ID: 1102346968

View in Genome Browser
Species Human (GRCh38)
Location 12:112166790-112166812
Sequence CTGAGTGAACGGAAGGACTG TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 158
Summary {0: 1, 1: 0, 2: 1, 3: 12, 4: 144}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1102346957_1102346968 19 Left 1102346957 12:112166748-112166770 CCAGAGCCTGGCTGGCCCGTGAC 0: 1
1: 0
2: 2
3: 23
4: 197
Right 1102346968 12:112166790-112166812 CTGAGTGAACGGAAGGACTGTGG 0: 1
1: 0
2: 1
3: 12
4: 144
1102346962_1102346968 3 Left 1102346962 12:112166764-112166786 CCGTGACTGGGCCTCAGTGACGG 0: 1
1: 0
2: 0
3: 6
4: 132
Right 1102346968 12:112166790-112166812 CTGAGTGAACGGAAGGACTGTGG 0: 1
1: 0
2: 1
3: 12
4: 144
1102346960_1102346968 13 Left 1102346960 12:112166754-112166776 CCTGGCTGGCCCGTGACTGGGCC 0: 1
1: 0
2: 2
3: 21
4: 216
Right 1102346968 12:112166790-112166812 CTGAGTGAACGGAAGGACTGTGG 0: 1
1: 0
2: 1
3: 12
4: 144
1102346961_1102346968 4 Left 1102346961 12:112166763-112166785 CCCGTGACTGGGCCTCAGTGACG 0: 1
1: 0
2: 0
3: 12
4: 108
Right 1102346968 12:112166790-112166812 CTGAGTGAACGGAAGGACTGTGG 0: 1
1: 0
2: 1
3: 12
4: 144
1102346964_1102346968 -8 Left 1102346964 12:112166775-112166797 CCTCAGTGACGGCCACTGAGTGA 0: 1
1: 0
2: 0
3: 5
4: 116
Right 1102346968 12:112166790-112166812 CTGAGTGAACGGAAGGACTGTGG 0: 1
1: 0
2: 1
3: 12
4: 144
1102346956_1102346968 20 Left 1102346956 12:112166747-112166769 CCCAGAGCCTGGCTGGCCCGTGA 0: 1
1: 0
2: 2
3: 18
4: 186
Right 1102346968 12:112166790-112166812 CTGAGTGAACGGAAGGACTGTGG 0: 1
1: 0
2: 1
3: 12
4: 144

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1102346968 Original CRISPR CTGAGTGAACGGAAGGACTG TGG Intronic
902316785 1:15626505-15626527 CTAGGTGACGGGAAGGACTGTGG + Intronic
902974340 1:20078157-20078179 ATGAGTGCCCTGAAGGACTGAGG + Intronic
906105682 1:43290737-43290759 CTGAGTGAACAGCAGGAAGGGGG + Intergenic
907394286 1:54178514-54178536 CTGAGTGAGCGGAGGGGATGTGG + Intronic
907436227 1:54450141-54450163 CTGAGTTAAGGTAGGGACTGTGG - Intergenic
912958975 1:114178247-114178269 CTGAGTGAACGATAGGAAAGAGG - Intergenic
914684504 1:149966332-149966354 CTGAGTGGAGGGAAGGAATCAGG - Intronic
915320438 1:155053135-155053157 CTGAGTCAGAGGAAGGGCTGGGG + Intronic
915493383 1:156264370-156264392 CTGAGTGAATGGCAGAAATGAGG - Intronic
923575801 1:235157991-235158013 TAGACTGAAGGGAAGGACTGTGG + Intronic
923928276 1:238661132-238661154 CTGTGTGAACAGAACCACTGTGG - Intergenic
1063381053 10:5586286-5586308 CAGAGTGAAAGGCAGCACTGTGG - Intergenic
1064332206 10:14404455-14404477 CTGTGTGAAGGGTAGGACTGCGG - Intronic
1067471775 10:46543000-46543022 CTGGGTGAATGGAAGGACTTTGG - Intergenic
1070757473 10:79002378-79002400 CTGAGAGATAGGGAGGACTGGGG - Intergenic
1075045205 10:119140990-119141012 CTGAGGGAACGGTTGGAGTGGGG - Exonic
1075635229 10:124026131-124026153 CTGAGGGTAGGGGAGGACTGGGG + Intronic
1075676132 10:124296814-124296836 CTGAGAGGACTCAAGGACTGGGG + Intergenic
1076463171 10:130660224-130660246 CTGAGTGCATGAAAGCACTGAGG + Intergenic
1076473432 10:130736058-130736080 CTGAGTGTATGGAGGGGCTGTGG + Intergenic
1077051020 11:566987-567009 CTGAGTGATCTGAAGCACTCTGG - Intergenic
1079111580 11:17608056-17608078 CTGAGGACAGGGAAGGACTGAGG - Intronic
1082774866 11:57237131-57237153 CTGAGTGCTGGGAAGGACTCTGG - Exonic
1083836267 11:65270568-65270590 CTGAGTCAATGGAAGAACGGAGG - Intronic
1090240642 11:125179103-125179125 CTCAATGAACAGAAGGCCTGAGG + Intronic
1091182914 11:133623064-133623086 CTGAGTGAACGAATGAACAGAGG + Intergenic
1091216806 11:133907232-133907254 CTGGGTGAAAGGAAGGACCAGGG + Intergenic
1092265126 12:6975029-6975051 ATGACTGGACAGAAGGACTGTGG + Intronic
1092841479 12:12546490-12546512 CGGAGGTAATGGAAGGACTGAGG - Intronic
1094475385 12:30836795-30836817 ATGAGTGAACGGTAGGAAGGTGG - Intergenic
1094484690 12:30915129-30915151 CTGAATGAAAGGAAGGAGTAAGG + Intergenic
1095357416 12:41292179-41292201 TGCAGTGAACAGAAGGACTGAGG + Intronic
1095859854 12:46904983-46905005 CTGAGTGCTCGGAAGAACCGGGG - Intergenic
1097190777 12:57218397-57218419 CTTAGTGAACTGGAGGAGTGGGG + Intronic
1100236450 12:92666550-92666572 CTGAGAGAAGGGAGGGACTGGGG - Intergenic
1100932741 12:99629192-99629214 CTGAGTGAATGGATGGTCTATGG - Intronic
1102051225 12:109863499-109863521 ATGAGTGAATGAATGGACTGTGG + Intronic
1102346968 12:112166790-112166812 CTGAGTGAACGGAAGGACTGTGG + Intronic
1103889385 12:124227378-124227400 CTGGGGGAAGGGAAGGAATGAGG + Intronic
1104159978 12:126168664-126168686 CTGAGAGAAGGGAAGGAATGAGG + Intergenic
1104442996 12:128810612-128810634 CTGAGTCACTGGCAGGACTGAGG + Intronic
1106369360 13:29116706-29116728 CTCAGTGATCAGATGGACTGTGG - Intronic
1107557226 13:41527378-41527400 CTGAGGGAAAGGGAGGACTCAGG - Intergenic
1107979766 13:45723431-45723453 ATGAGAGAAAGAAAGGACTGAGG - Intergenic
1110862860 13:80362720-80362742 CTGAGTGACAGGAATGAATGAGG + Intergenic
1114686264 14:24534661-24534683 CTGATTGAAGAGAAGGACTGCGG + Intergenic
1117554240 14:56868247-56868269 TTCAGTGAAGGGAAGGACTGGGG - Intergenic
1121071940 14:91031657-91031679 CTAAGTGAATGAAAAGACTGGGG + Intronic
1122423327 14:101590887-101590909 GTGTGTGGACGGCAGGACTGAGG + Intergenic
1122919397 14:104873864-104873886 CTCAGAGAAAGGAAGCACTGAGG - Intronic
1126254061 15:46604136-46604158 ATGAGTGAACAGAAGAGCTGAGG - Intergenic
1128575282 15:68770107-68770129 CAGAGTGAACTGAATGCCTGTGG + Intergenic
1133889862 16:9868698-9868720 CAGAGGGAAGGGAAGGCCTGGGG - Intronic
1136957795 16:34804429-34804451 GTGAGGGAACCGAAGGCCTGAGG + Intergenic
1143017081 17:3896632-3896654 CTGTCTGAACAGAAGGTCTGGGG - Exonic
1143218795 17:5244444-5244466 CTGAGTGATGGGAAGTACTAAGG + Intergenic
1144780219 17:17804379-17804401 ATGAGTGAGAGGAAGGACCGGGG - Intronic
1145043728 17:19595987-19596009 CTGAGTGAATGCAATGACAGTGG - Intergenic
1145875797 17:28317697-28317719 CGGAGGGAATGGAAGGATTGGGG - Intergenic
1146703601 17:34983033-34983055 CTGAGTGCACGGAGGGTTTGTGG - Exonic
1147660516 17:42114605-42114627 CTGAGGGAAGGAAGGGACTGAGG + Intronic
1148566424 17:48635613-48635635 CTGGGAGGACGGCAGGACTGAGG + Intergenic
1148675304 17:49441476-49441498 CTAAGTGAAAGCAGGGACTGTGG + Intronic
1150465408 17:65388490-65388512 CTGTGTGAACAGAAGGATAGTGG - Intergenic
1151369108 17:73636258-73636280 CAGAGTGATAGGGAGGACTGAGG + Intronic
1151430605 17:74060008-74060030 CTGAGTGGATGAATGGACTGAGG + Intergenic
1151747394 17:76018777-76018799 CTGAGTCAAGGGAAGGAGTAGGG + Intronic
1151772032 17:76170008-76170030 CTGAGTGCACAGCAGGACTTGGG + Intronic
1153693082 18:7613256-7613278 CTGAGAGAAGAGAATGACTGGGG - Intronic
1153812713 18:8765894-8765916 CTGAGTGGACAGAAGGAAAGAGG - Intronic
1156450872 18:37265967-37265989 CTGAGTGAGCAGAGGGCCTGGGG - Intronic
1157439307 18:47697776-47697798 CTGAGGGAACGTGAGGGCTGAGG - Intergenic
1158227106 18:55212901-55212923 CTGAGTGAAGAGAAGGCCAGAGG - Intergenic
1161527696 19:4767379-4767401 CTGAGTGATCTGAAGGCCTCAGG - Intergenic
1162943867 19:14030986-14031008 TTGAGTGGATGGCAGGACTGGGG - Exonic
1165034642 19:33023923-33023945 CAGAGTGAACCGAAGGTCTCTGG - Intronic
1165101586 19:33441580-33441602 CTGAGTGAAGGGAAGGAACAGGG - Intronic
1165895064 19:39136463-39136485 CTGACTGAACAGAAGGAAGGAGG - Intronic
1167502369 19:49855326-49855348 GTGAGTGCAGGGAGGGACTGGGG + Intronic
925597581 2:5571151-5571173 CTGAGTGAACGGAGGGAAAGAGG - Intergenic
925640269 2:5980583-5980605 CTGAGTGAATGGAAGCAGAGTGG - Intergenic
927426906 2:22991156-22991178 CAAAGTAAACGGAAAGACTGAGG + Intergenic
930458255 2:51634404-51634426 CTTAGGGAAGGGAAGTACTGTGG - Intergenic
931442200 2:62298016-62298038 CTGATTGATCAGAAGTACTGGGG + Intergenic
934600725 2:95655950-95655972 CTGTGAGAAAGGAAGGAATGGGG - Intergenic
936534096 2:113298090-113298112 CTGTGGGAAAGGAAGGAATGGGG - Intergenic
938294138 2:130166819-130166841 CTGAATCAATGGAAGGCCTGTGG + Intronic
938462509 2:131507062-131507084 CTGAATCAATGGAAGGCCTGTGG - Intergenic
940839115 2:158558933-158558955 CTGAGTGAATGGGAGGACTTTGG + Intronic
943193784 2:184717426-184717448 CTGGGTAAAGGGAAGCACTGAGG - Intronic
944073051 2:195694942-195694964 CTGAGTGAAAGAAAGAAATGGGG + Intronic
945678320 2:212882122-212882144 CAAAGTGACTGGAAGGACTGTGG + Intergenic
947066699 2:226234848-226234870 CTGAGTGTACTGAGAGACTGGGG + Intergenic
1168844991 20:938268-938290 ATGAGTGAAAGGAAGGAGAGAGG + Intergenic
1170084268 20:12511723-12511745 CTGAGTGAAGAGAAGTAATGAGG - Intergenic
1172578835 20:36030839-36030861 CTGAGTGAATGGATGGTCAGAGG + Intergenic
1173176775 20:40770902-40770924 GTGAGGGAAGGGAAGGGCTGTGG - Intergenic
1173231978 20:41205549-41205571 GTGTGTGAACGGAAGGGGTGGGG + Intronic
1179263151 21:39776562-39776584 CTGAGTCAAGGGAGAGACTGAGG - Intronic
1181113444 22:20615904-20615926 CTGAATCAACAGAAGGCCTGTGG + Intergenic
1183811163 22:40258875-40258897 CAGAGTGACCTGCAGGACTGAGG - Intronic
1184097305 22:42323455-42323477 CTGAGGGAACAGGAGGACGGTGG + Intronic
1184775188 22:46619637-46619659 CAGAGTGAACAGGAGGACCGGGG - Intronic
1184946590 22:47808367-47808389 GTGAGAGAACGCAAGGATTGTGG - Intergenic
1185276140 22:49950912-49950934 CTGAGTGGGCGAATGGACTGTGG - Intergenic
951402687 3:22253113-22253135 CTGAGGGAATGGATAGACTGTGG + Intronic
952916627 3:38250818-38250840 CAGAGGGAACAGGAGGACTGCGG - Intronic
954966703 3:54617860-54617882 CTCAGTGAAGGGAGGGACAGGGG - Intronic
955559656 3:60174978-60175000 CTGTGTGAACGAAAGGATAGGGG + Intronic
967725722 3:192860703-192860725 TTGAGAAAACGCAAGGACTGGGG + Intronic
969545560 4:7824748-7824770 CTGAGGGAACGGGAGGAAGGGGG + Intronic
969834466 4:9828931-9828953 GTGAGTGGATGGATGGACTGAGG + Intronic
985356494 4:189125187-189125209 CTGAGTGGATGGAAGAGCTGAGG + Intergenic
988033401 5:25795921-25795943 CTGGATAAAAGGAAGGACTGAGG + Intergenic
988907974 5:35809536-35809558 CTGGGTGAAGGCAAGGTCTGGGG + Intronic
990193304 5:53286349-53286371 ATGAGTGCACAGAAGAACTGAGG - Intergenic
994151721 5:96455657-96455679 CTGAGGGAACGGCAGGACTGAGG - Intergenic
995134202 5:108662587-108662609 CTTAGTGAATGAAAGCACTGAGG - Intergenic
995867801 5:116710220-116710242 CTGAGAGAAGGGAATGAATGAGG + Intergenic
996595135 5:125192249-125192271 CTGAGTGAAGTGGAGCACTGAGG + Intergenic
997646412 5:135484953-135484975 CTGAGTGAAGGGAAGCCCAGAGG - Intergenic
1001120080 5:168972878-168972900 CTGGGGGGACGGAAGGACTGGGG - Intronic
1006053223 6:31359472-31359494 TTGAGTGAAGGGAAGGGGTGAGG - Intergenic
1007782255 6:44261168-44261190 CAGAGTGAGAGGAAGGAATGTGG - Intronic
1011399961 6:86949933-86949955 CTGAGTGAACGTATTTACTGGGG + Intronic
1017978082 6:159375404-159375426 CTCGGTGAACCGTAGGACTGGGG - Intergenic
1019029629 6:168999299-168999321 CTGAATGAACCAAAGGTCTGAGG + Intergenic
1019921626 7:4166970-4166992 TTGAGTGGAGGGAAGGCCTGGGG - Intronic
1023681362 7:42690985-42691007 GTGAGTGACCAGAAGGACTGGGG + Intergenic
1027047643 7:75001665-75001687 CTGAGCGAAAGGATGGACTGTGG - Intronic
1027677127 7:81173842-81173864 CTGAGTAAATGGCTGGACTGAGG + Intergenic
1027787191 7:82594998-82595020 CAGACTGAAGGGTAGGACTGTGG + Intergenic
1028053910 7:86220300-86220322 CTGAGTTCACCCAAGGACTGTGG + Intergenic
1029385350 7:100239974-100239996 CTGAGCGAAAGGATGGCCTGTGG + Intronic
1030716315 7:112811837-112811859 CTGAATGAAGAGAAGGAATGGGG + Intergenic
1030799738 7:113835193-113835215 CTGATAGAATGGAAGGAATGAGG - Intergenic
1033360422 7:140635453-140635475 CGCAGTGTACGGAAGGCCTGGGG + Intronic
1036105052 8:5829629-5829651 CTGCCTGAGAGGAAGGACTGGGG + Intergenic
1041527594 8:58824448-58824470 CTGAGTGAATGGAGAGAGTGTGG - Intronic
1041567846 8:59300717-59300739 CTCAGTGAATTGAAGGATTGAGG - Intergenic
1042464810 8:69116250-69116272 AGGAATGAAAGGAAGGACTGTGG + Intergenic
1049001949 8:139831882-139831904 CGGAGTGGGCGGAAGCACTGTGG - Intronic
1049424714 8:142532939-142532961 CTGAGTGGACCCAAGGACTCAGG - Intronic
1049531497 8:143157826-143157848 CTGAGGGAGCGGAGGGGCTGGGG - Intergenic
1049785781 8:144450042-144450064 CTGACTGCACAGAAGGGCTGGGG + Exonic
1053123227 9:35561104-35561126 CTGGGGAAACGGAAGGGCTGAGG + Intronic
1055890434 9:81117965-81117987 CTGAGTTAAGGGAAGGACAATGG - Intergenic
1056762230 9:89423915-89423937 CTGAGGGAAGGGAGGTACTGAGG - Intronic
1057450813 9:95157930-95157952 CTGAGTGGGTGGAAAGACTGTGG - Intronic
1062170336 9:135131368-135131390 CAAAGTGAGAGGAAGGACTGAGG + Intergenic
1203786957 EBV:133485-133507 CCGAGTGAACGGCTGGGCTGGGG - Intergenic
1185450015 X:276826-276848 GTGAATCAACGGAAGGACAGGGG - Intronic
1185569716 X:1124194-1124216 CGGAGTGAGCAGAAGGACAGAGG + Intergenic
1185830847 X:3301606-3301628 CAGAGGGAAAGGAAGGGCTGAGG - Intergenic
1186758944 X:12702808-12702830 AGGAGTGAACTGAAGGCCTGAGG - Intronic
1187495846 X:19794845-19794867 CTGAATGAATGGAAGGAGTAAGG - Intronic
1189244557 X:39553533-39553555 TTGAATGAACGGAAAGACTGTGG - Intergenic
1199863860 X:151825634-151825656 CTGGGTGCAAGTAAGGACTGAGG + Intergenic