGAATATGTAAGG - Intergenic
906700770 1:47856448-47856470 TCTTGGATTTAGGATATGTTTGG + Intronic
907151000 1:52287414-52287436 TCTTTTATTAAGAAAGTGTTTGG + Intronic
907340992 1:53736231-53736253 TCTTTTATTTTGGACATGTTTGG + Intergenic
907667234 1:56444022-56444044 ACTTTTATTTAGGAGATATTAGG - Intergenic
909193012 1:72578165-72578187 ACTCATTTGTAGAAGATGTTGGG + Intergenic
909801912 1:79820583-79820605 TGTGATATTTAGAAGATGGAGGG + Intergenic
909843456 1:80359504-80359526 TCATATTTTTAGAAAATTTTCGG + Intergenic
910029300 1:82697711-82697733 ATTTATATTTAGAAAATTTTAGG - Intergenic
910871084 1:91833593-91833615 TTTTATTTTTAGTAGATGTGGGG - Intronic
911134390 1:94423669-94423691 GCTTTTATTTAGAAGTTTTTTGG + Intronic
911537955 1:99123111-99123133 TCTTATATGGAGAAGAATTTAGG + Intergenic
911589347 1:99728676-99728698 TCTTATTTTTAGCAAATCTTTGG - Intronic
912036986 1:105329540-105329562 TATTATATTTAGAAAATTATTGG - Intergenic
912856714 1:113175658-113175680 TCTTATATTTAGTAGAGATGGGG - Intergenic
914710585 1:150209589-150209611 TATAATATTTTGAATATGTTGGG + Intergenic
914869984 1:151465042-151465064 TCTTATGTTTAGAAGAGTTGGGG + Intergenic
915727636 1:158029512-158029534 TCTTATATTTAGATAATGATGGG + Intronic
917609775 1:176675840-176675862 ACTTGTATTTAGAAGATATACGG + Intronic
918235774 1:182579350-182579372 TCTCATATTTAGAAAGAGTTTGG + Intronic
918556964 1:185814145-185814167 TCTTCTATTTTCAAGTTGTTAGG - Intronic
919346992 1:196394946-196394968 TCTTAGATTAAGAAGTTCTTTGG + Intronic
920618130 1:207514711-207514733 TCTTATCTCTAAAATATGTTAGG - Intronic
921497710 1:215861393-215861415 TATTATATTTTGGAGATTTTAGG - Intronic
921943257 1:220865201-220865223 TTTTATTTTTTGAAGATTTTGGG + Intergenic
923298391 1:232617136-232617158 TCTGATACTTAGAAAATTTTAGG - Intergenic
923516623 1:234703211-234703233 TCTTATTTTTAGTAGAGGTGGGG + Intergenic
924783497 1:247172947-247172969 TCTTATCTATAGAAGAGGCTGGG - Intergenic
1063519778 10:6730790-6730812 TCTCAGAGTAAGAAGATGTTGGG + Intergenic
1064128340 10:12684752-12684774 GAATATATTCAGAAGATGTTGGG + Intronic
1065304975 10:24359718-24359740 TCTTAGAATTAGAAGCTGTTGGG + Intronic
1065422324 10:25558961-25558983 TCTTCTATTTGGGAGTTGTTTGG + Intronic
1067000560 10:42607948-42607970 TCTTATAGATAGCACATGTTTGG - Intronic
1067383894 10:45800680-45800702 GCTTTTATATAGAAGATCTTTGG + Intergenic
1067393316 10:45886321-45886343 TGTTATATTTGGTAAATGTTGGG - Intergenic
1067732056 10:48819634-48819656 TTTTATATTTATAAAATGTTGGG - Intronic
1067813548 10:49451204-49451226 TCTTGTATGTAGAAGATTCTAGG - Intergenic
1067861638 10:49855451-49855473 TGTTATATTTGGTAAATGTTGGG - Intronic
1067891588 10:50141258-50141280 GCTTTTATATAGAAGATCTTTGG + Intergenic
1068325274 10:55477141-55477163 TCTTATGTTTAGTATCTGTTGGG - Intronic
1068674079 10:59752037-59752059 GTTTATATTTTGAAGTTGTTTGG + Intergenic
1068797587 10:61101232-61101254 TCTTATATTTAGAAAAAAATGGG - Intergenic
1069464372 10:68625157-68625179 TGTTAAATTTAGAAGGTCTTAGG + Intronic
1073365812 10:102940124-102940146 TTTTATTTTTAGTAGATGTGGGG + Intronic
1073504262 10:103969911-103969933 TCTTGTAGTTAGAAGGTGGTAGG + Intronic
1073864430 10:107785784-107785806 TCTTATATTTAGCAGCCCTTAGG + Intergenic
1073898376 10:108189547-108189569 TCTTATATTTAGAAAATTTAGGG + Intergenic
1075661246 10:124198036-124198058 TCTTCCATTTGGAAGTTGTTGGG + Intergenic
1076500971 10:130935791-130935813 TCTTATTTTTAGAATATTATGGG - Intergenic
1077846950 11:6035760-6035782 TGTTATGTTCAGAAGATGGTGGG - Intergenic
1078755115 11:14201568-14201590 TCTTATTTTTAGAAGAGATGAGG + Intronic
1079558924 11:21796925-21796947 TCTTATATATAGAAAATCCTGGG - Intergenic
1080332603 11:31157009-31157031 ACTTATTTTTATAAGATGCTTGG - Intronic
1080980167 11:37392732-37392754 TCTTCTATATAGAATATCTTGGG - Intergenic
1082160100 11:48881336-48881358 TTTTATATTTTAAAGATGTCTGG - Intergenic
1082162266 11:48899070-48899092 TTTTATATTTTAAAGATGTCTGG + Intergenic
1084350528 11:68595538-68595560 TTTTAAATTTTGATGATGTTCGG - Intronic
1085338505 11:75716011-75716033 GCTTATATTTATTAGTTGTTAGG + Intergenic
1085954106 11:81369778-81369800 TGTTATATTTAGAAGGTTTTAGG - Intergenic
1086525533 11:87721819-87721841 TGTTATTTTTGCAAGATGTTTGG + Intergenic
1086661275 11:89421606-89421628 TTTTTCATTTAGAAGATATTAGG + Intronic
1087358590 11:97127520-97127542 TCTTCTATTTATATGAAGTTGGG + Intergenic
1087530080 11:99369557-99369579 TTTTATATTTATAATATATTAGG - Intronic
1087530779 11:99379224-99379246 TTTCATATTTAGTAGATGTCAGG - Intronic
1088476864 11:110249695-110249717 TCTTATTTTTAGAAGAGATGAGG - Intronic
1089225159 11:116913506-116913528 TCCTATATTGAGGAGGTGTTTGG - Intronic
1090305848 11:125690321-125690343 TCTGATTTTTAGTAGATGTAAGG - Intergenic
1091164347 11:133459454-133459476 TCTTATATATAGGATATGCTTGG - Intronic
1091326698 11:134695698-134695720 TTTGATATTTGGAAAATGTTGGG - Intergenic
1093395874 12:18681467-18681489 TCTCACATTTAGAATAGGTTGGG - Intergenic
1093431208 12:19087335-19087357 CCCTATATTTAGAAAAGGTTAGG + Intergenic
1094382974 12:29863749-29863771 ACTTTTATTTAAAAGATGATTGG + Intergenic
1095327141 12:40908411-40908433 TCTTGTATTCAGTAGAAGTTCGG - Exonic
1096439203 12:51624961-51624983 TCATACATTTATAATATGTTAGG + Intronic
1098037699 12:66322215-66322237 TATTATATTTAGAAGCTCATAGG + Intronic
1098055371 12:66499364-66499386 TCTTATATTTAGAGTACTTTTGG - Intronic
1099327479 12:81237453-81237475 TCTGATATTTAGGTAATGTTGGG + Intronic
1099416242 12:82390536-82390558 TCTTATCTCTAGAAGAAGATCGG + Intronic
1099516983 12:83609153-83609175 TGTTACATTTTGAAGCTGTTTGG + Intergenic
1099654664 12:85474409-85474431 TCTAATATTTACAAAATGTTTGG + Intergenic
1099740961 12:86633425-86633447 TTTGAGATATAGAAGATGTTGGG - Intronic
1099873719 12:88379390-88379412 TTTTATATTTTGAAGATGATTGG - Intergenic
1101377050 12:104180244-104180266 TCCTCTATTTAGAAGTTTTTAGG + Intergenic
1102326785 12:111992554-111992576 TCTTATATTTAGAAGATGTTTGG - Intronic
1103142483 12:118561141-118561163 TGTTATATTTAGGACATATTGGG + Intergenic
1103364590 12:120372229-120372251 TCTAGTACATAGAAGATGTTCGG - Intergenic
1105360693 13:19712041-19712063 TTTTATAGCTAGAAGATTTTGGG - Intronic
1105528473 13:21197532-21197554 TTTTATATTTTGGAGATTTTAGG + Intergenic
1106742395 13:32659804-32659826 TCTGTTATTTAGAAGGGGTTTGG + Intronic
1106944729 13:34814566-34814588 TTTTATATTTAGAAATAGTTTGG - Intergenic
1107676283 13:42800857-42800879 TTTTATGATTGGAAGATGTTGGG - Intergenic
1109646067 13:65258424-65258446 TCTTATTTTTAGGAGATATGTGG - Intergenic
1109790290 13:67238232-67238254 TATTATATTTTAAAGATTTTGGG + Intergenic
1109933740 13:69251479-69251501 GCTTATACTTAGAATATTTTAGG - Intergenic
1110304357 13:73967776-73967798 CCTTCTATGTAGAAGATATTAGG - Intronic
1111293566 13:86199920-86199942 TTGTATTTTTAGAAGAAGTTGGG + Intergenic
1111380799 13:87448457-87448479 TCTTATAGTTAGAAGAGACTTGG - Intergenic
1111603600 13:90506598-90506620 TCATATAGTTAGAGAATGTTTGG - Intergenic
1112071706 13:95859103-95859125 TTTTATATTTAGAAGATTTCAGG - Intronic
1113915784 13:113873338-113873360 TTTTATATTTGGAAAATTTTGGG + Intergenic
1114160440 14:20160042-20160064 TCTTATTGTAAGAATATGTTTGG + Intergenic
1114726131 14:24939753-24939775 TCTTATATTTATTACGTGTTGGG - Intronic
1114877148 14:26734394-26734416 ACTTATATTTGGGAAATGTTTGG + Intergenic
1114960101 14:27876064-27876086 TCATATATTTAGAAGCTTTGAGG + Intergenic
1115209411 14:30950348-30950370 CCTTATATTTTGAAAATTTTGGG - Intronic
1115429897 14:33304531-33304553 TCTTATGTTTAGAAAATAATGGG - Intronic
1115514011 14:34167185-34167207 TTTTATATTTAAAAGCTGCTGGG - Intronic
1115694032 14:35877310-35877332 GCTTAAATTTAGAATTTGTTAGG - Intronic
1116167058 14:41348070-41348092 TCCAATATTTGGAAGAAGTTTGG + Intergenic
1117050971 14:51859475-51859497 TATTATTTTTAGAGGATGTTGGG - Intronic
1117914754 14:60665673-60665695 TCTTTCATTTAGAAGAATTTGGG - Intergenic
1119037443 14:71242250-71242272 TCTTTACTTTAGAAGATTTTGGG + Intergenic
1119369045 14:74122473-74122495 TATTTTATTTAAAATATGTTAGG + Intronic
1121196149 14:92074152-92074174 TCTTATTTTTAGTAGAGGTGGGG - Intronic
1124150169 15:27170182-27170204 TCATTTCTTTAAAAGATGTTTGG + Intronic
1124185327 15:27520635-27520657 TGTTTTATTAAGAAGATTTTGGG - Intronic
1124597598 15:31103440-31103462 TGAAATATTTAGAACATGTTGGG + Intronic
1125228666 15:37426972-37426994 GCATATATTTAGAATGTGTTTGG + Intergenic
1126505057 15:49395791-49395813 TATTAAATTTTGAAGATGTGTGG + Intronic
1126585802 15:50285026-50285048 TCTTATATTTACATGAATTTAGG + Intronic
1126605614 15:50472996-50473018 TCTTATTTGTAGAAGCTCTTTGG - Intronic
1126751341 15:51880427-51880449 TCTTAAGTTTAGAACATTTTTGG + Intronic
1127163456 15:56217192-56217214 TCTTATTCTTAGGAGATGTCAGG - Intronic
1128824019 15:70692989-70693011 ACTTGTAATTAGAGGATGTTTGG - Intronic
1129859016 15:78845815-78845837 TCTTTTAGTTAGATGTTGTTAGG + Intronic
1130154881 15:81341673-81341695 TCTTATCTTTAGAAGGTGGAGGG - Intronic
1130346804 15:83054864-83054886 TCTATCATTTAGAAAATGTTTGG - Intronic
1130776504 15:86989981-86990003 TCTGATATTTAGAACCTGTCAGG - Intronic
1131900573 15:97083397-97083419 GCTTCTATTTACAACATGTTTGG + Intergenic
1135239848 16:20794645-20794667 TCTTAGAATTACAAGAAGTTTGG - Intronic
1136286143 16:29243815-29243837 TGTGATTTTTAGAGGATGTTTGG + Intergenic
1139103590 16:63799750-63799772 TCATATACTTAGAAGATGATAGG - Intergenic
1139288547 16:65836832-65836854 AGTGATATTTAGAAGATGTCAGG - Intergenic
1139713772 16:68796387-68796409 TATTATTTTCAGACGATGTTGGG - Intronic
1140164864 16:72540659-72540681 TCTTATATTTAGGTACTGTTTGG - Intergenic
1141298864 16:82794685-82794707 TATTATATTTATAGGGTGTTTGG - Intronic
1142091484 16:88214007-88214029 TGTGATTTTTAGAGGATGTTTGG + Intergenic
1142799117 17:2333752-2333774 TGTTAGATTTAGGAGATTTTTGG - Intronic
1144083922 17:11791180-11791202 TCTTATTTTTAAAAAATTTTAGG + Intronic
1144155587 17:12497559-12497581 ACTTAAATTTTGAAGATCTTTGG + Intergenic
1149279740 17:55089955-55089977 TCCTATATTAAAAAGATTTTAGG - Intronic
1153105666 18:1523014-1523036 TCTTATTTTTATTAGATATTTGG - Intergenic
1153266805 18:3279378-3279400 TCTTATATTTGTTAGATCTTGGG - Intergenic
1153721342 18:7906431-7906453 TCTTATATATAGGAGATACTTGG + Intronic
1153730612 18:8007872-8007894 TCTAATAGTTAAAAGACGTTAGG + Intronic
1153816123 18:8791646-8791668 TCTATTATTTAGAAAATGTGTGG - Intronic
1155052287 18:22158997-22159019 TTTTATAGTTAAAAGATCTTTGG + Intergenic
1155744627 18:29338507-29338529 TCTCATATTATGAGGATGTTGGG + Intergenic
1156284758 18:35681007-35681029 GTTTATATTTAGTAGAGGTTAGG + Intronic
1156298645 18:35816450-35816472 TTTTATATTTATAAAATATTTGG - Intergenic
1156405380 18:36778160-36778182 GCTTATATTTAGGGGATGATGGG + Intronic
1157317990 18:46609387-46609409 TCTTATATTAGGAAAATATTTGG - Intronic
1158930191 18:62316714-62316736 TATTATATTTTGAATATCTTGGG - Intergenic
1165206092 19:34187667-34187689 GCTTAAATTTAGAACATTTTTGG + Intronic
1165350193 19:35271008-35271030 TCTAATACTTAGCAGATGCTTGG + Intronic
1167785360 19:51631174-51631196 TCTTATGTTAAGAAGATTCTTGG + Intronic
1167801746 19:51747388-51747410 TCGTATATTTAGTAGAGGTGGGG + Intronic
1167996271 19:53405043-53405065 TCTTGTATTTAGTAGATTTGAGG - Intronic
925748261 2:7063461-7063483 TCTTATATTTACCTGATCTTTGG - Intronic
926661361 2:15470659-15470681 TTTTATATAGTGAAGATGTTTGG - Intronic
926829928 2:16950583-16950605 TCTTATCTTTACAAGTTGTTTGG - Intergenic
927163709 2:20295775-20295797 TATTATATTTTGGATATGTTGGG + Intronic
927543470 2:23932369-23932391 CCATATATTTAGCAGATTTTAGG - Intronic
928981699 2:37142717-37142739 TCTCAGATTTGGAAAATGTTGGG - Intronic
928997391 2:37307593-37307615 TCTTACATTTAGTAGACATTTGG - Intronic
931639878 2:64372504-64372526 TCTTATATACTGGAGATGTTTGG - Intergenic
932554052 2:72803121-72803143 TCTGATATTTTGAATATGCTTGG - Intronic
933012027 2:77077787-77077809 TATTGTTTTTAGAAGTTGTTGGG - Intronic
934954234 2:98603610-98603632 TCTTTGATTTGGAAGATGTATGG - Intronic
935023614 2:99255505-99255527 TCGCAAATTTAGAAGCTGTTTGG - Intronic
935442637 2:103119639-103119661 TATAATGTTTAAAAGATGTTAGG + Intergenic
936548956 2:113418263-113418285 TCTGACATTTGGAAGCTGTTTGG - Intergenic
938851739 2:135267454-135267476 TCTTTTTTTTAGAAGAGGGTGGG + Intronic
939044149 2:137230231-137230253 TTTTATAATTAACAGATGTTAGG - Intronic
941146883 2:161859072-161859094 TCTTAACTTTAAAAGATATTGGG - Intronic
941600106 2:167532371-167532393 TATTTTATTTAGCAAATGTTTGG - Intergenic
941968452 2:171323532-171323554 TCTTAGATATACAAGTTGTTAGG - Exonic
942355060 2:175102272-175102294 GCTTTTGTTTAGAATATGTTTGG - Intronic
942822804 2:180136098-180136120 CCTTATATATAGCACATGTTGGG - Intergenic
943765053 2:191651739-191651761 TCATATAATTAGAAGATTTCTGG + Intergenic
943893417 2:193321179-193321201 TCTTATGCTTATAAGATATTTGG - Intergenic
943920032 2:193694614-193694636 TTTTATTTTTAAAAGATTTTGGG - Intergenic
944070388 2:195661312-195661334 TTTTTTATTGAGAATATGTTTGG - Intronic
944239494 2:197472185-197472207 TTTAATATTTAGAGGATATTTGG + Intronic
944523834 2:200598297-200598319 TGTTATATTTAGAGCTTGTTTGG + Intronic
945275988 2:207988190-207988212 TCTTGTATATATAAGATGCTTGG + Intronic
945735106 2:213589211-213589233 TCTGCCATTTAGAAGAAGTTTGG - Intronic
946669389 2:222086228-222086250 AAGTATATTTAAAAGATGTTGGG + Intergenic
947151365 2:227119567-227119589 TCTTATATATACAATATATTTGG + Intronic
947185067 2:227447438-227447460 TCTTATATTTAGTAGAGATGGGG + Intergenic
947621081 2:231591599-231591621 GCCTACATTAAGAAGATGTTTGG - Intergenic
947881094 2:233513674-233513696 GCCTATATTTAAAATATGTTGGG + Intronic
948595074 2:239074644-239074666 TCTTATGTCTAGCAGGTGTTTGG - Intronic
1169026766 20:2378264-2378286 TCTTAAATTTATAAGAATTTAGG - Intergenic
1169138580 20:3213243-3213265 TTTTATTTTTAAAAGATGGTTGG + Intronic
1172261545 20:33570386-33570408 GATTATATTTAGAATAGGTTAGG + Intronic
1174992285 20:55523685-55523707 TCTAATATTTAGAATCTGTAAGG - Intergenic
1175051710 20:56161607-56161629 TATTATAATTAGAAGATTTAGGG - Intergenic
1177006508 21:15679359-15679381 CCTTATACTTAGAAAATATTGGG - Intergenic
1177458975 21:21384546-21384568 TCTTATATGTAGCAAAAGTTTGG - Intronic
1178720361 21:35003555-35003577 TCTTATATTAAATAGATATTGGG + Intronic
1183920099 22:41159349-41159371 TCTTTTATTTACAAAAAGTTAGG + Intronic
1184818300 22:46889002-46889024 TCTTATTTTAAAAAGATTTTTGG - Intronic
949326649 3:2873492-2873514 TCTTAAATTTAGAAGTTTGTGGG - Intronic
949973538 3:9433282-9433304 TCTAATATTTGAAAGGTGTTGGG + Intronic
951969836 3:28431253-28431275 TCATATATATATAAGATATTTGG - Intronic
952178910 3:30896937-30896959 TCTTATTTTTATAAGCTTTTTGG + Intergenic
953802199 3:46032649-46032671 TCTTATTGTTACAAGATCTTTGG - Intergenic
953988032 3:47460728-47460750 TCTTATTTTTAGTAGATATGGGG + Intronic
955115406 3:55994444-55994466 TCTTATATTTACAAAAGATTAGG + Intronic
955183223 3:56691197-56691219 TCTTATTTTTTGTAGATATTGGG + Intergenic
955817300 3:62858895-62858917 TCATATTTATAGAAAATGTTTGG + Intronic
956351031 3:68336894-68336916 TCTTATTTTTAGAAGAGATGGGG + Intronic
956392906 3:68793237-68793259 TTTTCTATTTAGTAAATGTTGGG - Intronic
956493796 3:69802700-69802722 TTTTTTTTTTAGAGGATGTTTGG + Intronic
957178790 3:76849314-76849336 TCTCATATTTGGAAAAAGTTTGG + Intronic
957278829 3:78123940-78123962 TCATATATTTAGAACCTTTTTGG + Intergenic
958648303 3:96901881-96901903 TCACATATTTAATAGATGTTTGG - Intronic
959274725 3:104263766-104263788 TATAACATTTAGAAAATGTTGGG + Intergenic
959573957 3:107913735-107913757 TCTTTTGTTTAGAAGACATTGGG - Intergenic
959581506 3:107987651-107987673 TTTTATAATTAGAGTATGTTAGG + Intergenic
959671981 3:108989000-108989022 TCTGATGTTTAAAAGATTTTTGG + Intronic
959979529 3:112499866-112499888 TCTTTTATGTAAAAGATTTTAGG + Intergenic
960049908 3:113229243-113229265 TCTGGTATTAAGAGGATGTTGGG + Intronic
960235007 3:115272018-115272040 TATTTTATTTAGAACATTTTTGG + Intergenic
960700785 3:120437299-120437321 TCTTATTTTTGGAATATGGTAGG + Intronic
962012260 3:131403355-131403377 TCTATCATTTAGAAGAGGTTTGG - Intergenic
962975995 3:140446340-140446362 ACTTATAATAAGAGGATGTTTGG - Intronic
963040006 3:141063268-141063290 TCTTATATGTAGCATATGGTTGG + Intronic
963738089 3:149044432-149044454 TCTAATATTTAGCACATGGTAGG - Intronic
964036262 3:152201361-152201383 TCTTTTCTTTAGAGAATGTTAGG - Intergenic
964426498 3:156559869-156559891 TCTCACATTTAGAAGATTCTGGG - Intergenic
964966378 3:162498165-162498187 TATTATATTTAGATTATTTTGGG - Intergenic
964981039 3:162680020-162680042 ATTAATATTTAGATGATGTTCGG + Intergenic
965193815 3:165567778-165567800 TATCAAATTTAGAAAATGTTTGG + Intergenic
965470251 3:169081410-169081432 TCTTATGTTTTAAAGAAGTTTGG + Intergenic
967596836 3:191335454-191335476 TTTTATATTTAGAAGGACTTTGG + Intronic
967729977 3:192898379-192898401 TCTCATATTTAGAAAAGGTTGGG + Intronic
968798853 4:2728723-2728745 GTTTATATTTAGAATATGATAGG + Intronic
969343530 4:6557346-6557368 TCTTATAGTCAGGAGATGCTGGG + Intronic
970528149 4:16953872-16953894 TCTTATAATTAAAAGATATTTGG + Intergenic
970558790 4:17262050-17262072 TTTTATTTTTAGTAGATGTGGGG + Intergenic
971079901 4:23197708-23197730 TCTTATATTAACTAGCTGTTTGG + Intergenic
971414467 4:26411622-26411644 TCTTATATTTATTACATGATTGG + Intronic
971977176 4:33705456-33705478 TCTTATATATACAATATCTTTGG + Intergenic
972592917 4:40505016-40505038 TTTTATCTTTAAAAGATGCTGGG + Intronic
972827006 4:42770288-42770310 TGTTATATTCTGCAGATGTTGGG - Intergenic
973978214 4:56284151-56284173 TCTTATCCTTTGAAAATGTTTGG + Intronic
974137820 4:57841152-57841174 TCCTATTTTTTGAAAATGTTAGG + Intergenic
974392547 4:61290785-61290807 TCTTTTATTTACAATGTGTTAGG + Intronic
974579600 4:63778846-63778868 TTTTATTTTTATAAAATGTTTGG + Intergenic
976611632 4:87036472-87036494 TTTTATTTTTAAAATATGTTTGG + Intronic
977027751 4:91842026-91842048 TCTAATATTTAGAATCTGTAAGG + Intergenic
977533127 4:98223898-98223920 TCCTTTGTTTAGCAGATGTTTGG + Intergenic
978430809 4:108631212-108631234 CCTTTAATTTAGAAAATGTTAGG - Intergenic
978790688 4:112660479-112660501 TCATACATTTAGATGATCTTTGG + Intergenic
979746801 4:124225079-124225101 TCTTATACTTAGTAGCTATTTGG - Intergenic
979938548 4:126729346-126729368 TCTTATAATTAGTAGATAATTGG + Intergenic
980248018 4:130272585-130272607 TTTTATTTTTAAAAAATGTTGGG + Intergenic
980609686 4:135142502-135142524 TCTTTTATTTACAAAATGTTTGG + Intergenic
980785673 4:137550974-137550996 TCTTTTATTTACCAGATATTTGG - Intergenic
980862118 4:138511910-138511932 TTATATAATTAGAAAATGTTGGG - Intergenic
981656523 4:147118011-147118033 TCTGATATTTGGAGGATGATAGG + Intergenic
981664513 4:147207953-147207975 TCTTTTGTTTACAAAATGTTTGG + Intergenic
982631861 4:157840269-157840291 TCTTTTATTTATAAGCTGTGTGG + Intergenic
983305517 4:165980161-165980183 ATTTATATTGAGAATATGTTGGG + Intronic
983400406 4:167257314-167257336 TCTTATATTTTGGAAATGTATGG + Intergenic
983482174 4:168288891-168288913 TCTTTTATTTTGAAAATATTAGG + Intronic
983730956 4:170992565-170992587 TTTTATACTTGGAAGATGTTTGG + Intergenic
984039371 4:174711384-174711406 TATTATATTTAGAAGTTATATGG + Intronic
986252170 5:6070642-6070664 CCTGGGATTTAGAAGATGTTAGG + Intergenic
986340821 5:6787920-6787942 TTTTATATTTTGAGCATGTTTGG + Intergenic
987767395 5:22250646-22250668 TTTTATTTTTCAAAGATGTTAGG - Intronic
987956890 5:24751710-24751732 TTGTATATTTAGAAAATGTTGGG - Intergenic
988706384 5:33729939-33729961 TACTATATTTGGAAAATGTTGGG - Intronic
989081604 5:37628603-37628625 TCTTATAGGCAGAATATGTTTGG + Intronic
990497658 5:56364783-56364805 TCTTTTATTTAATAGATATTGGG - Intergenic
991385018 5:66077568-66077590 TTTTATTTTTAGAAAGTGTTGGG - Intronic
992999064 5:82362157-82362179 CCATATATTTAGAATATGTCAGG - Intronic
993433140 5:87856907-87856929 TCTTGTATGTAGAAAATCTTTGG + Intergenic
993825357 5:92678220-92678242 TCTTATTTATAGAAGATTTTGGG + Intergenic
994082605 5:95724403-95724425 AATTATATTTGGAAAATGTTTGG + Intronic
995501049 5:112807217-112807239 TCTGATATACAGAAGATATTTGG - Intronic
996261564 5:121477199-121477221 TGTTATATTTGGAAAATGTAAGG - Intergenic
996369272 5:122735921-122735943 GCTTATATTAAGAAATTGTTAGG + Intergenic
998562793 5:143187005-143187027 TGTTATAATTAGAATATGCTTGG - Intronic
998655041 5:144169549-144169571 TTCTGTATTTAGAAGATGATGGG - Intronic
1000915194 5:167073144-167073166 TCCTACATTTTGAAGATGTATGG + Intergenic
1001357437 5:171042570-171042592 ACTTATATTTTGAGGATGATTGG + Intronic
1002057411 5:176606434-176606456 TCTAATGTTTAGAAGTTGATCGG - Intronic
1002425787 5:179174705-179174727 TCTTCACTTTACAAGATGTTTGG + Intronic
1002837213 6:875020-875042 TGTTATTTTTAGAAGATGGAGGG + Intergenic
1003135736 6:3433538-3433560 TCTAATATTTAAAAGTTGATTGG - Intronic
1003697826 6:8429276-8429298 TCTTATATTTACATTATATTTGG - Intronic
1003933142 6:10947115-10947137 TTTTATTTCTAGAAGTTGTTTGG + Intronic
1004972547 6:20927625-20927647 TCTGGAATTTAAAAGATGTTTGG + Intronic
1006661650 6:35651142-35651164 GCTTATATATAGAAGAAGTTTGG + Intronic
1008702485 6:54117643-54117665 TCTTATATATAAAAAATTTTAGG + Intronic
1008716358 6:54294849-54294871 CTTCATTTTTAGAAGATGTTAGG + Intergenic
1008903542 6:56650666-56650688 CCTTTTATTTATAAGATGATCGG + Intronic
1010746779 6:79571985-79572007 TATTAAAATTAGAAGAGGTTGGG - Intergenic
1011437690 6:87356125-87356147 ACTTTTATTTATATGATGTTAGG - Intronic
1012254435 6:97016018-97016040 TCCTAGATTTAGAGGATGTATGG + Intronic
1012354754 6:98300030-98300052 GCTTATACTTAGAACATTTTGGG + Intergenic
1012645540 6:101674772-101674794 TGTTATGTGTAGAAGCTGTTAGG + Intronic
1012706480 6:102538346-102538368 TCTTAGATGAGGAAGATGTTAGG + Intergenic
1013273939 6:108566278-108566300 ACTTATTTTTAGGAGATTTTAGG + Intronic
1014154024 6:118091115-118091137 TCTTAGATGAAGAACATGTTTGG + Intronic
1014648893 6:124010810-124010832 TCTTATTTTTAGAAACTGTGTGG + Intronic
1014820189 6:125980756-125980778 TATTATACTTAAAAGATATTTGG - Intergenic
1015740392 6:136447883-136447905 TTTTAAATTTTGAAGCTGTTTGG - Intronic
1016045237 6:139474105-139474127 TTTTATTTTTTGAAGTTGTTAGG + Intergenic
1017173920 6:151483999-151484021 TCTGAAATTTGGAAGATCTTTGG - Intergenic
1021329966 7:19324264-19324286 TCTTATGCTTAGAACATGATTGG + Intergenic
1023327277 7:39073984-39074006 TCTTAAAATCATAAGATGTTAGG + Intronic
1025321400 7:58097873-58097895 TTTTACATTTTGAAGATGATAGG + Intergenic
1026148689 7:67770298-67770320 TCTATAATTTAGAAGATGCTTGG - Intergenic
1027643306 7:80765452-80765474 TCTTATATTTTGCACATATTGGG + Intronic
1028136448 7:87227937-87227959 TTTTATATTGATAAGATGTTAGG - Intergenic
1029336118 7:99900977-99900999 TATTATATTCAGAAAATCTTTGG + Intronic
1029957689 7:104656757-104656779 TCTTATAATCAGGAGATATTTGG - Intronic
1030757230 7:113301765-113301787 TCTTATATATACAAGGTATTTGG + Intergenic
1031168962 7:118267632-118267654 TCATAAATTTAGAAGAACTTAGG - Intergenic
1031354276 7:120770796-120770818 TCTTGTATGTAGAATAAGTTGGG - Intergenic
1031550321 7:123103507-123103529 TTTTGTATGTATAAGATGTTGGG - Intergenic
1031817446 7:126455431-126455453 TCTATTATTTAGAAGAAATTTGG - Intronic
1033967214 7:146990701-146990723 TGTTATTTTTAGAAGTTGTTTGG + Intronic
1037386557 8:18348932-18348954 TCTTCACTTTAGAACATGTTAGG + Intergenic
1038558854 8:28551229-28551251 TATTTTATTTAAAAGATTTTGGG + Intronic
1041321238 8:56615091-56615113 TCATAAATTTAGAAAATGTTAGG - Intergenic
1043124862 8:76379280-76379302 TCTAATTTTTAGAAGGTATTAGG + Intergenic
1043798171 8:84572177-84572199 TCTTGTATGCAGCAGATGTTTGG + Intronic
1043949834 8:86296365-86296387 TCTTATATACAGCAGATTTTTGG + Intronic
1045691473 8:104764106-104764128 ACTTATATTTAGGACTTGTTTGG - Intronic
1046001849 8:108431061-108431083 TTTTATTTTTAAAACATGTTTGG - Intronic
1046883598 8:119338369-119338391 GCTTATAATTGGAAGAGGTTAGG - Intergenic
1047745537 8:127842095-127842117 TCTTATTTTTAAAAGTTGTATGG + Intergenic
1048141518 8:131799456-131799478 TCTAATATTCAGCAAATGTTTGG + Intergenic
1048240381 8:132735590-132735612 TGTTATATTTAGAGGATATTTGG + Intronic
1048644658 8:136406452-136406474 ACAAATATTTGGAAGATGTTTGG + Intergenic
1049903985 9:198587-198609 TCTGACATTTGGAAGCTGTTTGG + Intergenic
1050723428 9:8618247-8618269 TCCTATATTTGTAAGATATTTGG + Intronic
1052003208 9:23313542-23313564 TCTGTTATGTAGAAGATATTGGG - Intergenic
1052960186 9:34289080-34289102 TCTTTTATTTCGCAGTTGTTTGG + Intronic
1053693853 9:40616939-40616961 TCTTATAGTCAGGAGATTTTTGG - Intergenic
1054158805 9:61659399-61659421 TCTTATTTTTATAAGAGGTCCGG + Intergenic
1054270985 9:63023197-63023219 TCTTATAGTCAGGAGATTTTTGG + Intergenic
1054305098 9:63416163-63416185 TCTTATAGTCAGGAGATTTTTGG - Intergenic
1054403843 9:64740143-64740165 TCTTATAGTCAGGAGATTTTTGG - Intergenic
1054437463 9:65225653-65225675 TCTTATAGTCAGGAGATTTTTGG - Intergenic
1054478579 9:65590404-65590426 TCTTATTTTTATAAGAGGTCCGG + Intergenic
1054480290 9:65656471-65656493 TCTGACATTTGGAAGCTGTTTGG - Intergenic
1054492940 9:65796328-65796350 TCTTATAGTCAGGAGATTTTTGG + Intergenic
1054681350 9:68222393-68222415 TCTGACATTTGGAAGCTGTTTGG - Intergenic
1054834541 9:69662594-69662616 TCTTATATTTTCAAGTTATTTGG + Intronic
1054921636 9:70549093-70549115 TCATTTATTCAGAAGGTGTTGGG + Intronic
1055192879 9:73547689-73547711 TCTTATATTTTCTAGATGCTAGG + Intergenic
1055201634 9:73670080-73670102 TATTTTATTCAGAAAATGTTTGG + Intergenic
1055906970 9:81306362-81306384 GCTTAAATTTAAAAGAGGTTGGG + Intergenic
1058159655 9:101554686-101554708 TCTTATAGTTGGAAGATCTAAGG + Exonic
1058344159 9:103939828-103939850 TTTTATATTTAGGATCTGTTGGG - Intergenic
1058552462 9:106129436-106129458 TCTCATATTTAGATCAGGTTTGG + Intergenic
1060058305 9:120435140-120435162 TCTTGAATTTAAAAGTTGTTTGG - Intronic
1060366109 9:123015901-123015923 TCTTTTATGTTGAAGAGGTTAGG + Intronic
1062166071 9:135107918-135107940 TCTTATATTTAAAACATGGGCGG + Intronic
1062330275 9:136039138-136039160 TCTTATATTTAGTATTTGTGTGG - Intronic
1202783126 9_KI270718v1_random:19668-19690 TCTGACATTTGGAAGCTGTTTGG + Intergenic
1188148855 X:26647900-26647922 TTTTAGATCTAGAAGATTTTGGG + Intergenic
1189446078 X:41083391-41083413 TTTTATATATAGAAAATCTTGGG - Intergenic
1193310643 X:80005461-80005483 TTTTAGATTTACAAGAAGTTGGG - Intergenic
1193706516 X:84826314-84826336 TCTTATATGTAGAAAATCTTTGG - Intergenic
1193872561 X:86818965-86818987 TCTTATATATATAAGATTTCTGG - Intronic
1193942776 X:87696778-87696800 TTTCTAATTTAGAAGATGTTAGG - Intergenic
1195573949 X:106428883-106428905 TCTTATAATGAGAAAATTTTTGG - Intergenic
1195623695 X:106985466-106985488 TCTTATATTTAAAAGATCAAAGG + Intronic
1195879608 X:109578764-109578786 TCTCATATTTAGAGGATGATGGG + Intergenic
1195962463 X:110400329-110400351 CCTTATATTTAGAATAGTTTTGG - Intronic
1196013420 X:110912534-110912556 TCTTACATGCAGAATATGTTAGG + Intergenic
1196636518 X:118009018-118009040 TCTTATATTTTGGTGTTGTTAGG - Intronic
1197144243 X:123153930-123153952 TTTTATATTTAGTAGATATGGGG + Intergenic
1199408404 X:147490521-147490543 TATCAAATTTAGAAAATGTTTGG + Intergenic
1199464489 X:148120703-148120725 TCTAATATTTAAAAAATGTATGG + Intergenic
1199522963 X:148757974-148757996 TCATATATTTAGATGAAGTCAGG + Intronic
1200743858 Y:6884846-6884868 TCTAATATTTAGAATCTGTAAGG + Intergenic
1201454721 Y:14157570-14157592 TTTTATATTTAAAAAATTTTTGG + Intergenic
1201682121 Y:16657943-16657965 TCTTCTCTTTGGAAGAGGTTTGG - Intergenic
1202015734 Y:20404716-20404738 TATTTTATTTTGAAGATTTTGGG - Intergenic
1202330248 Y:23743496-23743518 TTTTATATTTAGAAGAGATGGGG - Intergenic
1202540522 Y:25926566-25926588 TTTTATATTTAGAAGAGATGGGG + Intergenic