ID: 1102338636

View in Genome Browser
Species Human (GRCh38)
Location 12:112104085-112104107
Sequence CTGAGTTAGGACATTTCTCT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 186
Summary {0: 1, 1: 0, 2: 1, 3: 15, 4: 169}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1102338636_1102338639 0 Left 1102338636 12:112104085-112104107 CCAAGAGAAATGTCCTAACTCAG 0: 1
1: 0
2: 1
3: 15
4: 169
Right 1102338639 12:112104108-112104130 CAAAGAAGTGACTGTCACCCGGG 0: 1
1: 0
2: 1
3: 14
4: 185
1102338636_1102338640 11 Left 1102338636 12:112104085-112104107 CCAAGAGAAATGTCCTAACTCAG 0: 1
1: 0
2: 1
3: 15
4: 169
Right 1102338640 12:112104119-112104141 CTGTCACCCGGGAGACACACTGG 0: 1
1: 0
2: 0
3: 15
4: 128
1102338636_1102338638 -1 Left 1102338636 12:112104085-112104107 CCAAGAGAAATGTCCTAACTCAG 0: 1
1: 0
2: 1
3: 15
4: 169
Right 1102338638 12:112104107-112104129 GCAAAGAAGTGACTGTCACCCGG 0: 1
1: 0
2: 1
3: 14
4: 172

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1102338636 Original CRISPR CTGAGTTAGGACATTTCTCT TGG (reversed) Intronic
903132339 1:21288508-21288530 ATGAAATAGCACATTTCTCTGGG - Intronic
903994138 1:27294788-27294810 CTGAGCTAGGACATCTCTCTGGG - Intronic
906399479 1:45494579-45494601 ATGAGGTAGGACACTGCTCTAGG - Intronic
907239145 1:53071056-53071078 CTGAATTAGGAGGTTACTCTGGG - Intronic
910876125 1:91880082-91880104 TTGAGTGAGGGCATTTCTGTAGG - Intronic
911269099 1:95778778-95778800 CTTACTTAGGACGTTTGTCTAGG + Intergenic
915482704 1:156197996-156198018 CTGAGTTGGGACCTTTGGCTGGG + Intronic
917234849 1:172880180-172880202 CTGAATTTGTACATTTCTTTGGG + Intergenic
919472137 1:197991848-197991870 CTGAGTTCGGTTATTTCCCTTGG - Intergenic
920257411 1:204664989-204665011 CTGATTTAGGACACTGTTCTAGG - Intronic
923020686 1:230161083-230161105 CTGGGTTAGGCCATTCCACTTGG - Intronic
1064260202 10:13779367-13779389 CTCAGTAAGGAATTTTCTCTTGG - Intronic
1068056657 10:52019817-52019839 TTGAGTTTGGAGAGTTCTCTAGG + Intronic
1068359260 10:55954413-55954435 CTTATTTGGGACATGTCTCTTGG - Intergenic
1072251257 10:93584015-93584037 CTGAGTAAGGATATCGCTCTAGG - Intronic
1073246076 10:102091114-102091136 CTGAATTAGGGCATTTGTGTTGG - Intergenic
1077698236 11:4414642-4414664 CAGTCTTAGGACTTTTCTCTGGG + Intergenic
1078273279 11:9817391-9817413 CTGAGTTATGCAATTTCTCAGGG + Intronic
1087153310 11:94877888-94877910 CTGAGCTCTGACCTTTCTCTTGG + Intergenic
1089260707 11:117222081-117222103 CTGAGTCGGGAGATCTCTCTGGG - Intronic
1089776230 11:120838201-120838223 CTGAGTCAGGACTTGACTCTGGG - Intronic
1089777360 11:120847775-120847797 CTGAGTTAGCACCTTTAGCTTGG + Intronic
1090309124 11:125719349-125719371 CTGCCCTAGGACATTGCTCTAGG - Intergenic
1090340636 11:126016913-126016935 CTGAATTAGGCCATTTTTCTGGG - Intronic
1092641065 12:10510316-10510338 CTGAGTTAGGATAATTGTTTGGG - Intronic
1095205479 12:39435139-39435161 CTAAGTTTGAACATTTTTCTTGG + Intronic
1096372148 12:51077895-51077917 CTGAGATAGTCCATTTCCCTAGG + Intronic
1100312414 12:93408924-93408946 TTGGGTTATGACATTTTTCTTGG - Exonic
1102338636 12:112104085-112104107 CTGAGTTAGGACATTTCTCTTGG - Intronic
1103380942 12:120494040-120494062 ATGATTTAGGAAATTTCCCTGGG + Intronic
1104226596 12:126840945-126840967 CTGGGAGAGGAAATTTCTCTAGG - Intergenic
1106277625 13:28228099-28228121 CTGAGTAGGCACATTGCTCTGGG - Intronic
1108978347 13:56478762-56478784 CTGGGTTTGGACATTTCTAATGG - Intergenic
1112125635 13:96464365-96464387 CTGAATAAGGACATTTTCCTTGG + Intronic
1114270356 14:21097358-21097380 TTGCGTTAGGACATGCCTCTGGG - Intronic
1115336816 14:32250392-32250414 CTGATATATGACCTTTCTCTAGG - Intergenic
1124933255 15:34144369-34144391 CTTAGTTATAACATTTTTCTCGG - Intronic
1126568487 15:50125444-50125466 CTTAATCAGGACATGTCTCTGGG + Intronic
1127737028 15:61851247-61851269 CGGAGGGAGCACATTTCTCTTGG - Intergenic
1128656079 15:69462925-69462947 CTGACTTAAGACATTCCTCCGGG - Intergenic
1130793255 15:87179378-87179400 ATCAGTGAGGACATTTCTCCAGG + Intergenic
1133269607 16:4604312-4604334 CTGCGTTTGGAAAGTTCTCTGGG - Intergenic
1134179471 16:12035933-12035955 CAGAGTTAGGACAGTCCTCTGGG + Intronic
1136302947 16:29348865-29348887 CAGAGTTAGGACAGTCCTCTGGG + Intergenic
1140377537 16:74456740-74456762 ATGAGACAGGACATTTCTGTGGG + Exonic
1141630195 16:85283479-85283501 CTGAGTTAGGCCATGCCTCAGGG - Intergenic
1143326932 17:6105141-6105163 CTGAGTCATGACCTTGCTCTAGG + Intronic
1145001182 17:19305792-19305814 CTGAGTTGGGAGAGTTTTCTTGG + Intronic
1145984940 17:29039469-29039491 CTCAGATAGTACATTTTTCTCGG + Intronic
1151316479 17:73325573-73325595 GTGAGAGAGGACATTTCTGTTGG - Intergenic
1151769001 17:76147451-76147473 CAGAGTCAGGACAGCTCTCTGGG - Intronic
1152406002 17:80098288-80098310 ATGACTTTGGACTTTTCTCTTGG + Intronic
1153410095 18:4783168-4783190 CTGAGTTATCCCATCTCTCTAGG + Intergenic
1153648583 18:7218145-7218167 TTGAGTTTGTACATTTCTTTGGG + Intergenic
1155755606 18:29491200-29491222 CTTAGTTAGGGCTTTTATCTAGG + Intergenic
1155844391 18:30687494-30687516 CTGAGGCAGGACACTTCTCCTGG + Intergenic
1155892850 18:31288756-31288778 GTGGATTAGCACATTTCTCTGGG - Intergenic
1158062560 18:53363664-53363686 CTGAGGTAGGGAATTTATCTGGG - Intronic
1158774325 18:60557861-60557883 CTGAGATAGGAGATTTATCCTGG - Intergenic
1159659984 18:71083241-71083263 CTGAAATAGGTCATTTTTCTGGG + Intergenic
1160740175 19:681935-681957 CTGATTTAGGGCCCTTCTCTAGG + Exonic
1163742476 19:19024207-19024229 CTGAGTTAGGAGAATCCACTTGG - Intronic
1164325717 19:24189556-24189578 GTGAGTTATGACATATCACTTGG - Intergenic
1165365188 19:35360904-35360926 CTGACTTGGGACATTTGACTGGG - Intergenic
926002587 2:9345786-9345808 TTGAGTGATGACATTTCTATAGG - Intronic
926813900 2:16781423-16781445 CAGAGTTAGAACATTTCTCAGGG + Intergenic
927845709 2:26471334-26471356 CTGAGTGAGGATGTTTCTTTGGG + Intronic
928252492 2:29694053-29694075 CTGAGTTAGTAGAGTTTTCTAGG + Intronic
933286119 2:80386353-80386375 CTAGCTAAGGACATTTCTCTTGG - Intronic
935752822 2:106252670-106252692 CTGATTCAGGACTTTTCTTTTGG + Intergenic
935913241 2:107920211-107920233 CTGATTCAGGACTTTTCTTTTGG + Intergenic
937897115 2:126985855-126985877 CTAAGTTGGAACATTTCTATGGG - Intergenic
941266779 2:163372304-163372326 ATGAGTTAGTACAATCCTCTTGG + Intergenic
941452872 2:165680466-165680488 AAGAGTTAGGACAATCCTCTGGG + Exonic
941499905 2:166261273-166261295 CTGAGGCAGGACATTTATCTGGG - Intronic
941740755 2:169032780-169032802 CTGAGTTGACAAATTTCTCTTGG - Intergenic
943778265 2:191792105-191792127 CTAAGCAGGGACATTTCTCTTGG + Intergenic
946231675 2:218295430-218295452 CTGGGTTAGGAGCTTTCTCTGGG - Intronic
946807295 2:223483862-223483884 CTGCGTTCAGATATTTCTCTAGG + Intergenic
948153472 2:235763635-235763657 CTGAATTAGGACAGGTCTCCTGG - Intronic
948321670 2:237074749-237074771 CTGAGTCAGGACATATGTCGTGG - Intergenic
948975292 2:241460038-241460060 CAGAGTTAGGACATTGCCTTTGG + Intronic
1169894519 20:10488471-10488493 GTGAGAGAGTACATTTCTCTTGG + Intronic
1173888076 20:46479298-46479320 CTGAGTTGGGACAATTATCCTGG - Intergenic
1181488165 22:23244689-23244711 CTCAGTAAGTACATTTGTCTGGG + Intronic
1182843203 22:33409044-33409066 CTGAGATAGGCTATTTCTCTTGG + Intronic
1183186972 22:36297647-36297669 ATGTGTAAGGACATTTGTCTAGG + Intronic
1183493039 22:38126911-38126933 CTGAGTCAGGACGTTCCTCGGGG + Intronic
949496285 3:4635298-4635320 CTGAGTTAGCACCTTTCTAAAGG - Intronic
950339247 3:12228014-12228036 CTGAGTCAAGAAAATTCTCTTGG - Intergenic
950866991 3:16197224-16197246 CTGGGGTAGCCCATTTCTCTGGG - Intronic
951045742 3:18036277-18036299 CTGTGTTAGGACATGGCTCTTGG + Intronic
951778647 3:26338684-26338706 ATGCTTTAGGACATTTATCTGGG - Intergenic
952047538 3:29341589-29341611 CTGAGCTTGCTCATTTCTCTGGG + Intronic
953457329 3:43053595-43053617 CTGGGTTCTGGCATTTCTCTCGG - Exonic
953479479 3:43238022-43238044 TTGTGTTAGGACATTTCTGATGG - Intergenic
953810368 3:46107669-46107691 CTGAGTGGGGCCACTTCTCTTGG + Intergenic
954495041 3:50950379-50950401 CAGAATTAAAACATTTCTCTGGG + Intronic
955090837 3:55749139-55749161 CTGAGTTCTGTCACTTCTCTGGG - Intronic
957984088 3:87550415-87550437 CTGGGCTAGGAATTTTCTCTTGG + Intergenic
961154604 3:124668351-124668373 AGGAGTCATGACATTTCTCTGGG + Intronic
961432920 3:126895974-126895996 CTGAGCTAGAACATCTCTCAGGG - Intronic
965582845 3:170287944-170287966 ATGAATTAAGACTTTTCTCTTGG + Intronic
967152928 3:186666238-186666260 CTGAGTTGGGAGATTACTCACGG + Intronic
969412837 4:7041083-7041105 CTGGGTTAGGAGTTTTATCTGGG - Exonic
972946203 4:44259060-44259082 CTGGGTTAGGAAACTTGTCTTGG + Intronic
975263631 4:72335065-72335087 CTAAGTTAACACTTTTCTCTGGG - Intronic
975358249 4:73433660-73433682 GTGAGTTAATTCATTTCTCTGGG - Intronic
975873761 4:78811751-78811773 GTCATTTAAGACATTTCTCTCGG + Intronic
976272042 4:83240341-83240363 CTGAATTATGAAATTCCTCTGGG - Intergenic
976858076 4:89628404-89628426 CTGAGTTAGGTCAGTGCTGTTGG + Intergenic
977915173 4:102584521-102584543 CTGAGTTTGGAACTTTCTCCAGG + Intronic
977970745 4:103211181-103211203 ATGAGTTATGATATTTCTTTGGG - Intergenic
978243632 4:106547026-106547048 TTGATTTTGAACATTTCTCTGGG - Intergenic
979107504 4:116705976-116705998 ATAAGTTAGGACGTTTCTCAGGG + Intergenic
979698961 4:123645831-123645853 CTAATTAAGGACATGTCTCTAGG + Intergenic
980014030 4:127628363-127628385 CTGAGGTAGGAGATGTGTCTAGG + Intronic
980432544 4:132722894-132722916 ATGATTCAGGACATTTGTCTTGG - Intergenic
980828477 4:138100861-138100883 CTGAATTTAGTCATTTCTCTGGG + Intergenic
980923177 4:139107865-139107887 CTGTGATCAGACATTTCTCTAGG - Intronic
982472019 4:155804101-155804123 TTGAGATAGGATATTTCCCTGGG + Intronic
985752951 5:1692878-1692900 CTGAGTTATGGCATTTTTATAGG + Intergenic
987266527 5:16262059-16262081 CTGGGCTAGGACACTTTTCTGGG - Intergenic
990887525 5:60611698-60611720 AAGAGTTAGGACTTTTCTCTAGG - Intronic
993076340 5:83236631-83236653 GTGATTCAGGACATTTGTCTGGG + Intronic
993355038 5:86895542-86895564 GTGAGTAAGGATATTTCTCAAGG - Intergenic
994864087 5:105242509-105242531 CTGAGATATGACATTTATCTTGG + Intergenic
995863943 5:116671136-116671158 TTGAGCTTGGACTTTTCTCTGGG + Intergenic
996986344 5:129570034-129570056 CTGATTTAGGAGAATTCTTTTGG - Intronic
999859217 5:155627506-155627528 CTGAGTTGGGCCATTTCCCATGG - Intergenic
1000141278 5:158405543-158405565 CTGAGTTAGGACCTGTCTTCTGG - Intergenic
1000535395 5:162472130-162472152 CTGTGTTAGGTCACTGCTCTGGG + Intergenic
1000546947 5:162614845-162614867 CTGATGTAGGACATTTTTCTGGG - Intergenic
1000639967 5:163689781-163689803 CTGATTTAAGATAATTCTCTTGG + Intergenic
1004053391 6:12110602-12110624 GAGAGTTAGGGCCTTTCTCTGGG + Intronic
1004456096 6:15792721-15792743 CTGAGTCAGGCCAGTTCTCTCGG + Intergenic
1005681331 6:28211701-28211723 CAGAGATAGGACATTTCACAGGG + Intergenic
1006864720 6:37200237-37200259 CTGAGTTTGCACTTTTCTCTGGG - Intergenic
1008314225 6:50019630-50019652 CTGAGTTAGATGATTTCTTTGGG - Intronic
1010634288 6:78238601-78238623 TAGAGTTTGGACATATCTCTAGG - Intergenic
1012093539 6:94930728-94930750 CTAAGTTAGGGAATTTCTCCTGG + Intergenic
1012502743 6:99907451-99907473 ATGATTTAGGACATTGGTCTGGG + Intergenic
1013162759 6:107561540-107561562 CTGGGCTGGGCCATTTCTCTGGG + Intronic
1013783681 6:113755933-113755955 CTGAGTGAGGTTATTACTCTGGG - Intergenic
1016598987 6:145835084-145835106 GTGAGTGAGGACATTTCAATAGG - Intergenic
1016640948 6:146348758-146348780 CTGGTTTAGGACTTCTCTCTGGG - Intronic
1017167323 6:151421452-151421474 GTGAGTTAAGACATTAATCTGGG - Intronic
1020538449 7:9430182-9430204 CTGATATATGACCTTTCTCTAGG - Intergenic
1021661344 7:22921147-22921169 ATGAGCTAACACATTTCTCTTGG + Intergenic
1021816876 7:24455713-24455735 CTGTGCCAGGACATTTTTCTAGG - Intergenic
1022257617 7:28675006-28675028 CTGCCTTAGGGCATTTATCTAGG + Intronic
1025979870 7:66396569-66396591 ATGAGTTAGGTCTTTTCTCCAGG - Intronic
1029699368 7:102236340-102236362 CTGAGGTAGGCCATGCCTCTTGG + Intronic
1030042866 7:105467725-105467747 CTGAGTAAGCACCTCTCTCTGGG - Intronic
1031429143 7:121644789-121644811 ATGAGGAAGGACATTTCTCCAGG + Intergenic
1033135674 7:138782112-138782134 CTGAGATAATACATTTCTGTTGG - Intronic
1034129590 7:148702742-148702764 CTGGGTTAGGAGCCTTCTCTGGG + Intronic
1034544388 7:151780416-151780438 CTGACTTAGAACATTTGTATTGG - Intronic
1034677066 7:152899414-152899436 CTGATTTATTACTTTTCTCTGGG + Intergenic
1035288421 7:157821291-157821313 CTGAGTAAAGACATAACTCTAGG + Intronic
1035878241 8:3214790-3214812 CTTATTTAGGACATTGTTCTAGG - Intronic
1036780921 8:11646786-11646808 CTGAGTTAAGGCATGTCCCTTGG - Intergenic
1038333391 8:26627515-26627537 CAGAGAGAGGCCATTTCTCTCGG + Intronic
1038621827 8:29151192-29151214 GAGAGTTAGGACCTTGCTCTGGG - Intronic
1039589834 8:38737061-38737083 CTGAGCTAGGTCATTTCTTAGGG - Intronic
1039618749 8:38977478-38977500 CTGAGTCAGCACATCTATCTGGG - Intronic
1040372046 8:46786829-46786851 CTGAGTTAGGGAAATTCTCATGG + Intergenic
1040397879 8:47016684-47016706 CAGAGTGAGGACATCTTTCTTGG + Intergenic
1041947453 8:63462029-63462051 CTGAGTTAGGACCAGTTTCTGGG + Intergenic
1044289427 8:90450411-90450433 GAGAGTTAGGACATTGCTCCGGG + Intergenic
1044779706 8:95731647-95731669 TTTATTTAGGACATTTCACTTGG - Intergenic
1045573438 8:103393507-103393529 GAGAGTTAGGACATTTCTGCAGG - Intergenic
1045970669 8:108076462-108076484 CTGAGCTAGGAAATATCTTTGGG + Intronic
1047401225 8:124549185-124549207 TTCTGTTAGGACATTTATCTTGG + Intronic
1047431494 8:124797212-124797234 CTCAGTTGGGACATTACTTTGGG - Intergenic
1048069517 8:131006768-131006790 CTCAGTTCTGACATTTCTCATGG - Intronic
1052046630 9:23801544-23801566 CTTAGCTAGGACACTTCTGTTGG - Intronic
1055206967 9:73743423-73743445 GTGAGTTACTAAATTTCTCTGGG - Intergenic
1056000374 9:82210187-82210209 GTGCCTGAGGACATTTCTCTTGG + Intergenic
1058774925 9:108273597-108273619 CTGACTAAGAACCTTTCTCTTGG + Intergenic
1062118846 9:134823114-134823136 CTGAGCTAGGACGGTTGTCTGGG - Intronic
1191154841 X:57262491-57262513 CTGAGTTTGGAGATTTCCTTGGG - Intergenic
1195017254 X:100791731-100791753 CTGAGCTAGGACATTTCACAAGG + Intergenic
1196919491 X:120571068-120571090 CTGGGATAGGAGATTGCTCTAGG + Intronic
1197564515 X:128065491-128065513 CTGAGTTTGTAGATTTCTTTGGG - Intergenic
1199697927 X:150356703-150356725 CTGAGTTGGGCCTTTTCTCTTGG + Intergenic