ID: 1102327615

View in Genome Browser
Species Human (GRCh38)
Location 12:112001462-112001484
Sequence GCCAAATGGTCCAGGTGTAG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 381
Summary {0: 1, 1: 0, 2: 1, 3: 27, 4: 352}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1102327615_1102327618 -2 Left 1102327615 12:112001462-112001484 CCACTACACCTGGACCATTTGGC 0: 1
1: 0
2: 1
3: 27
4: 352
Right 1102327618 12:112001483-112001505 GCATTGTTTGAAGAAATTTTTGG 0: 1
1: 0
2: 8
3: 149
4: 937
1102327615_1102327619 21 Left 1102327615 12:112001462-112001484 CCACTACACCTGGACCATTTGGC 0: 1
1: 0
2: 1
3: 27
4: 352
Right 1102327619 12:112001506-112001528 TTGTCACAACTAAAGAACAGAGG 0: 1
1: 0
2: 0
3: 21
4: 178
1102327615_1102327620 22 Left 1102327615 12:112001462-112001484 CCACTACACCTGGACCATTTGGC 0: 1
1: 0
2: 1
3: 27
4: 352
Right 1102327620 12:112001507-112001529 TGTCACAACTAAAGAACAGAGGG 0: 1
1: 0
2: 2
3: 16
4: 261

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1102327615 Original CRISPR GCCAAATGGTCCAGGTGTAG TGG (reversed) Intronic
901138600 1:7013498-7013520 GACAAAGGGGCCAGGTGTGGTGG - Intronic
901666222 1:10827820-10827842 GACAAACGATCCAGGTGCAGGGG + Intergenic
901724271 1:11228474-11228496 GCTAAAAGGGCCAGGTGCAGTGG - Intronic
901920705 1:12534798-12534820 CCCAAATGGGCCAGGTGTGGTGG - Intergenic
902335555 1:15752365-15752387 GGCATATGGGCCAGGTGTAGTGG + Intergenic
902388027 1:16087165-16087187 ACAAAATGGTCCAGGTACAGTGG + Intergenic
903964794 1:27080550-27080572 GCAAAATGGGCCAGATGCAGTGG - Intergenic
904568008 1:31439591-31439613 AGCAAATGGGCCAGGTGCAGTGG + Intergenic
904797239 1:33065806-33065828 GCCAAAAGGTCCAAGTCTAAAGG - Intronic
905194602 1:36265864-36265886 GTGAAATGGTCCAGATGTGGTGG + Intronic
905810223 1:40907426-40907448 CCCAAAAGGGCCAGGTGTGGTGG + Intergenic
906634022 1:47396270-47396292 AGCAAATGGGCCAGGTGCAGTGG - Intergenic
907162744 1:52383334-52383356 CAAAAATGGTCCAGGTGTGGTGG - Intronic
908554246 1:65241206-65241228 GCAAAATGGGCCAGGTGCAGTGG - Intergenic
908843070 1:68297879-68297901 ACAAAATGAGCCAGGTGTAGTGG - Intergenic
910921824 1:92356720-92356742 GGAAAATGGGCCAGGTGTGGTGG - Intronic
910974053 1:92887128-92887150 TGCAATTGGGCCAGGTGTAGTGG + Intronic
911047809 1:93642938-93642960 CCCATATGGGCCAGGTGTGGTGG + Intronic
911406795 1:97451336-97451358 GCCAAATGCTACAGTTGCAGAGG + Intronic
914418526 1:147506901-147506923 GACAAATGGGCCAGGTGAAGTGG - Intergenic
915605888 1:156950347-156950369 GCAAAATAGGCCAGGTGCAGTGG + Intronic
916505536 1:165425115-165425137 GACATATGGTCCAGGAATAGCGG + Intronic
917131640 1:171749268-171749290 AAAAAATGGTCCAGGTGTGGTGG + Intergenic
919619822 1:199852085-199852107 GTCATATGGGCCAGGTGCAGTGG + Intergenic
920527260 1:206676366-206676388 GCAAAATGGTGCAGCTGTTGTGG - Intronic
921782436 1:219181641-219181663 ACCAAATGGTCCAGATCAAGAGG - Intronic
922283311 1:224145911-224145933 ACAAAATTGTCCAGGTGTGGTGG + Intronic
923016973 1:230134392-230134414 ACCAAATAGGCCAGGTGCAGTGG - Intronic
923127967 1:231048583-231048605 GCCACATAGGCCAGGTGCAGTGG + Intergenic
923596060 1:235361540-235361562 GGGAAATGCTCCAGGTGGAGGGG - Intergenic
923655640 1:235913801-235913823 GCAAATTGGGCCAGGTGTGGTGG + Intergenic
1062942486 10:1434682-1434704 TCTAAATGGTCCAGGTGCCGGGG - Intronic
1063104330 10:2979820-2979842 ACCAAATGGTCCAGGTTCCGGGG + Intergenic
1063923487 10:10954531-10954553 GCCAAATTGGCCAGGTGCGGTGG - Intergenic
1063999930 10:11655108-11655130 GCACAAGGGGCCAGGTGTAGTGG + Intergenic
1064190387 10:13200855-13200877 ACCAAATGGGCCAGGTGCGGTGG + Intronic
1064365581 10:14704734-14704756 GGCAAAAGGGCCAGGTGTGGTGG + Intronic
1064706460 10:18077508-18077530 CCCAAGTGGGCCAGGTGTGGTGG + Intergenic
1065127393 10:22586816-22586838 GCTAAATGGGCCAGGCGCAGTGG - Intronic
1065692911 10:28353791-28353813 GAGAAATGGGCCAGGTGCAGTGG - Intergenic
1069391455 10:67940211-67940233 GACAAATGGGCCAGGTGCGGTGG - Intronic
1069411802 10:68161873-68161895 TCCAAATGGGCCGGGTGCAGTGG + Intronic
1070249982 10:74765245-74765267 GACAAATAGGCCAGGTGTGGTGG + Intergenic
1070946729 10:80398234-80398256 GCCAAATACGCCAGGTGCAGTGG + Intergenic
1071588355 10:86847140-86847162 CCCAAATGGGCCAGGCGCAGGGG - Intronic
1072136511 10:92551846-92551868 TCAAAATGGGCCAGGTGCAGTGG + Intronic
1072506083 10:96068879-96068901 GAAAAATGGGCCAGGTGTGGTGG + Intergenic
1073182534 10:101593539-101593561 AGCAAATGCTCCAGGGGTAGAGG + Intronic
1074761210 10:116668810-116668832 GCCAGATGTTCCAGGGGTAATGG - Intronic
1077320914 11:1941601-1941623 GACAAGTGAGCCAGGTGTAGCGG - Intergenic
1077765785 11:5158562-5158584 AACAAATGGGCCAGGTGCAGTGG - Intronic
1078240023 11:9522779-9522801 CCCAAATAGGCCAGGTGTGGTGG - Intronic
1078282677 11:9918656-9918678 GGCAAAGGGGCCAGGCGTAGTGG - Intronic
1079307138 11:19333395-19333417 ACCAAATAGTCCGGGTGCAGTGG - Intergenic
1079486456 11:20940534-20940556 GCCCAAGGGGCCAGGTGCAGTGG - Intronic
1080953336 11:37063085-37063107 GCAAAATGGTTCAGGTGCAAGGG + Intergenic
1081202156 11:40229558-40229580 GCCATAAGGGCCAGGTGTGGTGG - Intronic
1081878147 11:46424847-46424869 AACAAATAGGCCAGGTGTAGTGG + Intronic
1082012351 11:47458687-47458709 GCCAAAGGGGCCGGGTGTGGTGG - Intergenic
1082727548 11:56754346-56754368 GCAGAATGGGCCAGGTGTGGTGG - Intergenic
1083077660 11:60057689-60057711 GAGAAATGGTCCGGGTGCAGTGG - Intronic
1083536308 11:63469797-63469819 GGCAAATTGGCCAGGTGCAGTGG + Intronic
1083827850 11:65213302-65213324 CCCAAATAGGCCAGGTGCAGTGG - Intergenic
1084610248 11:70197654-70197676 CCAAAATGGGCCAGGTGCAGTGG + Intergenic
1089033374 11:115357481-115357503 GCCAAAGGGTCCAAGCGCAGAGG + Intronic
1089709777 11:120306575-120306597 GCCAAATGTCCCAGGGGGAGTGG + Intronic
1091432290 12:446668-446690 GGCAAGGGGGCCAGGTGTAGTGG + Intergenic
1094330721 12:29290156-29290178 ACCATATGGGCCAGGTGTGGTGG + Intronic
1094584885 12:31768710-31768732 GCAAAATGGGCCGGGTGTGGTGG + Intergenic
1094606331 12:31952373-31952395 ACAAAATTGGCCAGGTGTAGTGG + Intergenic
1095737535 12:45574381-45574403 GCTAAGTTGTCCAGGTGCAGTGG + Intergenic
1096585203 12:52615476-52615498 GCCAAATAGTCCTGGTGTGTTGG - Intronic
1096710357 12:53451288-53451310 TTCAAATGGGCCAGGGGTAGTGG - Intergenic
1098224150 12:68304121-68304143 TAAAAATGGTCCAGGTGCAGTGG + Intronic
1098264820 12:68707312-68707334 AAAAAATGGTCCAGGTGTGGAGG + Intronic
1098403221 12:70095760-70095782 GTCAAGTGGTCCAGGTAGAGGGG + Intergenic
1099237830 12:80103109-80103131 GCAAAGTGGTCCAGGTTTACAGG - Intergenic
1100343499 12:93704106-93704128 TCCAAATAGGCCAGGTGTGGTGG - Intronic
1100797293 12:98196076-98196098 GCAAAACGGACCAGGTGCAGTGG - Intergenic
1101061505 12:100977396-100977418 ACCTAAGGGTCCAGGTGTGGTGG + Intronic
1101230175 12:102732719-102732741 CCCAAATGGGCCAGGTGCTGTGG + Intergenic
1101875562 12:108594652-108594674 GCAAAATTGGCCAGGTGTGGTGG + Intronic
1102246187 12:111357682-111357704 AACAAATAGTCCAGGTGCAGTGG - Intergenic
1102327615 12:112001462-112001484 GCCAAATGGTCCAGGTGTAGTGG - Intronic
1102822773 12:115922429-115922451 GCCAAATAGTAAAGGTTTAGGGG + Intergenic
1102959325 12:117081934-117081956 GGGAAATGGGCCAGGTGTGGTGG + Intronic
1103048144 12:117755785-117755807 GCCAAATGGTCAAGTTGTGAAGG + Intronic
1103071462 12:117946875-117946897 GATAAATGGGCCAGGTGCAGTGG + Intronic
1103217995 12:119218165-119218187 GTCTAAAGGGCCAGGTGTAGTGG - Intronic
1105498955 13:20954682-20954704 GAAAAATGGGCCAGGTGTGGTGG + Intergenic
1105708392 13:22982702-22982724 GGCAGATGGTCAAGGTGCAGAGG + Intergenic
1107302312 13:38978439-38978461 GCAAAATGGGCCAGGTGCAGTGG - Intronic
1107918313 13:45175908-45175930 GGCAAATGGGCCAGGTGCAGTGG - Intronic
1108963403 13:56265700-56265722 GACAAATAGGCCAGGTGTGGTGG + Intergenic
1110512086 13:76362627-76362649 GACAAATGGGCCAGGTGCAGTGG + Intergenic
1112009013 13:95278406-95278428 GCCAACTGGTACAGGTGAAAAGG + Intronic
1112498189 13:99922091-99922113 GCCAAACAGGCCAGGTGCAGTGG - Intergenic
1115238443 14:31231290-31231312 ATAAAATGGTCCAGGTGCAGTGG + Intergenic
1115340136 14:32284924-32284946 ACAAAGTGGGCCAGGTGTAGTGG - Intergenic
1115348887 14:32371807-32371829 GTCAAAGATTCCAGGTGTAGTGG + Intronic
1115498595 14:34029890-34029912 GCCAAATGTTCCAGGGGGTGAGG + Intronic
1115847875 14:37557001-37557023 TTAAAATTGTCCAGGTGTAGTGG - Intergenic
1116630357 14:47323336-47323358 GACAAACAGTCCAGGTGCAGTGG + Intronic
1118935936 14:70288367-70288389 GGCAAATGGGCCAGGCGTTGTGG + Intergenic
1119173506 14:72552412-72552434 GGCAAATGGTGCACGTGTTGTGG + Intronic
1119235134 14:73013318-73013340 GCAAAATGGGCCAGGTGCAGTGG + Intronic
1119406512 14:74402669-74402691 GCCAAATGGGCCCTGTGTGGGGG - Intergenic
1119447677 14:74679887-74679909 GGCAAAAGGGCCAGGTGTGGTGG + Intronic
1119591351 14:75891004-75891026 GAAAAATGGGCCAGGTGCAGCGG - Intronic
1120191602 14:81445091-81445113 GCAAAAGGGGCCAGGTGTGGTGG + Intergenic
1121139562 14:91529236-91529258 ATCAAATGGTCCAGGTGCGGTGG - Intergenic
1121290399 14:92769797-92769819 GAGGAATGGTCCAGGTGCAGTGG - Intergenic
1122330077 14:100905879-100905901 TCGAAATAGTCCAGGGGTAGGGG - Intergenic
1122533343 14:102444684-102444706 CCAGAATGGTCCAGGTGTGGTGG + Intronic
1122662198 14:103303906-103303928 GAAAAATTGTCCAGGTGTGGTGG + Intergenic
1122748371 14:103914510-103914532 CCCAATTGGGCCAGGTGTTGTGG + Intronic
1122987934 14:105221187-105221209 GCCAAATGGGCAAGGTGAGGGGG + Intronic
1123812325 15:23940368-23940390 GCAAAATTAGCCAGGTGTAGTGG - Intergenic
1124272100 15:28291938-28291960 GGCAAAAGGGCCAGGTGCAGTGG + Intronic
1124902002 15:33832716-33832738 GCCAAAGGGGCCAGGTGCAGTGG + Intronic
1125364563 15:38900261-38900283 TCCAAATAGGCCAGGTGCAGTGG - Intergenic
1126487930 15:49203336-49203358 GGCAAATGGTCTCGGTGTGGTGG - Intronic
1126702117 15:51377860-51377882 GCCAGATTGGCCAGGTGTGGTGG + Intronic
1126807859 15:52370823-52370845 CCCAAGTTGGCCAGGTGTAGTGG + Intronic
1127229137 15:56969688-56969710 TCCAAATGGGCGAGGTGCAGTGG - Intronic
1127580055 15:60329937-60329959 CCAAAATTGTCCAGGTGTGGTGG + Intergenic
1128183948 15:65628244-65628266 GCTAAAGGGGCCAGGTGTGGTGG - Intronic
1128461412 15:67870608-67870630 CCCAAATTAGCCAGGTGTAGTGG + Intergenic
1132238732 15:100241109-100241131 GCCAGATAGGCCAGGTGTAGGGG - Intronic
1133122871 16:3621931-3621953 GCCAAATTGGCCAGGCGTGGTGG + Intronic
1133328259 16:4955648-4955670 GGCAACTGGGCCAGGTGTGGTGG + Intronic
1133330453 16:4970097-4970119 ACCAGATGGGCCAGGTGCAGTGG - Intronic
1133652484 16:7825709-7825731 TCTAAATGGGCCAGCTGTAGTGG - Intergenic
1134203844 16:12221325-12221347 ACCAGATGGACCAGGTGTGGTGG + Intronic
1134786178 16:16945827-16945849 GCAAAATAGGCCAGGTGTTGTGG - Intergenic
1135070804 16:19349901-19349923 ACCAAATGGGCCAGGCGTGGTGG + Intergenic
1135570120 16:23542825-23542847 CTCCAATGGTCCAGGTGCAGTGG + Intronic
1135793605 16:25421186-25421208 GAAAAATGGGCCAGGTGTGGTGG - Intergenic
1138501718 16:57449493-57449515 ACTAAGTGGTCCAGGTGTGGTGG + Intronic
1139220245 16:65174542-65174564 TCCAAATGGGCCAGGTGCGGTGG - Intergenic
1139773529 16:69298230-69298252 GGCAAATGCCCCAGGTGTGGTGG - Intronic
1139971196 16:70776395-70776417 AACAAATGGGCCAGGTGCAGTGG - Intronic
1140088699 16:71819217-71819239 GAAAAATGGGCCAGGTGTGGTGG + Intergenic
1140424504 16:74849545-74849567 GCAAAATGGGCCAGGCGTGGTGG - Intergenic
1141856626 16:86685813-86685835 AACCAATGGGCCAGGTGTAGTGG + Intergenic
1143062166 17:4211114-4211136 GCCAAATCAGCCAGGTGTGGTGG + Intronic
1143743591 17:8973103-8973125 GCCTAAGGGGCCAGGTGTGGTGG + Intergenic
1144491997 17:15721108-15721130 GCAAAATGGGCCAGGTGCGGTGG + Intergenic
1144908480 17:18658086-18658108 GCAAAATGGGCCAGGTGCGGTGG - Intronic
1145745072 17:27311933-27311955 GAAAAATGGGCCAGGTGTGGTGG - Intronic
1146289988 17:31599963-31599985 GCAAAATGGGCCGGGTGTGGTGG - Intergenic
1148613184 17:48978792-48978814 GACTAATGGACCAGGTGTGGTGG + Intergenic
1149823929 17:59809282-59809304 GTTGAATGGGCCAGGTGTAGTGG - Intronic
1150126215 17:62636892-62636914 GTCCATTGGTCCAGGTGCAGTGG - Intronic
1150724279 17:67638819-67638841 CCAAAATGGGCCAGGTGCAGTGG + Intronic
1151204193 17:72493405-72493427 GCCAAGAGGGCCAGGTGTGGAGG + Intergenic
1151606896 17:75143270-75143292 CCAAAAGGGGCCAGGTGTAGCGG + Intronic
1152494233 17:80659787-80659809 GCCAGATGGTCCGGGCGCAGTGG - Intronic
1153501556 18:5755135-5755157 GCCATATGGGCCAGGTGTGGTGG - Intergenic
1154984800 18:21539562-21539584 GCGAAATGGGCCAGGCGCAGTGG + Intronic
1155167367 18:23242123-23242145 ACAAAATGAGCCAGGTGTAGTGG + Intronic
1155485636 18:26338763-26338785 GAGAAATGATCCAGGCGTAGTGG - Intronic
1155486608 18:26350382-26350404 GGCAAATGAGCCAGGTGTAATGG + Intronic
1155999670 18:32371106-32371128 GCCCAATCTTCCAGGTGGAGAGG + Intronic
1156177888 18:34568901-34568923 GAGAAATGGGCCAGGTGTGGCGG - Intronic
1156231816 18:35160617-35160639 GCCAAACGGGTCAGGTGCAGTGG - Intergenic
1157196803 18:45626367-45626389 GACAACTGGTGCAGGTGTCGGGG - Intronic
1157203160 18:45676537-45676559 GCCAAATGTTCCTGGGGAAGGGG - Intronic
1160111336 18:76034549-76034571 GAAAAGTGGTCCAGGTGGAGGGG - Intergenic
1161078932 19:2300813-2300835 GCCAAATGGAACTGGAGTAGGGG + Intronic
1161130077 19:2583091-2583113 GCCAGTTAGACCAGGTGTAGTGG - Intronic
1161136596 19:2623591-2623613 ACCAAATTGGCCAGGTGTGGTGG + Intronic
1161360478 19:3846262-3846284 GAAAAATGGGCCAGGTGCAGTGG - Intronic
1162472953 19:10883278-10883300 CCCAAGTTGTCCAGGTGTGGGGG + Intronic
1162821054 19:13223876-13223898 GCCAAATGGGCCGGGTGTGGTGG + Intronic
1165611632 19:37158958-37158980 GCAGAATGGGCCAGGTGTGGTGG + Intronic
1165790915 19:38491714-38491736 GAAAAATGGGCCAGGTGCAGTGG - Intronic
1166714350 19:44957074-44957096 GCCAAATGTTCCAAGAGCAGGGG + Intronic
1167222367 19:48209011-48209033 CTCAAATGTGCCAGGTGTAGTGG + Exonic
1167558066 19:50207844-50207866 GCCAAATGATCGAGGGGCAGAGG - Intronic
1168352123 19:55682091-55682113 AGCAAGTGGGCCAGGTGTAGTGG - Intronic
1168398583 19:56069222-56069244 GCCAAATAGGCCAGGTATGGTGG + Intergenic
1168457420 19:56524105-56524127 GCGAAATGGGCTAGGTGTAGTGG - Intronic
925406444 2:3608533-3608555 GCCAAATTGGCCAGGTGCAGTGG + Intronic
925732911 2:6934971-6934993 ACCACATGGTCAAGGTGGAGTGG + Intronic
926452957 2:13028289-13028311 GCCAAATTAGCCAGGTGTGGTGG + Intergenic
927549046 2:23981179-23981201 GCCAGGTAGGCCAGGTGTAGTGG + Intronic
927815844 2:26216606-26216628 GCCAAATGGTCCAGGCTCGGTGG - Intronic
930800735 2:55440153-55440175 AGAAAATAGTCCAGGTGTAGTGG + Intergenic
931153503 2:59601256-59601278 ACCAAATAGTCCAGGTACAGTGG - Intergenic
931272004 2:60711686-60711708 GCCAAATAATCCAGGTTTACAGG + Intergenic
932264073 2:70351982-70352004 GTCAAATAGGCCAGGTGCAGTGG + Intergenic
934539701 2:95163652-95163674 GTGAAATGGGCCAGGTGCAGTGG + Intronic
935634076 2:105236765-105236787 CCCACAGGGTCCAGGTGCAGAGG + Intergenic
935876142 2:107510400-107510422 GCAAAATGGTTTAGGTGTTGTGG - Intergenic
936963778 2:118105326-118105348 GCCATATGGGCCAGGTGCGGTGG - Intronic
938902004 2:135806262-135806284 GCACATTGGTCCAGGTGTGGTGG - Intronic
939263282 2:139837552-139837574 CAAAAATTGTCCAGGTGTAGTGG + Intergenic
939831642 2:147079703-147079725 CCCAATTGGGCCAGGTGCAGTGG + Intergenic
939897577 2:147810545-147810567 GCAAAATAGTCCAGGTTTAGAGG + Intergenic
940214582 2:151291103-151291125 GGCAAATGATACAGGTGGAGGGG + Intergenic
940363423 2:152819925-152819947 GCTGAATGGGCCAGGTGCAGTGG - Intergenic
941072859 2:160974152-160974174 TCCAAATGCTCTAGGGGTAGTGG - Intergenic
943254417 2:185575726-185575748 GTTATATGGGCCAGGTGTAGTGG + Intergenic
943566562 2:189523715-189523737 GACAAACAGGCCAGGTGTAGTGG + Intergenic
944154462 2:196594966-196594988 TCAAAATGGGCCAGGTGCAGTGG + Intergenic
945008868 2:205440549-205440571 ACCAAATGGTCCAGCTCGAGGGG - Exonic
947548199 2:231027212-231027234 CCCAAACGGGCCAGGTGCAGTGG + Intergenic
948401268 2:237687315-237687337 TCCAAATAGGCCAGGTGTGGTGG + Intronic
949039297 2:241839656-241839678 ACTAATTGGTCCAGGTGCAGTGG - Intergenic
1168761376 20:352236-352258 ACCAATGGGTCAAGGTGTAGAGG + Intronic
1169049490 20:2564013-2564035 GACAAATGGGCCAGGTGTGGTGG - Intronic
1169101600 20:2954508-2954530 GGCAAAGGGGCCAGGTGTGGTGG - Intronic
1169430530 20:5532210-5532232 GCCAAACTGGCCAGGTGCAGTGG + Intergenic
1170192324 20:13656442-13656464 GCAAATTTGGCCAGGTGTAGTGG - Intergenic
1170443355 20:16400416-16400438 GCAAAATGGTGCAGCTGTTGTGG + Intronic
1170633129 20:18082212-18082234 GGCAAATGTTACAGGTTTAGAGG - Intergenic
1171128305 20:22624085-22624107 GAAAAATGGGCCAGGTGCAGTGG + Intergenic
1172726918 20:37051331-37051353 ACCAAATTATCCAGGTGTAGTGG - Intronic
1173612531 20:44380579-44380601 GACAAAGAGGCCAGGTGTAGTGG - Intronic
1174003024 20:47388618-47388640 ACCAAATTGGCCAGGTGCAGTGG + Intergenic
1174336285 20:49863425-49863447 GTCAAATAGACCAGGTGCAGTGG + Intronic
1174366948 20:50062216-50062238 GGTAACTGGTCCAGGTGCAGTGG - Intergenic
1176018921 20:62952876-62952898 ACCCAGTGGTCCAGGTGTGGCGG + Exonic
1177240299 21:18447156-18447178 TACAAATGGGCCAGGTGTAGTGG + Intronic
1177309260 21:19367278-19367300 GATAAATGGAGCAGGTGTAGAGG + Intergenic
1180613170 22:17110539-17110561 GCTGAATGGGCCAGGTGCAGTGG + Exonic
1180697137 22:17758943-17758965 GCCAGGTGGGCCAGGTGTGGTGG + Intronic
1180753410 22:18142230-18142252 GGCAAATGGGCCGGGTGTGGTGG + Intronic
1181166809 22:20988315-20988337 CCCAAATGGACCAGGCGTGGTGG + Intronic
1181471514 22:23143136-23143158 GCTAACTGGGCCAGGTGCAGTGG + Intronic
1182207936 22:28647550-28647572 GGCAAATGGGCCAGGCGTGGTGG + Intronic
1182652617 22:31864394-31864416 GCCATCTGGGCCAGGTGTGGTGG - Intronic
1183601175 22:38841417-38841439 GCCAAATGCTGCAGGTGCTGGGG + Intronic
1184583005 22:45429725-45429747 GCCAGATGGTCCAGGCAGAGCGG - Intronic
1184604956 22:45567326-45567348 GCAAAATGGGCCAGGTGCGGTGG + Intronic
949407363 3:3728573-3728595 GAGAAATGGGCCAGGTGTGGTGG - Intronic
952639532 3:35577021-35577043 GCAAAATGAGCCAGGTGTGGTGG - Intergenic
953012715 3:39042668-39042690 AGCAAAAGGTCCAGGTGCAGTGG + Intergenic
953542685 3:43836199-43836221 ACCAAATTAGCCAGGTGTAGGGG - Intergenic
953602575 3:44382268-44382290 GACATATAGGCCAGGTGTAGTGG + Intronic
954033101 3:47834389-47834411 ACCACATGGGCCAGGAGTAGTGG - Intronic
954053203 3:47999925-47999947 GCCAAAGGGGCCAGGTGCAGTGG + Intronic
954734871 3:52698526-52698548 ACAAAATGAGCCAGGTGTAGTGG + Intronic
955239738 3:57168117-57168139 GACAAATGGGCCAGGAGTGGTGG - Intronic
955368123 3:58328673-58328695 GTGAAATGGGCCAGGTGCAGTGG + Intergenic
955558933 3:60167877-60167899 GCAAAATTAGCCAGGTGTAGTGG + Intronic
956822408 3:72965774-72965796 GCCAAATGGCCCTGGGGTAGAGG + Intronic
956894696 3:73648174-73648196 ATCAAATAGGCCAGGTGTAGTGG - Intergenic
957765308 3:84617040-84617062 GCCATCTGGTCGATGTGTAGTGG - Intergenic
959220643 3:103514432-103514454 GCAACATGGGCCAGGTGTGGTGG - Intergenic
959369312 3:105503947-105503969 GCCAAATGTTGCAGGAGCAGAGG - Intronic
960489683 3:118300350-118300372 GCCACATTGGCCAGGTGTGGTGG + Intergenic
960862500 3:122166332-122166354 GCTAAAGGGGCCAGGTGCAGTGG - Intergenic
961863620 3:129937822-129937844 GACACATGGGCCAGGTGTTGAGG - Intergenic
962032580 3:131616918-131616940 GCCAAATGGTTCAGGTCCATCGG + Intronic
964508835 3:157427403-157427425 AACAAATGGGCCAGGTGCAGTGG - Intronic
966004060 3:174987036-174987058 GCCAAATGGTCAATGGGAAGTGG - Intronic
967860120 3:194144444-194144466 CCCAACTGGGCCAGGTGCAGTGG + Intergenic
968143337 3:196276781-196276803 GAAAAATTGACCAGGTGTAGTGG + Intronic
968824380 4:2883147-2883169 ACGAAATGGGCCAGGTGTGGTGG - Intronic
969082930 4:4633805-4633827 GCAAAATGGCCCAGGCGCAGTGG + Intergenic
969571217 4:8009681-8009703 GCCAAGTGGGCCAGGTGCGGTGG - Intronic
970018013 4:11534271-11534293 ACTAAATCGTCCAGGTGCAGTGG - Intergenic
970987286 4:22173215-22173237 TCAAAATAATCCAGGTGTAGGGG + Intergenic
971320030 4:25598187-25598209 TCTAAATGGGCCAGGTGCAGTGG + Intergenic
971427607 4:26531413-26531435 GACAAAAGGGCCAGGTGCAGTGG - Intergenic
972101527 4:35425849-35425871 GAAAAATTGTCCAGGTGTGGTGG + Intergenic
972959242 4:44431844-44431866 GCCAAACTGTCAAGGTGTCGTGG - Intronic
974438548 4:61887557-61887579 GCAAAACGGGCCAGGTGTGGTGG + Intronic
975663743 4:76712852-76712874 ACCAAATGGCCCAGGTGTGTAGG - Intronic
975864237 4:78709709-78709731 GAAAAATGGGCCAGGTGCAGTGG - Intergenic
976269940 4:83220535-83220557 ACCACATAGGCCAGGTGTAGTGG - Intergenic
976672060 4:87664973-87664995 ACCAAATGAGCCAGGTGTGGTGG + Intergenic
978352517 4:107834880-107834902 GCAAAATTAGCCAGGTGTAGTGG + Intronic
979781717 4:124659485-124659507 GCTCAATAGGCCAGGTGTAGTGG + Intergenic
983546642 4:168971569-168971591 CACAAATGGGCCAGGTGCAGTGG - Intronic
983959216 4:173732163-173732185 GAAAAATCATCCAGGTGTAGTGG + Intergenic
985138017 4:186808590-186808612 ACCATATGGCCCAGGTGTGGAGG - Intergenic
986179291 5:5378451-5378473 GAGAAAGGGGCCAGGTGTAGTGG + Intergenic
987371359 5:17196169-17196191 GCAACATGGGCCAGGTGCAGTGG - Intronic
989144712 5:38237080-38237102 TCAAAATTGTCCAGGTGCAGTGG - Intergenic
990422596 5:55651533-55651555 GCAAAAGGGGCCAGGTGTGGTGG - Intronic
991733455 5:69610716-69610738 GAAAAATGGGCCAGGTGTGGTGG + Intergenic
991809889 5:70465862-70465884 GAAAAATGGGCCAGGTGTGGTGG + Intergenic
991861499 5:71017134-71017156 GAAAAATGGGCCAGGTGTGGTGG - Intronic
993378148 5:87174438-87174460 TGCAAATGGGCCAGGTGTGGTGG + Intergenic
993464087 5:88223598-88223620 TCTAAATGGGCCAGGTGCAGTGG + Intronic
996205157 5:120725366-120725388 GTTAAATAGGCCAGGTGTAGTGG + Intergenic
996578084 5:124998854-124998876 ACAAAATTATCCAGGTGTAGTGG - Intergenic
996685375 5:126274043-126274065 AGAAAATGGGCCAGGTGTAGTGG - Intergenic
996686450 5:126286803-126286825 GCAAAATGGTGCAGGAGTACTGG + Intergenic
996756027 5:126935896-126935918 GCCATATAGGCCAGGTGTGGTGG - Intronic
997117500 5:131141309-131141331 GGCAAAAGGGCCAGGTGCAGTGG + Intergenic
997301172 5:132806704-132806726 CCCAAATGTCCCAGGGGTAGGGG + Intronic
1000123335 5:158219285-158219307 GCAAGATGGTAAAGGTGTAGAGG + Intergenic
1000668453 5:164028460-164028482 GTAAAATGGGCCAGGTGCAGTGG + Intergenic
1001037269 5:168306241-168306263 ACAAAATTGACCAGGTGTAGTGG + Intronic
1001058512 5:168468730-168468752 GCCAAATGTTCCAGGGGGAAGGG - Intronic
1002530192 5:179839844-179839866 GACAAATGGGCCAGGCGCAGTGG + Intronic
1003313717 6:4992048-4992070 GCCAATTAGGCCAGGTGTGGTGG + Intergenic
1003961479 6:11213211-11213233 TCCAAATGCTCCAAGTGTAATGG + Intronic
1004099322 6:12592595-12592617 CCCAAATGGTCCAGCGGTAAAGG - Intergenic
1004659902 6:17701240-17701262 GCTAAATGCGCCAGGTGCAGTGG + Intronic
1005035859 6:21554417-21554439 GCCAAAGGGGCCAGGCGTAGCGG + Intergenic
1006234031 6:32611775-32611797 GCCAGATGGGCCAGGCGTGGTGG - Intergenic
1007036976 6:38683920-38683942 GACAAATGGGCCAGGCGTGGTGG + Intronic
1007070928 6:39037705-39037727 GCCAAATGTTCCATGGGCAGAGG - Intergenic
1007555022 6:42758494-42758516 GCCAGATGGTGCAGGTGTATTGG + Intronic
1008427500 6:51376498-51376520 GCTAAATCGCCCAGGTGAAGGGG - Intergenic
1008607891 6:53158249-53158271 GGCAAATAGGCCAGGTGTGGTGG + Intergenic
1008915006 6:56777846-56777868 CCCAAATTATCCAGGTGTGGTGG - Intronic
1010843825 6:80680330-80680352 GCTAAATGATGCATGTGTAGAGG - Intergenic
1012375290 6:98554833-98554855 GACACATGGGCCAGGTGTAGTGG + Intergenic
1012884737 6:104832744-104832766 TCCATATGGGCCAGGTGCAGTGG + Intronic
1013238875 6:108224565-108224587 GCTAAGTGGGCCAGGTGTGGTGG - Intronic
1014309791 6:119785696-119785718 GGCAACTGCTCCAGGTCTAGAGG + Intergenic
1014504235 6:122232882-122232904 GCTCCATGGTGCAGGTGTAGAGG + Intergenic
1014626955 6:123738055-123738077 GACAAATGGACCAGGCGCAGTGG - Intergenic
1014826142 6:126050544-126050566 ATAAAATGGGCCAGGTGTAGTGG + Intergenic
1015679324 6:135786659-135786681 GAAAAATGGGCCAGGTGCAGTGG + Intergenic
1015829363 6:137351240-137351262 GAAAAATGGGCCAGGTGCAGTGG + Intergenic
1016951422 6:149584268-149584290 GACTAATGGGCCAGGTGCAGTGG - Intronic
1018406134 6:163484486-163484508 GCTAAATGGGACAGGTGCAGTGG - Intronic
1020169666 7:5835392-5835414 GAAAAATTATCCAGGTGTAGTGG + Intergenic
1020865558 7:13556779-13556801 GATAAATGGGCCAGGTGCAGTGG + Intergenic
1021114192 7:16730229-16730251 GCATAATGGGCCAGGTGCAGTGG + Intergenic
1023240630 7:38142913-38142935 GCAAAATGGTACAGCTGTTGTGG + Intergenic
1023885592 7:44352090-44352112 GCTAAAGGGACCAGGTGGAGTGG + Intergenic
1023996447 7:45161773-45161795 GCCAAGTGGTCCAGGTCTAGGGG + Intronic
1025072758 7:55915116-55915138 ACCAAATGGGCCAGGTGCGGCGG - Intronic
1026645435 7:72164078-72164100 GCCATATGGACCAGGTGCAGTGG + Intronic
1030073379 7:105716540-105716562 ACAAAAAGGTCCAGGTGTGGTGG + Intronic
1033322663 7:140353995-140354017 GCTAAGTGGGCCAGGTGTGGTGG - Intronic
1034018326 7:147611025-147611047 GCTAAATGGGCCAGGCGTGGTGG - Intronic
1034562824 7:151892547-151892569 ACAAAATGGGCCAGGTGTGGGGG + Intergenic
1036155668 8:6339805-6339827 GGCAATTGGGCCAGGTGTGGTGG + Intergenic
1036940825 8:13050142-13050164 GCCAAATTATCCAGGGGTGGTGG - Intergenic
1038547738 8:28438810-28438832 GCAAAATAGGCCAGGTGTGGTGG + Intronic
1039297164 8:36169186-36169208 ACAAAATTGGCCAGGTGTAGTGG - Intergenic
1039371469 8:36988185-36988207 GCAAAATAGTCCAGGTTTACAGG - Intergenic
1039558452 8:38494156-38494178 GAAAAATGGGCCAGGTGTGGTGG + Intergenic
1039995939 8:42533326-42533348 GCCTATTGGGCCAGGTGCAGTGG + Intronic
1040023646 8:42762361-42762383 GCGCCATGGTCCAGGTGTGGTGG + Intronic
1040447630 8:47511692-47511714 GGCAAATGGTCTTGGTGTACTGG + Intronic
1042008595 8:64212027-64212049 GAAAAATAGGCCAGGTGTAGTGG + Intergenic
1043794102 8:84513806-84513828 GCCAATAGGACCAGGTGCAGTGG + Intronic
1046319381 8:112552205-112552227 TCAAAATGGGCCAGGTGTAGTGG + Intronic
1047110461 8:121784029-121784051 CCCAAATAGGCCAGGTGCAGTGG + Intergenic
1047482704 8:125300104-125300126 CGAAAATTGTCCAGGTGTAGTGG - Intronic
1047759560 8:127944238-127944260 GTCAAATGGGCCAGGTGTAATGG - Intergenic
1048505342 8:135015799-135015821 GTAAAATGGGCCAGGTGTGGTGG + Intergenic
1052800744 9:32965764-32965786 GCCAAAAAGGCCAGGTGCAGTGG + Intergenic
1055128668 9:72749819-72749841 GACAAAGGGGCCAGGTGCAGTGG + Intronic
1057124494 9:92605972-92605994 GGCAAAGGGGCCAGGCGTAGTGG + Intronic
1057265772 9:93616807-93616829 GCAAAATCAGCCAGGTGTAGTGG - Intronic
1057565122 9:96160402-96160424 GCAGAAAGGTCCAGGTGTGGTGG + Intergenic
1057586651 9:96334348-96334370 GCAAAATGGGCCGGGTGTGGCGG + Intronic
1059239606 9:112792712-112792734 GGAAAATGGCCCAGGTGTAGTGG - Intronic
1059284333 9:113159885-113159907 TACAAATGGGCCAGGTGTGGTGG + Intronic
1060282575 9:122224310-122224332 GCCAGATGGGCCGGGTGTGGTGG - Intronic
1060911554 9:127355224-127355246 GCCAAATTGTCAAGGTCTGGGGG + Intronic
1061108034 9:128547393-128547415 GCAGAATGGGCCAGGTGTGGTGG + Intergenic
1061336723 9:129942978-129943000 GCCAAATGGGCCGGATGCAGTGG - Intronic
1062524359 9:136972309-136972331 ACCAACTGCTCCAGGTGTGGGGG + Intergenic
1185820353 X:3197168-3197190 GCCAAGTGGCCCAGCTGTTGAGG - Intergenic
1188420896 X:29989604-29989626 ACCATATGGGCCAGGTGCAGTGG - Intergenic
1189780139 X:44506159-44506181 GCTAAATAGGCCAGGTGCAGTGG + Intergenic
1189810816 X:44779143-44779165 ACAAAATTGGCCAGGTGTAGTGG + Intergenic
1189978759 X:46488587-46488609 GCCAAAAGGTCCGAGTGTAAAGG + Intronic
1190080068 X:47349759-47349781 GCAAAATTATCCAGGTGTGGTGG - Intergenic
1190754694 X:53391329-53391351 GAAAAATGGGCCAGGTGCAGAGG + Intronic
1192569199 X:72188811-72188833 GCCACATGCACCAGGTGTGGTGG - Intronic
1193166299 X:78284687-78284709 ACCGAAGGGGCCAGGTGTAGTGG - Intronic
1195584927 X:106553820-106553842 ACAAAATCATCCAGGTGTAGTGG + Intergenic
1195737498 X:108028701-108028723 GCCAAAAGGTCCATCTGTATAGG + Intergenic
1196413351 X:115443939-115443961 GTTAAATGGGCCAGGTGCAGTGG + Intergenic
1196677834 X:118439286-118439308 GCAAAATGGGCCAGGCGTGGTGG + Intronic
1198423221 X:136488844-136488866 GCAAATTGTTCCAGGTGTAAAGG + Intronic
1200473379 Y:3615252-3615274 GTAATATAGTCCAGGTGTAGTGG + Intergenic
1201977036 Y:19862092-19862114 GAGACATGGGCCAGGTGTAGTGG - Intergenic