ID: 1102344075

View in Genome Browser
Species Human (GRCh38)
Location 12:112147317-112147339
Sequence CTCAATACTCTGATTTGGTT TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 192
Summary {0: 1, 1: 0, 2: 0, 3: 12, 4: 179}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1102344071_1102344075 -1 Left 1102344071 12:112147295-112147317 CCAGGAGGGAACTTCTTGTTCCC 0: 1
1: 0
2: 0
3: 11
4: 111
Right 1102344075 12:112147317-112147339 CTCAATACTCTGATTTGGTTTGG 0: 1
1: 0
2: 0
3: 12
4: 179
1102344070_1102344075 9 Left 1102344070 12:112147285-112147307 CCACGTCTGGCCAGGAGGGAACT 0: 1
1: 0
2: 0
3: 25
4: 215
Right 1102344075 12:112147317-112147339 CTCAATACTCTGATTTGGTTTGG 0: 1
1: 0
2: 0
3: 12
4: 179
1102344069_1102344075 12 Left 1102344069 12:112147282-112147304 CCTCCACGTCTGGCCAGGAGGGA 0: 1
1: 1
2: 9
3: 139
4: 960
Right 1102344075 12:112147317-112147339 CTCAATACTCTGATTTGGTTTGG 0: 1
1: 0
2: 0
3: 12
4: 179

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1102344075 Original CRISPR CTCAATACTCTGATTTGGTT TGG Intronic
904308220 1:29604546-29604568 CTCTTGACTCTGATTTAGTTGGG - Intergenic
905657780 1:39696587-39696609 CTCAAGATTCAGATTTGCTTGGG - Intronic
906426399 1:45717413-45717435 CGGTATACTCTGATTAGGTTTGG - Intronic
907990316 1:59575835-59575857 CTAAATATTCTCATATGGTTTGG + Intronic
912149349 1:106838318-106838340 CTCAGCTCTCTGATTTGGTTGGG - Intergenic
916215026 1:162386790-162386812 CACAATAAAATGATTTGGTTTGG + Intronic
916562134 1:165942109-165942131 CCCAATACTCTCATTTTATTAGG - Intergenic
918662916 1:187112220-187112242 TTCAATACTCTGACTTTGCTAGG - Intergenic
919543257 1:198878203-198878225 CTAAGTGCTCTGATATGGTTTGG + Intergenic
921331607 1:214044111-214044133 CTCAATACTCTCATTGGGTAGGG + Intergenic
923477524 1:234348515-234348537 CTCGAGACTCTGATTTAGTTGGG + Intergenic
1063241465 10:4174256-4174278 CAAAGTGCTCTGATTTGGTTCGG - Intergenic
1064421303 10:15193154-15193176 CTTAAGAATCTGATATGGTTTGG + Intergenic
1066327132 10:34372868-34372890 CTTAAAACTTTGATTTGATTGGG - Intronic
1066701653 10:38135934-38135956 CTGAAGCCTCTGATATGGTTTGG - Intergenic
1068883324 10:62073117-62073139 CTCATCATCCTGATTTGGTTTGG - Intronic
1072869088 10:99097935-99097957 GTCAAGACTCTGATGTGGCTAGG + Intronic
1073005732 10:100322705-100322727 CTCAATACTCTGCTTCTATTAGG + Intronic
1073988301 10:109234500-109234522 CTCTATAACCTGATTTTGTTTGG - Intergenic
1074044272 10:109822276-109822298 CTCTATAATCTGGTTTTGTTTGG + Intergenic
1075646574 10:124100744-124100766 CAAAACACTCTGATGTGGTTTGG + Intergenic
1075850060 10:125579557-125579579 CTTCTTGCTCTGATTTGGTTTGG + Intronic
1076453216 10:130571332-130571354 CTCTGAACTCTGATTTAGTTGGG - Intergenic
1078647058 11:13150431-13150453 CTCTATTCTCTGGTTAGGTTTGG - Intergenic
1078745275 11:14107713-14107735 CGCATTACTCTGATCTGGTTTGG - Intronic
1078855341 11:15201990-15202012 CCCAATAATCTGAGTAGGTTTGG - Intronic
1081193906 11:40137900-40137922 CTCACTTTTCTGATTTGTTTTGG - Intronic
1081724443 11:45318176-45318198 CTGAATACCCTGATTTTATTTGG + Intergenic
1085059100 11:73428149-73428171 CTCAGTTCTCTTCTTTGGTTTGG - Intronic
1087256006 11:95954410-95954432 CTCAATCCTCCGCTTTGCTTTGG - Intergenic
1087367541 11:97239900-97239922 CTTAACACTCTGACTTGTTTAGG - Intergenic
1089212625 11:116816245-116816267 CAAAACACTCTGGTTTGGTTTGG - Intergenic
1096375539 12:51107006-51107028 CAAATTACTCTGGTTTGGTTTGG - Intronic
1101136305 12:101747162-101747184 TTCTATACTCTGATTCGATTGGG + Exonic
1101338721 12:103821315-103821337 TTCAATACCATGATTTTGTTGGG + Intronic
1101616380 12:106342007-106342029 CACAATACTCTGATTTTATTTGG - Intronic
1102344075 12:112147317-112147339 CTCAATACTCTGATTTGGTTTGG + Intronic
1103305333 12:119959614-119959636 CAGATTACTCTGGTTTGGTTCGG - Intergenic
1109258696 13:60117008-60117030 CTCAATACTATGAAATCGTTAGG - Intronic
1109511941 13:63388629-63388651 CAGAATACTCTAGTTTGGTTGGG - Intergenic
1109800357 13:67369533-67369555 ATCAATACTATGATTGGGTGGGG - Intergenic
1111595796 13:90408434-90408456 TTCAAAACACTGATTTGTTTTGG + Intergenic
1112728741 13:102335285-102335307 TTCAATACTATTATTTTGTTTGG + Intronic
1113430707 13:110248210-110248232 CTCCATACGCTTATTTAGTTGGG - Intronic
1115456343 14:33608058-33608080 TTAAATGCTCTGATATGGTTTGG - Intronic
1115727017 14:36228172-36228194 CTCCATACACTGAGTTGATTGGG + Intergenic
1115940527 14:38603507-38603529 CTCAATACTCTGTACTGGGTGGG - Intergenic
1116285100 14:42960831-42960853 CACAATCCTCTGGTTTAGTTGGG + Intergenic
1116808253 14:49514170-49514192 CTAAAAACTCAGATTTTGTTTGG - Intergenic
1118124702 14:62888844-62888866 CTAAATTCTCTAATTGGGTTGGG - Intronic
1118699490 14:68419335-68419357 CCCAATAATTTGATTGGGTTTGG - Intronic
1120397903 14:83991600-83991622 CTTAGTTCTCTGATATGGTTTGG - Intergenic
1120401926 14:84043157-84043179 ATCAAAACTCTCACTTGGTTTGG - Intergenic
1121656049 14:95596421-95596443 CACAATTCTCTGAATTGGCTGGG - Intergenic
1124160338 15:27262518-27262540 CTCAATACTCAGATGGGGTAGGG - Intronic
1125355405 15:38812302-38812324 CTTAATATTCTGATTTGGAAAGG + Intergenic
1126040406 15:44584947-44584969 CTCTGTTCTCTGATTTGATTTGG - Intronic
1126442474 15:48704798-48704820 CTCCAAACTATGATTTGGGTTGG - Intergenic
1130112598 15:80977913-80977935 CTCAGTTCTCTGCTTTGGATGGG - Exonic
1131044849 15:89306028-89306050 CTCAACAGGCTGATTTGGTAGGG - Exonic
1133512059 16:6469247-6469269 TTCAGTACTCTTATTAGGTTTGG - Intronic
1133702805 16:8324985-8325007 ATAATTACTCTGATTTGATTAGG - Intergenic
1136028025 16:27482356-27482378 CTGTATACTCTCATTAGGTTAGG + Intronic
1139237410 16:65354703-65354725 CACATTACCCTGATTTGGTTTGG - Intergenic
1140680508 16:77380439-77380461 TTCAAAACTCTGTATTGGTTTGG + Intronic
1140683899 16:77414141-77414163 CTGAATACTCTGATGTGGACAGG - Intronic
1141569765 16:84927574-84927596 CTCAATGCACTGCTTTGCTTTGG - Intergenic
1144040119 17:11403238-11403260 CTCAAGACTCAGATTTGATAGGG + Intronic
1146526401 17:33570659-33570681 CTCATGATTCTGAGTTGGTTGGG + Intronic
1149766777 17:59285521-59285543 TTCAACACTCAGAATTGGTTTGG + Intergenic
1150836356 17:68567686-68567708 CTTTGTACTCTGATATGGTTTGG + Intronic
1155234660 18:23807156-23807178 ATAAATTCTCTGAATTGGTTTGG - Intronic
1156026212 18:32657633-32657655 CTCAATGTTCTGGTTTGCTTGGG + Intergenic
1156362270 18:36393594-36393616 CCCAATACCCTGAATTGGTGGGG - Intronic
1157260576 18:46173242-46173264 CTCAAAACACTGCTTTGCTTTGG + Intergenic
1160271608 18:77390798-77390820 ATCCATACTCTGCTTTCGTTGGG + Intergenic
1163985934 19:20951400-20951422 CTCAGCACTCTGATTTAGTGTGG - Intergenic
1168429402 19:56265976-56265998 CTCTATACCCTGATTTCCTTTGG - Intronic
1168451636 19:56470952-56470974 GTAAATACTCTGATATGGTTTGG + Intronic
926950924 2:18242652-18242674 CTCTATCTTCTGATATGGTTTGG + Intronic
927358015 2:22196267-22196289 CTCTGTACTCTGACTTGGTCTGG + Intergenic
930127301 2:47811691-47811713 CTCAGGATTCTGATTTGGGTGGG - Intronic
931844686 2:66191155-66191177 CTGGATACGCTGATTTGGTAGGG - Intergenic
932375117 2:71228323-71228345 CTGTATACTTTGATATGGTTTGG + Intergenic
937398935 2:121564707-121564729 CTCACTTCTCTGAGTTGTTTCGG - Intronic
937988216 2:127648114-127648136 CACAGTACTCTGACTTGGTCTGG - Exonic
939052756 2:137328631-137328653 CCAAATTCTCTGATATGGTTTGG + Intronic
940027219 2:149221057-149221079 CTCACTGATATGATTTGGTTTGG + Intergenic
941524465 2:166589466-166589488 CTCAACACTCTTATTTGATATGG - Intergenic
942253592 2:174068963-174068985 CTCAATATTCTCATTTCTTTAGG + Intergenic
942523445 2:176828861-176828883 CTCAAGGCTCTGGTTTGGCTCGG + Intergenic
942729474 2:179048305-179048327 CTTTATACTCTGAATTGCTTGGG + Intronic
943210831 2:184963950-184963972 ATCAATCCTCAGATTTGCTTGGG - Intergenic
943568830 2:189548122-189548144 CTGAATACTCAGAACTGGTTTGG - Intergenic
944008720 2:194944695-194944717 CTCAATACAATGTGTTGGTTGGG + Intergenic
946853444 2:223930038-223930060 TTCCATACTCTGATTTATTTGGG - Intronic
947751774 2:232536314-232536336 CTCACTTCCCAGATTTGGTTAGG + Intronic
1169293127 20:4369829-4369851 CTCTCTACTCTGCTTAGGTTAGG - Intergenic
1172350967 20:34240355-34240377 CCCTAGACTCTGATTTAGTTGGG + Intronic
1174540809 20:51287931-51287953 CTCAATACCTTGATTTTGTGAGG + Intergenic
1175683945 20:61013147-61013169 CTCCAAAATCTCATTTGGTTTGG - Intergenic
1177909497 21:27013116-27013138 GAAAACACTCTGATTTGGTTTGG + Intergenic
1178214423 21:30578152-30578174 CACCAGACTCTGATATGGTTTGG + Intergenic
1178988942 21:37335333-37335355 CTGAAAACACTGATATGGTTTGG - Intergenic
1182049818 22:27304092-27304114 CTCCATACACTGATTTGCTCAGG - Intergenic
1184483491 22:44762067-44762089 GACAATTCTCTGATATGGTTTGG - Intronic
950357855 3:12426629-12426651 CTCATTTCTCTGATTTTCTTGGG - Intronic
951821489 3:26818474-26818496 CTCAATATTCTGTTTTGCATTGG - Intergenic
952857663 3:37785460-37785482 GTAAATACTGTGTTTTGGTTTGG + Intronic
952920035 3:38277699-38277721 CCCAATACTCTGTCTGGGTTAGG + Exonic
956368616 3:68533489-68533511 CTAAAGCCTCTGATATGGTTTGG - Intronic
958007370 3:87829233-87829255 CTCCAGACTCTGATATTGTTGGG + Intergenic
962748614 3:138416598-138416620 CTCTCTACTCTGATTTAATTGGG + Intergenic
964200840 3:154117375-154117397 CTAACTACTCTGATATGATTTGG - Intergenic
967234706 3:187372979-187373001 TTCAATAGTGTGGTTTGGTTTGG - Intergenic
970857401 4:20665022-20665044 CTCACTGCTCTGGTTGGGTTTGG - Intergenic
971868981 4:32211195-32211217 CTCAATAATCTCTTTGGGTTGGG - Intergenic
974939791 4:68452918-68452940 CTCAAATCTCTGAATTGGATGGG + Intronic
976790169 4:88869497-88869519 CTCACTACTCTCATGTGCTTTGG + Intronic
978547937 4:109893330-109893352 CTAAAGAGTCTGATATGGTTTGG + Intergenic
978836578 4:113157609-113157631 CTCAATTCCCTTTTTTGGTTAGG - Intronic
979168568 4:117569657-117569679 ATCAATATTATGAATTGGTTTGG - Intergenic
979741421 4:124155564-124155586 CTCTTTACTGTCATTTGGTTTGG + Intergenic
981220256 4:142223676-142223698 CTCAATACTAGGAGTTGGTAGGG + Intronic
981573777 4:146181541-146181563 CTCAATAATCTGAGTTTGTGTGG - Intronic
984107987 4:175574396-175574418 CTCAATACACTGCTTTGGGTTGG - Intergenic
984729921 4:183058440-183058462 CTCAAAACTCTGGTTTGGGCTGG - Intergenic
986641643 5:9877626-9877648 CTTAATACTCTGATATGGCATGG - Intergenic
986917341 5:12637473-12637495 ATTAATACACTGATATGGTTTGG - Intergenic
987677149 5:21089371-21089393 CTTTATACTATGATATGGTTTGG - Intergenic
988460023 5:31426792-31426814 TTCAATATGCAGATTTGGTTAGG - Intronic
989582557 5:43046494-43046516 CTCAATACACTGAAATGGTTGGG + Intergenic
990238589 5:53794360-53794382 ATCTATCCTCTGATATGGTTTGG - Intergenic
991079089 5:62576063-62576085 TAGAATACTCTGATTTTGTTTGG + Intronic
993298027 5:86168909-86168931 CTAAATATACTGATATGGTTTGG + Intergenic
993359940 5:86962333-86962355 CTCAAGAATCTGGTTTGGGTGGG - Intergenic
993610498 5:90047571-90047593 CACAATACTCAGATTTTATTTGG + Intergenic
995064363 5:107843596-107843618 CTCCTTGCTCTCATTTGGTTTGG - Intergenic
995199878 5:109413964-109413986 TTGAAAACTCTGATATGGTTTGG + Intergenic
997679655 5:135740923-135740945 CTCAATACTGTACTTTGGGTGGG + Intergenic
998221961 5:140290158-140290180 CTCAATTCTCTGATTTACTTGGG - Intronic
1001160376 5:169307381-169307403 CTCAATACACTGATTTTTTAAGG + Intergenic
1001202515 5:169731202-169731224 CTAAAGACCCTGATATGGTTTGG + Intronic
1003097309 6:3152697-3152719 GTCATTATTCTCATTTGGTTAGG - Exonic
1003722023 6:8714395-8714417 ATGAATAATCTGCTTTGGTTTGG - Intergenic
1003946540 6:11081049-11081071 CTCAACTCTGTGATATGGTTTGG - Intergenic
1004606298 6:17197961-17197983 CACAATTCTCTGGTTTGGTGAGG - Intergenic
1006527386 6:34618626-34618648 GTCAATAATCTGATTTTGTCAGG + Intronic
1008195163 6:48509986-48510008 GGCAACACTCTGGTTTGGTTTGG - Intergenic
1008314297 6:50020736-50020758 CTTCATACTCTGAATTGCTTTGG - Intronic
1008721697 6:54361624-54361646 GTGACTACTCTGATATGGTTTGG - Intronic
1010383427 6:75249999-75250021 CACAATACAGTGATTAGGTTGGG + Intronic
1014912332 6:127109968-127109990 CTTGATTCTCTGATTTAGTTAGG - Intergenic
1016268255 6:142257500-142257522 ATCTATAGTCTGATTTGATTTGG - Intergenic
1017062726 6:150500573-150500595 CTTAAAACACTGATATGGTTTGG + Intergenic
1017292668 6:152758989-152759011 CACAATATTTTTATTTGGTTTGG - Exonic
1017896795 6:158686935-158686957 CTCAATTCTCTGATGTGTTCCGG + Intronic
1019953977 7:4398386-4398408 CTCAAAAATCTGATTTAGTGAGG - Intergenic
1022009417 7:26295789-26295811 CACTTTACTCTGATTTGGTATGG + Intronic
1023149773 7:37191341-37191363 CTAACTACTTTGATTTAGTTGGG - Intronic
1023645157 7:42304251-42304273 GTCAATACACAGATATGGTTGGG - Intergenic
1026423437 7:70264958-70264980 CTCAATACTCTGATAAGATGTGG + Intronic
1030433061 7:109477425-109477447 CTCAAAATTTTCATTTGGTTAGG + Intergenic
1030804199 7:113894066-113894088 CTTAATTCTCTGATTGGATTGGG + Intronic
1031541646 7:123002413-123002435 CTCTATATTCTGATTTGTCTGGG + Intergenic
1031794515 7:126154731-126154753 GTCAATACTCTCATATGATTTGG - Intergenic
1031938723 7:127764546-127764568 GTCAAAGTTCTGATTTGGTTTGG - Intronic
1039305951 8:36263273-36263295 GTAAATGCTCTGATATGGTTTGG + Intergenic
1039943536 8:42111097-42111119 GTCAATACACTGATATGGTTTGG - Intergenic
1040004172 8:42604485-42604507 TTCTATACTCTCATTTGCTTAGG + Intergenic
1040870861 8:52099390-52099412 CTCAAACACCTGATTTGGTTAGG - Intergenic
1043370185 8:79582697-79582719 ATGAATACACTGATATGGTTTGG + Intergenic
1043678260 8:82988908-82988930 ATAAATACTGTGATATGGTTTGG + Intergenic
1045642780 8:104270262-104270284 GTATATACTCTGATATGGTTTGG - Intergenic
1046159290 8:110338972-110338994 ATTAACAGTCTGATTTGGTTTGG - Intergenic
1047430060 8:124783321-124783343 CTCATTATTCTGGTTTGGTGGGG - Intergenic
1049567591 8:143349235-143349257 CCCTCGACTCTGATTTGGTTGGG - Intronic
1052064975 9:24007118-24007140 CTCAATGGTCTGACTTGTTTTGG - Intergenic
1052219712 9:26005140-26005162 CTCATTAGACTGATGTGGTTTGG + Intergenic
1052772500 9:32702748-32702770 CTCAAAACTCAGATTTGGAAAGG + Intergenic
1056427233 9:86489400-86489422 CAAAATAATCTAATTTGGTTAGG - Intergenic
1058907377 9:109492658-109492680 CTCTCAACTCTGATTTAGTTGGG - Intronic
1203574506 Un_KI270744v1:164548-164570 CAAAATACTCTGTTTTGGTTTGG + Intergenic
1186334053 X:8567415-8567437 CTCAGTACTATGATTTATTTTGG + Intronic
1186980285 X:14951217-14951239 CCCTAGGCTCTGATTTGGTTTGG + Intergenic
1188943485 X:36266995-36267017 CTCAATATTCTGATCTGTCTTGG + Intronic
1189377724 X:40478736-40478758 CCCACTGCTCTGATTTGGGTGGG - Intergenic
1192713734 X:73617827-73617849 TTTAACACTCTGATATGGTTTGG - Intronic
1194748994 X:97663306-97663328 TGCAATACATTGATTTGGTTTGG - Intergenic
1196399842 X:115302920-115302942 CTCAATTGTCTGCTTTGTTTGGG - Intronic
1196979090 X:121191827-121191849 CTCAGTTCTCTGCTTTGGTCAGG + Intergenic
1199479662 X:148284207-148284229 ATCTTTACTTTGATTTGGTTGGG + Intergenic