ID: 1102333922

View in Genome Browser
Species Human (GRCh38)
Location 12:112060692-112060714
Sequence CTAAAGAATTAGATGAAGTC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 256
Summary {0: 1, 1: 0, 2: 1, 3: 21, 4: 233}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1102333922 Original CRISPR CTAAAGAATTAGATGAAGTC AGG (reversed) Intronic
901189554 1:7400383-7400405 GTAAAGAATTCAATGAAATCAGG - Intronic
902365587 1:15971697-15971719 CTGGAGAATTACATGAGGTCAGG - Intronic
907040168 1:51251781-51251803 CAAAAGAATTAGCTGGAGCCGGG + Intronic
907110706 1:51923901-51923923 CTGAAGAATGAGAAGAAGTTAGG - Intronic
908660396 1:66428738-66428760 CTAAATAATTCTATGAAGCCAGG - Intergenic
908686907 1:66730882-66730904 CTAAAGGATGAGTTGGAGTCAGG - Intronic
909186383 1:72491871-72491893 CTAAAGAAGTATAATAAGTCAGG + Intergenic
909992863 1:82244529-82244551 TTAAAGAGCTAGATGAAATCTGG - Intergenic
910461037 1:87448175-87448197 ATAAAGAATTTGATTAACTCTGG - Intergenic
912886476 1:113480000-113480022 ATAGAAAATTAAATGAAGTCAGG - Intronic
914246435 1:145889302-145889324 ATAAAGAATTACATGAGGTCAGG + Intergenic
914318278 1:146534509-146534531 ATAAAGAATTTGATTAACTCTGG - Intergenic
914496082 1:148198847-148198869 ATAAAGAATTTGATTAACTCTGG + Intergenic
915391997 1:155552168-155552190 CTAAATAAATATATGAAGGCCGG + Intronic
916634490 1:166653695-166653717 AGAAAGAAGTAAATGAAGTCGGG + Intergenic
917890476 1:179432719-179432741 TTAAAGAATGAGATGTGGTCGGG - Intronic
918864710 1:189880647-189880669 CTAAATAATAAGATGAATTGAGG - Intergenic
918917025 1:190655359-190655381 CTAAAATATTAGAAGAAGACAGG + Intergenic
919579330 1:199351864-199351886 CTAAAGAATTAGATGTGTTCTGG - Intergenic
920731692 1:208492334-208492356 TTATAGTATTAGTTGAAGTCAGG + Intergenic
921200155 1:212797029-212797051 CTAAAGAATAAGTAGAGGTCGGG - Intronic
923437207 1:233978732-233978754 GTTAAGGATTAAATGAAGTCAGG + Intronic
924040889 1:239982702-239982724 CTAAAGAATTAGATGCTGTCAGG - Intergenic
1062986985 10:1778271-1778293 TTCAAGAATTATCTGAAGTCTGG - Intergenic
1066553009 10:36580444-36580466 AGAAAGAATTAGAGGAAGTGTGG + Intergenic
1070451604 10:76563992-76564014 CTAAAGAACTACATGAATTAAGG + Intergenic
1075498423 10:122949410-122949432 CTACATAATGAGATGAAGTGAGG + Intronic
1076162245 10:128254114-128254136 CTTAAGAACCAGGTGAAGTCTGG + Intergenic
1078756136 11:14212173-14212195 CAGAATAATTAGATGGAGTCCGG + Intronic
1078863895 11:15278823-15278845 CTAAAGAATAAAATGGAGTTGGG + Intergenic
1080963923 11:37192781-37192803 CTAATGAATCAGATGATGTCAGG + Intergenic
1081273984 11:41123735-41123757 TTAAAGAATTAGAGGAAATCTGG - Intronic
1081522505 11:43896705-43896727 CTAAATAATGGGAAGAAGTCAGG - Intronic
1085614276 11:77983399-77983421 TTAAAGAACTAGAAGAAGACTGG - Intronic
1086156382 11:83671306-83671328 CTTAAGAATTAGATGAATGTAGG + Intronic
1087558888 11:99758979-99759001 CAAAAGAATATGATGAAGGCTGG + Intronic
1088066050 11:105720928-105720950 TTAAAACATTAGATAAAGTCTGG - Intronic
1091381188 12:61836-61858 CTAAAGAAAAAGATCAAATCTGG + Intergenic
1091417565 12:302222-302244 CTAAAGAAATAGAACAAGGCTGG + Intronic
1093419597 12:18959573-18959595 CTATAGAATAATTTGAAGTCAGG + Intergenic
1094043746 12:26145208-26145230 CTCAAGACTTAACTGAAGTCAGG + Intronic
1094479342 12:30869398-30869420 CTAAGGACTGAGATGAAGCCAGG - Intergenic
1094546607 12:31410265-31410287 CTAAAGAAACAGATGAAATGGGG + Intronic
1096062570 12:48714201-48714223 CTAAAGAAGTAGATTAGGCCGGG - Intronic
1098690141 12:73477101-73477123 CCAAAAAAATACATGAAGTCAGG - Intergenic
1099398331 12:82169847-82169869 CTAAAGAATGAGAAGTAGTTTGG - Intergenic
1099616393 12:84941113-84941135 CTATAGTATAATATGAAGTCAGG - Intergenic
1100005487 12:89890525-89890547 CTAAGGAATTAGCAGGAGTCAGG + Intergenic
1100270139 12:93016788-93016810 CGTTAGAGTTAGATGAAGTCCGG + Intergenic
1101421200 12:104552600-104552622 GTAAAGATCTAGAGGAAGTCTGG - Intronic
1102333922 12:112060692-112060714 CTAAAGAATTAGATGAAGTCAGG - Intronic
1105523951 13:21157227-21157249 CTAAAGAATCAGATACAGTCAGG + Intronic
1105791574 13:23805445-23805467 CAAAGGAATTAGATAGAGTCTGG + Intronic
1106203324 13:27563566-27563588 CTAAAGAAATAATTGAAGTTAGG - Intronic
1107396440 13:40022943-40022965 GTAAAGAATTACATTAAGGCCGG + Intergenic
1107851945 13:44579007-44579029 ATAAATAAATAAATGAAGTCCGG - Intergenic
1109010374 13:56934028-56934050 TTGAAGAATTAGTTGAAGTAAGG - Intergenic
1110289216 13:73784929-73784951 CTAAAGAAGGAGATGAGGCCGGG - Intronic
1110534231 13:76632261-76632283 AGAAAGAATTAGATGACCTCAGG + Intergenic
1110839759 13:80128346-80128368 GGAAGGAATTAGATGAAGTAGGG + Intergenic
1111670642 13:91325309-91325331 CTAAAGAGTTAGATTAATTTGGG - Intergenic
1113298254 13:108986323-108986345 ATAAAGACTAAGATGTAGTCTGG + Intronic
1115286827 14:31723347-31723369 CTATAGAATAGTATGAAGTCAGG + Intronic
1116141195 14:40996237-40996259 CATAAAAATTAGATGAAGTGTGG - Intergenic
1116148251 14:41102482-41102504 CTAAAGAGCTAGATGCAATCAGG + Intergenic
1117497860 14:56323530-56323552 CCAAAGAATTAGATAAACTGGGG + Intergenic
1117557972 14:56906256-56906278 CTAAAGTAGAAGATGAAGTCTGG + Intergenic
1118176838 14:63448916-63448938 TTTAACAATTAAATGAAGTCTGG - Intronic
1119063542 14:71501723-71501745 TTAAAAAATTAATTGAAGTCTGG + Intronic
1119956182 14:78801024-78801046 CTAAAGAAATACATGAGGCCGGG + Intronic
1122029556 14:98902335-98902357 TTAAAGAATAAGAGGGAGTCAGG - Intergenic
1122394726 14:101415776-101415798 ATAAAGCAATAGATGAAGTTTGG + Intergenic
1122668562 14:103352291-103352313 CTAAAGATGTAGTTGAAATCTGG - Intergenic
1122911948 14:104834427-104834449 CAAAAGAATTAAATGGAGGCTGG - Intergenic
1124258043 15:28162030-28162052 ATAAAAAATTAGAAGAAGGCCGG + Intronic
1124831139 15:33150703-33150725 CTTAAGAAAGAGATTAAGTCTGG - Intronic
1126032028 15:44508389-44508411 ATAAAGAATGAGATGCAGCCAGG - Intronic
1129514310 15:76147732-76147754 CTAAAGAAATCAATTAAGTCTGG + Intronic
1131110382 15:89761088-89761110 CTTAAGAAATAGATGAAGGCCGG + Intronic
1138644753 16:58416441-58416463 CTAAATAAGTAAAAGAAGTCAGG - Intergenic
1139127420 16:64095947-64095969 CAAAAGCATTAGATGAAGCAGGG + Intergenic
1140347146 16:74224780-74224802 CTAAAGACTTAGAAGGAGTGGGG + Intergenic
1141324033 16:83038905-83038927 TTAACGAACTTGATGAAGTCAGG + Intronic
1141776224 16:86124187-86124209 CAGAAGAATTACTTGAAGTCGGG + Intergenic
1143815375 17:9508154-9508176 CTAGACAATTTGATGAAATCAGG + Intronic
1144768067 17:17743736-17743758 CTAAGGATTGAGATTAAGTCAGG - Intronic
1149402221 17:56309908-56309930 CTACAGGATGAGATGAAGTGAGG + Intronic
1149419799 17:56498877-56498899 CAAAGCAAATAGATGAAGTCTGG + Intronic
1149703090 17:58671838-58671860 CTAAAGGATTAGATGAATTGAGG - Intronic
1152998343 18:429675-429697 GTAAAGAATTACATGAGGCCAGG - Intronic
1156564199 18:38164974-38164996 CAAAAGAAATAGATGACCTCAGG - Intergenic
1157209904 18:45733243-45733265 CTAAAGAAGGAGAAGAAGACGGG + Intronic
1158808625 18:61005324-61005346 CTTGTGAATTAGAAGAAGTCTGG + Intergenic
1159881941 18:73866473-73866495 CTGAAGAACTAGCTGAAGACGGG - Intergenic
1162454131 19:10772515-10772537 TTACAGACTTTGATGAAGTCCGG + Exonic
1163670419 19:18624669-18624691 CTAACGGATTACCTGAAGTCAGG - Intergenic
1164345978 19:27257604-27257626 CTAAATAATTAAAAGAAGTAAGG + Intergenic
925070430 2:962551-962573 AAAAATAATTAGATGAAGTAAGG + Intronic
926017287 2:9465045-9465067 AAAAAGAATTAGATGAAGTATGG + Intronic
926463324 2:13161020-13161042 CTCAAAAATTAGATGCAGGCAGG - Intergenic
927582712 2:24268312-24268334 CTGAAGTAGAAGATGAAGTCAGG - Intronic
928051142 2:27996602-27996624 CTCAAGACTTTGATGAATTCTGG - Intronic
928661136 2:33502809-33502831 TTAAAGAGTTAGAGGAAGGCTGG - Intronic
929493868 2:42422612-42422634 CTAAAGAAATAGATAACTTCTGG + Intronic
929662238 2:43798597-43798619 GTACAAATTTAGATGAAGTCAGG + Intronic
930168774 2:48230326-48230348 CTAAATATTTATATAAAGTCTGG + Intergenic
930191239 2:48462530-48462552 CTAAGGAATTACGTGAAGTATGG + Intronic
931378459 2:61729758-61729780 CAAAAGAATTTTTTGAAGTCGGG - Intergenic
932225643 2:70038248-70038270 CTAAAGAAATGCATGAAGGCTGG + Intergenic
932468304 2:71938072-71938094 TTAGAGCATAAGATGAAGTCAGG - Intergenic
935390643 2:102549071-102549093 CTAAAGAATTAAATAAAGTATGG + Intergenic
936827212 2:116597068-116597090 TGAAACACTTAGATGAAGTCTGG + Intergenic
938218842 2:129548287-129548309 CTAAAGTATTAGATACAGTGTGG - Intergenic
939040861 2:137188088-137188110 TTAAAGAATTAAATGAATGCTGG + Intronic
939358908 2:141143223-141143245 ATAAAGAATCAGATGATCTCTGG - Intronic
939881438 2:147635851-147635873 CTGAACAATTACATGAAGTGAGG - Intergenic
940469238 2:154072816-154072838 ACAAAGAATTAAATGAAGACAGG + Intronic
940599296 2:155837432-155837454 CTACATAATGAGATGAAGTGAGG + Intergenic
942023700 2:171892519-171892541 CTTAAGAAGTAGATGTAGGCCGG - Intronic
942262163 2:174177990-174178012 CTAGAGAATTAGTTGAATTGGGG - Intronic
942710519 2:178830080-178830102 CTAAAGAAGTACATAAATTCTGG + Exonic
942737124 2:179127114-179127136 ATAAAGTTTTAGAGGAAGTCAGG - Intronic
943828778 2:192430957-192430979 CTACATATTTAGATCAAGTCTGG + Intergenic
945423336 2:209666287-209666309 ATAAAGAATTAGATGAGAACTGG - Intronic
945618524 2:212105076-212105098 CTAAAAAATCAGATGACTTCTGG + Intronic
946040293 2:216777100-216777122 CAAAAGAACTGGATGGAGTCTGG + Intergenic
946269168 2:218575696-218575718 TTTAAGAATCAAATGAAGTCCGG - Intronic
946949720 2:224860491-224860513 TTAAAAAAATAGATAAAGTCAGG + Intronic
946952624 2:224893610-224893632 CTGAAGAAATAGATGACTTCAGG - Intronic
947232587 2:227902889-227902911 ACAAAGAATTAGATGGAATCTGG + Intronic
947357824 2:229315613-229315635 CTGAAGAATTAAAATAAGTCTGG + Intergenic
947609042 2:231511012-231511034 CAAAAGAATTACCTGAACTCAGG + Intergenic
947861099 2:233357942-233357964 CTGAAGAATTATTTGAAGTTTGG - Intronic
947952242 2:234158296-234158318 CTATAGGGTTAGATGAACTCAGG - Intergenic
1169069313 20:2713069-2713091 CAAAGGAATCAGATGATGTCTGG + Intronic
1171117003 20:22533700-22533722 CTAAAGGTTAAGATGAAGTTGGG - Intergenic
1172535752 20:35671922-35671944 CTAAAGAACTAGATGAATGCAGG - Intronic
1173205853 20:40992542-40992564 CTAGAGACTTAGATGCACTCTGG - Intergenic
1173521244 20:43701868-43701890 TTAAAAAATTAGCTGAAGCCGGG + Intronic
1173631212 20:44517157-44517179 GCAAAGAATGAGATGATGTCAGG + Intronic
1176991511 21:15502773-15502795 CTAAAGATTTAGAGGCAGACTGG + Intergenic
1177863077 21:26478333-26478355 TTAAAGACTTAAATGAAGTGAGG + Intronic
1178547408 21:33503983-33504005 TTAAAAAAATAGATGAAGTAAGG + Exonic
1178733455 21:35127395-35127417 ATAAAGAAGTAGATGACGACTGG - Intronic
1182480587 22:30606545-30606567 TTAAAGAATGGGATTAAGTCCGG - Intronic
1183140526 22:35934353-35934375 CTAAACAATTGGTTGAAGTGGGG - Intronic
949716237 3:6934768-6934790 CAATAGAACTAGATGAAGTTTGG + Intronic
950108963 3:10406259-10406281 GAAAAGAATGAGATGAAGTGTGG + Intronic
951806956 3:26656010-26656032 ATAGAGAAGTAGATGAGGTCAGG - Intronic
952464668 3:33569791-33569813 CTAAAGATTTAAATGCAGTGGGG - Intronic
953856347 3:46502323-46502345 CTAAAGAAGTAATTGAAGTCTGG + Intergenic
958053809 3:88383956-88383978 CTAAAGAATAAGAAGAAGCCCGG - Intergenic
958528648 3:95294405-95294427 CTAAAGGATTAGATGAAACTGGG - Intergenic
960117522 3:113911471-113911493 CTAAAGGATCAGTTGAAGCCAGG - Intronic
960313579 3:116147994-116148016 CTATAGAATTAGGTCAACTCTGG - Intronic
960725707 3:120667921-120667943 CTCAGGAATGAGGTGAAGTCAGG + Intronic
962837251 3:139200392-139200414 GTACAAAATTAGATGGAGTCTGG - Intronic
963665771 3:148184168-148184190 CTAATGGACTTGATGAAGTCAGG + Intergenic
964181378 3:153891111-153891133 CAAAATAAGTAGATGAGGTCTGG - Intergenic
965684635 3:171289126-171289148 CTCAAGAAGTAGATGAAGTGGGG + Intronic
967123375 3:186403595-186403617 AAAAAGAAGTAAATGAAGTCGGG - Intergenic
967310203 3:188098864-188098886 CTAAAGAAACAGATGAGGCCGGG + Intergenic
969230970 4:5830923-5830945 CTAAAGACTTACATAAATTCAGG - Intronic
969567372 4:7986546-7986568 CTAAAGAAGAAAATGCAGTCAGG - Intronic
969996036 4:11314330-11314352 CTAAGGGATTAGTTGAAGTTAGG - Intergenic
970507687 4:16748552-16748574 ATAAAGCATTTGTTGAAGTCAGG - Intronic
970964316 4:21910178-21910200 CAAAAGAAGGAGATGAGGTCAGG + Intronic
971439545 4:26665532-26665554 CTAGATAAGTAGAGGAAGTCTGG + Intronic
972213216 4:36863540-36863562 CTAAAGGATTACATAAAGTTTGG + Intergenic
972813851 4:42622077-42622099 TTAAAGACTTAAATGAAGGCTGG + Intronic
974070479 4:57118973-57118995 ATGAAGAATTATAAGAAGTCTGG - Intergenic
974873046 4:67667244-67667266 CAAAATAATTAGATATAGTCAGG + Intronic
975724318 4:77277325-77277347 CTAAGGTGTTACATGAAGTCTGG + Intronic
976782735 4:88778926-88778948 ATAAAGAACTAGAGGAAGTAAGG - Intronic
977575730 4:98672366-98672388 CCAAAGAATGAGATGCAGCCAGG + Intergenic
979133235 4:117075407-117075429 CTCAAGGATCTGATGAAGTCAGG + Intergenic
979768318 4:124490574-124490596 ATATAGAAATAGATGAAGTGTGG + Intergenic
980662192 4:135876396-135876418 CTAAAGGATGAGAAGGAGTCAGG + Intergenic
981218853 4:142207548-142207570 CTAAAGAATTTGATAACTTCAGG + Intronic
984665821 4:182428188-182428210 GTAAAGATTTAGAGGAACTCCGG + Intronic
985969154 5:3361796-3361818 CTAAAGAATGAGAGGAAGGCAGG + Intergenic
987227799 5:15861920-15861942 ATAAACAATTAAATGAAGTCTGG - Intronic
988364317 5:30276214-30276236 CTAAAGAAATACATGAGGTTGGG - Intergenic
992744549 5:79806422-79806444 CTAAAGAGCTAAATGAAGTGAGG + Intergenic
996290558 5:121846985-121847007 CTAAAGAATTAAATGAGGCAGGG + Intergenic
996364720 5:122688986-122689008 CTAAAGACTTAGATAAGGCCGGG + Intergenic
997795121 5:136801728-136801750 ATAAAAAATTAGATGATATCAGG - Intergenic
998649514 5:144102343-144102365 CTAATGAATTCTAGGAAGTCAGG + Intergenic
999964590 5:156795854-156795876 CTAAAGAATCAAATGAAGAATGG + Intergenic
1001171709 5:169425481-169425503 CTTATGAATTAGGGGAAGTCAGG + Intergenic
1001349788 5:170949210-170949232 CTAATTAATTAGATAAACTCTGG - Intronic
1002777918 6:344228-344250 CTAAAGAGTTAGAAGAAGAAAGG + Intronic
1002979516 6:2122197-2122219 CTAAAGGTTTAGATGAGATCAGG - Intronic
1003997857 6:11561559-11561581 CTAAAGATTTTGATCAACTCTGG - Intronic
1004909928 6:20273127-20273149 CAGAAGAATCACATGAAGTCAGG - Intergenic
1006846477 6:37065554-37065576 TTAAAGAATTAGATGAGATGGGG + Intergenic
1007118046 6:39357743-39357765 CTTAAGAATTACATCAAGGCCGG - Intronic
1008102376 6:47405782-47405804 GAAAAGAATTAGATGAATTCTGG + Intergenic
1008748621 6:54704931-54704953 CCAAAGCATTATGTGAAGTCAGG + Intergenic
1008822056 6:55644803-55644825 CTGTAGTATTAGTTGAAGTCAGG + Intergenic
1009956881 6:70466053-70466075 TTACAGAATTAGGTGAGGTCAGG + Intronic
1012133745 6:95529112-95529134 GTCAAGAGTTAGATGAAGTGGGG + Intergenic
1013175926 6:107676405-107676427 GAAAAATATTAGATGAAGTCAGG + Intergenic
1013319444 6:108972628-108972650 CTAAGGAATTAGTTGAAATAAGG + Intronic
1013956640 6:115849725-115849747 CTAAAGCAATAGAAGAAGACAGG + Intergenic
1014608140 6:123504947-123504969 TTAAAGAATTTGATGAAGGCCGG + Intronic
1015099797 6:129463420-129463442 CTAATGAATTAAATGAACTGGGG + Intronic
1015989402 6:138921361-138921383 TTAAAGATTTACATGAAGGCTGG + Intronic
1016811380 6:148264446-148264468 CACAAGAATTACATGAAGACTGG + Intergenic
1017099067 6:150831606-150831628 CCGAAGAAGTAGATGAAATCTGG + Exonic
1017235727 6:152115622-152115644 TGAAAGAACTATATGAAGTCAGG + Intronic
1017340161 6:153311820-153311842 TTAAAGTGTCAGATGAAGTCAGG - Intergenic
1019099894 6:169621035-169621057 ATGAAGAGTTAGATGAAGTGAGG - Intronic
1021146918 7:17100208-17100230 AAAAAGAATTAAATGAAGACTGG + Intergenic
1022223214 7:28335102-28335124 CTAAAGTATAATTTGAAGTCAGG + Intronic
1023511315 7:40956573-40956595 CAAAAGAAATAAATGAATTCAGG - Intergenic
1026961726 7:74412573-74412595 CAAAAGAATTACTTGAACTCGGG + Intergenic
1027436166 7:78166799-78166821 CTAGAGAATTAGAAGATGTTAGG - Intronic
1028088791 7:86671769-86671791 GTAAAGAATCAAATGAAGTGAGG - Intronic
1028276242 7:88861313-88861335 TTAAAGAAAAAGATGAAGCCAGG + Intronic
1028287442 7:89020872-89020894 ATAGATAATTAAATGAAGTCAGG - Intronic
1030327121 7:108232046-108232068 ATAAATAATTAGATGAACTCAGG + Intronic
1030437552 7:109543391-109543413 TTAAAGAATTAGAAGATGTGTGG - Intergenic
1032826231 7:135571218-135571240 TTGAACAATGAGATGAAGTCAGG - Exonic
1033843787 7:145407081-145407103 CTACATAATGAGATGAAGTGAGG - Intergenic
1037279511 8:17221954-17221976 ATTAAGAATTATATGAAGTCAGG + Exonic
1039255516 8:35714682-35714704 GTAAAGAATAAGATGAAGAATGG + Intronic
1042571393 8:70169272-70169294 CTCCAAAATAAGATGAAGTCAGG + Intronic
1043579675 8:81697721-81697743 ATAAAGAACTACATGAGGTCGGG - Intergenic
1044023815 8:87142444-87142466 ATATAGAATTACATGAAGACAGG + Intronic
1044474178 8:92606711-92606733 ATAAAGAATTAGATGAGTTTAGG + Intergenic
1045833985 8:106498864-106498886 CTAAAGAATTAGGAGATGGCCGG + Intronic
1046868793 8:119181086-119181108 CTAAGTAATGAGATGAAGTGAGG - Intronic
1049080747 8:140441523-140441545 CTAAAGAAGTAAATTAGGTCAGG + Intronic
1050064843 9:1748855-1748877 CTAGAAAAATAGATGAAATCAGG - Intergenic
1051637817 9:19196934-19196956 TTAAAAAATTAGTTGAAGCCTGG - Intergenic
1053070335 9:35097379-35097401 CTGGAGAATCAGTTGAAGTCAGG + Intergenic
1053253767 9:36597359-36597381 ATAAAGAATAAGTGGAAGTCAGG - Intronic
1055870696 9:80875896-80875918 CTAAAGCAATAGATGAAGAAAGG + Intergenic
1056892515 9:90509090-90509112 CTAAAGAGTTAGAGAAGGTCTGG + Intergenic
1057032526 9:91786873-91786895 CTAAAGAATTAGAGGAGCTACGG + Intronic
1058256728 9:102776001-102776023 CTGAAGTATTATTTGAAGTCAGG + Intergenic
1059915337 9:119093542-119093564 CTGAAGACTTAGGTGCAGTCTGG - Intergenic
1060138409 9:121181216-121181238 CTAAACAACTAGATGTAATCAGG - Exonic
1186229424 X:7437242-7437264 ATAAGGAATTAGAGGAAGACTGG + Intergenic
1186499904 X:10042854-10042876 CTATAAAATTATTTGAAGTCCGG - Intronic
1186923839 X:14310308-14310330 TTAAAGAATAGGATGGAGTCTGG - Intergenic
1188528439 X:31111594-31111616 CTAAAGGATTAGAGGAAGGCCGG + Intronic
1188540622 X:31246625-31246647 CTTAAGAATTATGTGAAATCAGG + Intronic
1189136017 X:38551042-38551064 CTATAGAATGATTTGAAGTCAGG + Intronic
1191831546 X:65420683-65420705 ATAGACAATTAGATGAAATCAGG + Intronic
1194176792 X:90660666-90660688 CAAAAGTATAAGATGAAGTGAGG - Intergenic
1195476520 X:105292356-105292378 CTTAAGGATTAGCTGAAGTGTGG - Intronic
1198563557 X:137879796-137879818 CTAATGAATTGGAAGAGGTCTGG - Intergenic
1199277478 X:145963477-145963499 CTAGAGAATTAGAGAAAGTTAGG + Intergenic
1200523417 Y:4241516-4241538 CAAAAGTATAAGATGAAGTGAGG - Intergenic