ID: 1102329266

View in Genome Browser
Species Human (GRCh38)
Location 12:112014853-112014875
Sequence TGGCACTTGCAGCTCATTCA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 137
Summary {0: 1, 1: 0, 2: 0, 3: 14, 4: 122}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1102329265_1102329266 -10 Left 1102329265 12:112014840-112014862 CCTGTCGTGGATTTGGCACTTGC 0: 1
1: 0
2: 1
3: 3
4: 52
Right 1102329266 12:112014853-112014875 TGGCACTTGCAGCTCATTCAAGG 0: 1
1: 0
2: 0
3: 14
4: 122
1102329261_1102329266 7 Left 1102329261 12:112014823-112014845 CCTATTTTCAAGCGTTCCCTGTC 0: 1
1: 0
2: 2
3: 1
4: 105
Right 1102329266 12:112014853-112014875 TGGCACTTGCAGCTCATTCAAGG 0: 1
1: 0
2: 0
3: 14
4: 122
1102329264_1102329266 -9 Left 1102329264 12:112014839-112014861 CCCTGTCGTGGATTTGGCACTTG 0: 1
1: 0
2: 0
3: 4
4: 89
Right 1102329266 12:112014853-112014875 TGGCACTTGCAGCTCATTCAAGG 0: 1
1: 0
2: 0
3: 14
4: 122
1102329260_1102329266 23 Left 1102329260 12:112014807-112014829 CCAGTGGTTGAAGTCTCCTATTT 0: 1
1: 0
2: 0
3: 10
4: 114
Right 1102329266 12:112014853-112014875 TGGCACTTGCAGCTCATTCAAGG 0: 1
1: 0
2: 0
3: 14
4: 122

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1102329266 Original CRISPR TGGCACTTGCAGCTCATTCA AGG Intronic
900390797 1:2432986-2433008 GGGCACTTGAAGCTCAGCCATGG - Intronic
902824296 1:18962443-18962465 TGGCAGTGGCAGCTCATTGCTGG + Intergenic
904845439 1:33410126-33410148 TGGAAATTCCAGCTCATTCCAGG - Intronic
905242988 1:36593251-36593273 TGGCCCTTGAAACTCATTCAAGG + Intergenic
906804941 1:48771810-48771832 TGGTAATTTTAGCTCATTCAGGG - Intronic
908023202 1:59919906-59919928 TGGCACTGGCATATCATACATGG + Intronic
908159139 1:61389156-61389178 TGGCACTTGCAGTGCCATCAGGG + Intronic
909172881 1:72317534-72317556 AGGCATTTCCAGCTCACTCAGGG + Intergenic
909618237 1:77636996-77637018 AGGCTCTTGCAGCTCAATCACGG + Intronic
912944098 1:114070251-114070273 AGGCATTTCCAGCTCACTCACGG + Intergenic
913058044 1:115180010-115180032 AGGCAATTGCAGCTCCTGCAGGG - Intergenic
915405795 1:155658820-155658842 TGGCAGTGGTAGCTCATTCAGGG - Intergenic
922565377 1:226598072-226598094 AGGCCCTTGCATCTCCTTCATGG + Intronic
922932062 1:229397538-229397560 TGGTACTTGCAGCTCCTTCTTGG + Intergenic
1063515584 10:6691664-6691686 CGGCGCTGGCAGCTCATTCATGG - Intergenic
1066235786 10:33482990-33483012 GGGCACTAGAAGATCATTCAGGG - Intergenic
1068611177 10:59062044-59062066 TGGCACTAGCATCTTATTCGAGG + Intergenic
1068911852 10:62387094-62387116 TGGGACTTGCAGAACATACAAGG + Intronic
1070403805 10:76076796-76076818 TGGAAATGGCAGCTCTTTCAAGG + Intronic
1072533138 10:96338467-96338489 TGTCACTGGTGGCTCATTCAGGG + Exonic
1073096864 10:100985203-100985225 TGGCACATGAAGCCCATTCTTGG + Exonic
1073656928 10:105426315-105426337 AGGCATTTCCAGCTCACTCATGG + Intergenic
1075723486 10:124600288-124600310 TGGCACCTGCAGCTCTTCCTAGG + Intronic
1077808485 11:5613317-5613339 GGGCACTTGAAGCTCCTTCATGG + Intronic
1078599353 11:12716519-12716541 TGGCACTTGCTTCTTAGTCAGGG + Intronic
1078932653 11:15924668-15924690 ACTCACTTGCAGCCCATTCAGGG + Intergenic
1085241217 11:75058078-75058100 TGGCACTGGCAGCTGCTTCTGGG + Intergenic
1086287160 11:85263412-85263434 TGGCAGTGGCAGCTCAACCAGGG - Intronic
1089190481 11:116649831-116649853 TGGCTCCTGAAGCCCATTCATGG + Intergenic
1090924273 11:131235913-131235935 AGGCGCTTGCAGCTCCTCCATGG - Intergenic
1094031287 12:26014069-26014091 AGGCACTGGCAGCTCAGGCAGGG - Intronic
1102329266 12:112014853-112014875 TGGCACTTGCAGCTCATTCAAGG + Intronic
1105809923 13:23985942-23985964 GCGCACTTGCAGCTAATCCAGGG - Intronic
1107120389 13:36789381-36789403 TGACCCTTGCTTCTCATTCATGG + Intergenic
1109340861 13:61056373-61056395 TGGGAATTGCAGTTCATTGAGGG + Intergenic
1110691821 13:78439406-78439428 TGGCATTTGCATATTATTCAGGG - Intergenic
1113406488 13:110045640-110045662 TGGCAGTTGCATTTCATTTATGG + Intergenic
1116058636 14:39894847-39894869 AGGCATTTCCAGCTCACTCATGG - Intergenic
1117534181 14:56688310-56688332 TGGCCCTTGTTGCTCAGTCAAGG - Intronic
1118259791 14:64236126-64236148 TGGCACTTTCAGTTCAATTAAGG + Intronic
1118381964 14:65224837-65224859 TGGCAGTAGCAGCTCCTTCTTGG - Intergenic
1118500254 14:66355710-66355732 TGAGACTTGCAGTTGATTCATGG + Intergenic
1119516797 14:75254714-75254736 TGGCACTGCCACCCCATTCACGG + Intronic
1126027533 15:44462352-44462374 TGGCACTAGCAGCTGATTTCAGG + Intronic
1129961671 15:79692151-79692173 AGGCATTTCCAGCTCACTCACGG + Intergenic
1131070612 15:89463387-89463409 TGGCAGTGGCAGCCCATCCAGGG + Intergenic
1132574172 16:657074-657096 TGGCACCTGCAGCACACACAGGG - Exonic
1132869434 16:2109236-2109258 GGGCACCTGCAGCCCACTCACGG + Exonic
1135525044 16:23207754-23207776 AGGTACTTGCAGCTAATTGAGGG + Intronic
1139174296 16:64669046-64669068 TGGCACATGGTGCTCATTAATGG - Intergenic
1139828786 16:69779586-69779608 TGGAACTTGAAGCCCATACATGG - Intronic
1140565428 16:76036240-76036262 TGGCAGCGGCAGCTCATCCAGGG - Intergenic
1141834979 16:86532492-86532514 AAGCAGTTGCAGCTCTTTCAGGG + Intronic
1148835596 17:50464139-50464161 TTTCACCTACAGCTCATTCAGGG - Intronic
1152469470 17:80482836-80482858 TGGCCCCTGCAGCTCACTCTTGG - Intergenic
1152713093 17:81884687-81884709 TGGGACTTGGAGCTCTTCCAGGG - Intergenic
1157741562 18:50097785-50097807 TGGCACCTGCGGCTGCTTCATGG - Intronic
1158096057 18:53772597-53772619 TTTCACTTGGATCTCATTCAAGG - Intergenic
1159465722 18:68781450-68781472 TGGCCCTTGGAGGTCATCCATGG - Intronic
1159873751 18:73787629-73787651 TGTCTCTTGCAGCTCTTTGAAGG - Intergenic
1162894257 19:13755645-13755667 TGGCTCTTTCAGCTCATAAATGG + Intronic
1168673012 19:58255746-58255768 TGGCAGCGGCAGCTCATCCAGGG - Intronic
927681837 2:25144890-25144912 TGGGACTAGCAGCTCAGTCCTGG + Intronic
929115371 2:38439447-38439469 TGGCACTTTCAGCTGCTTCATGG + Intergenic
931386895 2:61805722-61805744 TGGCAGTTGCAGCTCCATGAGGG - Intergenic
932358813 2:71088492-71088514 TGGCACTTGCAGCAAACTCCTGG + Intergenic
939892060 2:147748013-147748035 TAGCACTTACAGCACATACAGGG - Intergenic
941421187 2:165284503-165284525 TGGCTCTACCTGCTCATTCATGG + Intronic
945036301 2:205706825-205706847 TGGCTCTTGAAGCTCATCCCCGG + Intronic
945404309 2:209425699-209425721 TGGTACCTGCAGCTCATGCATGG - Intronic
947348928 2:229222232-229222254 TGGCACTGGCATGTGATTCAGGG - Intronic
947610249 2:231520752-231520774 TGGCATTTCCAGATCATTCCTGG - Intergenic
948768978 2:240237841-240237863 TGGCACAGGCCGCTCTTTCATGG - Intergenic
1171449742 20:25226999-25227021 GGGGACTTGCAGCTCACTCGAGG - Intergenic
1174390920 20:50217830-50217852 GGGCACTTGCAGCTGAGGCAAGG - Intergenic
1175880772 20:62257494-62257516 TGGAGCTTGCAACTCATCCATGG + Intronic
1178805370 21:35834748-35834770 CGGGACTTGCAGATCCTTCAGGG - Intronic
1179451607 21:41472201-41472223 TGGCTCTTGCATCACCTTCAAGG + Intronic
1179624260 21:42639539-42639561 TGGCACTTACAGGGCATTCCAGG - Intergenic
1180091450 21:45535626-45535648 TGGCACTTCCAGTTCACTCCTGG - Intronic
1180856394 22:19048550-19048572 TGGCAGGTGCAGCTCAGGCATGG + Exonic
1180961586 22:19764750-19764772 TGCCACTTGGAGCTCATTCCTGG + Intronic
949751088 3:7353494-7353516 AGGCATCTCCAGCTCATTCATGG - Intronic
950785491 3:15430694-15430716 TGGCACATTCAGCTGATTTAGGG + Intronic
951646108 3:24892929-24892951 TGGCAATTGCTTTTCATTCAGGG + Intergenic
952299437 3:32091464-32091486 TTATACTTGCAGGTCATTCATGG + Intergenic
953690485 3:45113669-45113691 TGGCACTTGCAGCAAGTACACGG + Intronic
955960424 3:64334963-64334985 TGGCACTTGAAGGTCTTTGAAGG - Intronic
956304966 3:67813807-67813829 TGTCATTAGCAACTCATTCAGGG + Intergenic
957659673 3:83131527-83131549 AGGTACAAGCAGCTCATTCAAGG - Intergenic
960774363 3:121232097-121232119 TGCCACTGGCAGCTCCTTCAGGG + Intronic
961141509 3:124560265-124560287 TGCAACTTGCAGCCCTTTCAGGG - Intronic
961751314 3:129096422-129096444 TGCGTCTTGCAGCTCATGCATGG + Intronic
965206322 3:165721913-165721935 TGGAACTTACAGCTCTTTAACGG + Intergenic
971014547 4:22474587-22474609 TAGCATTTTCACCTCATTCATGG - Intronic
974688006 4:65256738-65256760 TGGCAGTTACAGCTCAAACAGGG - Intergenic
981125788 4:141104862-141104884 TGGCACTTCCAACTCCCTCATGG + Intronic
983234603 4:165164914-165164936 TGGCACTTGCAGCTAAGCCACGG + Intronic
986276793 5:6282101-6282123 AGGCACTTGTTTCTCATTCATGG - Intergenic
993134890 5:83947639-83947661 TGGAACTTTCAGCCTATTCATGG + Intronic
993873377 5:93277619-93277641 TGGCAATGGCAGAGCATTCAGGG - Intergenic
994747200 5:103693058-103693080 TCTCATTTACAGCTCATTCAGGG - Intergenic
994949636 5:106443570-106443592 TGGCACTTTCAGAACATTCAAGG + Intergenic
998378742 5:141708939-141708961 TTGCACTTGCTGTTCATTCTGGG + Intergenic
1002473758 5:179452576-179452598 TGGCAGCTGCAGCTCCCTCAAGG + Intergenic
1006466536 6:34197900-34197922 CGTCACCTGCAGCACATTCAAGG - Intergenic
1010795528 6:80113174-80113196 TGGCCATGGCAGCTCATCCAGGG - Intronic
1012058251 6:94443803-94443825 TGGCACTTGCAGCTGATCTTGGG + Intergenic
1012453587 6:99380197-99380219 TGGCACCCTCAGGTCATTCATGG + Exonic
1018053234 6:160029824-160029846 TGTCACATGCAGCTCACTCAGGG + Intronic
1019687940 7:2392127-2392149 TGGCACCTGAAGCTCATCCCTGG + Intergenic
1022196424 7:28071666-28071688 CGGCACTTACAGCTGATTAAAGG + Intronic
1022219490 7:28298480-28298502 TGGCTATTGCAGCTAATTCTCGG - Intergenic
1027580713 7:79991427-79991449 TGGCACTAGCATCTTCTTCAAGG - Intergenic
1031298133 7:120030801-120030823 TGGCATTTGCAGCACTTTCATGG - Intergenic
1032923696 7:136577897-136577919 AGGCATTCCCAGCTCATTCACGG + Intergenic
1033448155 7:141439798-141439820 TGGCATTTGAGGCTCCTTCATGG + Intronic
1038460691 8:27714094-27714116 TGGCACTGGCATCTCCTTCTGGG - Intergenic
1039785076 8:40827556-40827578 TGGCTCTAGTGGCTCATTCAGGG + Intronic
1040270401 8:45934385-45934407 GGGCACTTGGAGCGCTTTCAGGG + Intergenic
1045772004 8:105753147-105753169 TGGAAATTGCAGCTAATTCCAGG - Intronic
1046540025 8:115567816-115567838 TGCCTCCTGCAGCTCTTTCAGGG + Intronic
1049776195 8:144406464-144406486 TGCCACCTCCAGCTCTTTCATGG + Intronic
1049978877 9:885524-885546 AGGCACTGGCAGGTCATTGATGG - Intronic
1051849282 9:21489154-21489176 TGGCACTTGCAGCAAACTCCTGG + Intergenic
1057631859 9:96725696-96725718 TGACAGTGGAAGCTCATTCACGG + Intergenic
1058199193 9:102017730-102017752 TGGATCTTGCAGCTCTATCATGG - Intergenic
1059846969 9:118290684-118290706 AGGAATTTGCAGCTCTTTCATGG + Intergenic
1060271510 9:122145823-122145845 TGGTATTTGCAGCTCCTTTAAGG + Intronic
1061392166 9:130323268-130323290 TAGCACTTGGAGCTCCTTTAGGG - Intronic
1062666303 9:137674768-137674790 TGGCCCTTGCAGCTCATCACGGG - Intronic
1186482363 X:9905615-9905637 TGGCACTTGGAGCACATCCTTGG + Intronic
1187100878 X:16190212-16190234 TGGCACTTACAGCTAAACCATGG - Intergenic
1190525515 X:51325908-51325930 TGGTACTTACAGCTGCTTCAAGG - Intergenic
1190543965 X:51505722-51505744 TGGTACTTACAGCTGCTTCAAGG + Intergenic
1192297991 X:69870092-69870114 AGGCATTTCCAGCTCACTCATGG + Intronic
1197793894 X:130281035-130281057 TGGCAGTGGCAGTTCATCCAGGG + Intergenic