ID: 1102349961

View in Genome Browser
Species Human (GRCh38)
Location 12:112184798-112184820
Sequence CGCCGATGCCTGCCAGGCCC TGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 243
Summary {0: 1, 1: 0, 2: 3, 3: 19, 4: 220}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1102349961_1102349972 25 Left 1102349961 12:112184798-112184820 CCAGGGCCTGGCAGGCATCGGCG 0: 1
1: 0
2: 3
3: 19
4: 220
Right 1102349972 12:112184846-112184868 CCTGTGGGTCCTTCCTGGTGAGG 0: 1
1: 0
2: 4
3: 29
4: 278
1102349961_1102349968 20 Left 1102349961 12:112184798-112184820 CCAGGGCCTGGCAGGCATCGGCG 0: 1
1: 0
2: 3
3: 19
4: 220
Right 1102349968 12:112184841-112184863 CAGCCCCTGTGGGTCCTTCCTGG 0: 1
1: 0
2: 4
3: 40
4: 289
1102349961_1102349965 10 Left 1102349961 12:112184798-112184820 CCAGGGCCTGGCAGGCATCGGCG 0: 1
1: 0
2: 3
3: 19
4: 220
Right 1102349965 12:112184831-112184853 TCGTCACGCCCAGCCCCTGTGGG 0: 1
1: 0
2: 1
3: 6
4: 79
1102349961_1102349973 28 Left 1102349961 12:112184798-112184820 CCAGGGCCTGGCAGGCATCGGCG 0: 1
1: 0
2: 3
3: 19
4: 220
Right 1102349973 12:112184849-112184871 GTGGGTCCTTCCTGGTGAGGTGG 0: 1
1: 0
2: 0
3: 23
4: 263
1102349961_1102349964 9 Left 1102349961 12:112184798-112184820 CCAGGGCCTGGCAGGCATCGGCG 0: 1
1: 0
2: 3
3: 19
4: 220
Right 1102349964 12:112184830-112184852 CTCGTCACGCCCAGCCCCTGTGG 0: 1
1: 0
2: 2
3: 15
4: 137

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1102349961 Original CRISPR CGCCGATGCCTGCCAGGCCC TGG (reversed) Exonic
900198022 1:1387235-1387257 CTCCGATGCCTGCTGTGCCCAGG + Exonic
900400935 1:2472624-2472646 GGCCAATGCCAGCCGGGCCCAGG + Intronic
902224282 1:14986980-14987002 CTCCGATGCATGCCAGGCCAGGG + Intronic
903295939 1:22343071-22343093 TGCGGGTGCCTGCAAGGCCCAGG - Intergenic
903661825 1:24983143-24983165 GGCAGATGCCTTCCAGGCCGAGG + Intergenic
904465205 1:30703631-30703653 CACCAAAGCCTGCCTGGCCCGGG + Intergenic
904494827 1:30880636-30880658 CGCCCATGCCTGCAGGTCCCAGG - Intronic
906534835 1:46545692-46545714 CCCCGATGCCTGGCAGGGCCAGG - Intronic
910913090 1:92258740-92258762 CCCCGAACCCTGACAGGCCCCGG - Intronic
912100730 1:106201374-106201396 GGGGGATGCCTGCCAGGGCCAGG - Intergenic
912941901 1:114052569-114052591 GGACGCTGCCTGCCAGGCCAAGG - Intergenic
915489709 1:156244266-156244288 CCACTGTGCCTGCCAGGCCCAGG + Exonic
916561178 1:165935108-165935130 TGCAGACGCCTGCCAGACCCAGG - Intergenic
917367955 1:174254491-174254513 CCCCGAACCCTGACAGGCCCCGG + Intronic
919989267 1:202697941-202697963 TGCTGATAGCTGCCAGGCCCAGG + Intronic
920106336 1:203556105-203556127 GGCAGATGCCTGCCAGGGCCAGG - Intergenic
920338209 1:205258973-205258995 CACCCAGGCCTGCCAGCCCCGGG + Intronic
921189766 1:212699386-212699408 CGCCGACGCCTGGCTGGGCCGGG - Intronic
923126993 1:231040994-231041016 CACCGATCCCTGCCCTGCCCAGG + Intergenic
923273658 1:232378904-232378926 CGCCCCTCCCTACCAGGCCCTGG - Intergenic
923458513 1:234187160-234187182 AGCTGCTGCCTGCCAGCCCCAGG + Intronic
1064651862 10:17517406-17517428 CGCCGCTGCATGCCAGCACCTGG + Intergenic
1064968406 10:21038367-21038389 CACCGAGGCCTGCCAGGGGCTGG - Intronic
1067436940 10:46284919-46284941 CGCCGAGACCCGGCAGGCCCAGG - Intergenic
1069708578 10:70474846-70474868 CTCCCTTCCCTGCCAGGCCCTGG - Intergenic
1071966615 10:90858165-90858187 CGGCGGTGCCTGCCCAGCCCGGG - Intergenic
1072705162 10:97675739-97675761 CACTCTTGCCTGCCAGGCCCAGG - Exonic
1073103972 10:101021875-101021897 CACCGTTGGCTGCCAGGACCTGG + Exonic
1073292906 10:102422062-102422084 CGCTGATCGCTGCCCGGCCCTGG + Exonic
1073424338 10:103447193-103447215 CGCCGTTGCCTGCCAGACCCTGG + Exonic
1074787009 10:116849995-116850017 CGAGGAAGCCTGCCAGCCCCTGG - Intronic
1075616005 10:123891462-123891484 CGCCGCTGCCTGCGGGGCCCGGG - Exonic
1075657752 10:124173360-124173382 TGCAGCTGCCTGCCTGGCCCAGG - Intergenic
1076035844 10:127197438-127197460 CTCTGATGCCTGTCAGGCCCTGG + Intronic
1076539705 10:131206364-131206386 TGCCCAGGCCTCCCAGGCCCTGG + Intronic
1077495918 11:2886344-2886366 CGCCGCTGCCAGCTCGGCCCTGG + Intergenic
1078322164 11:10345996-10346018 CCCCGACCCCTGACAGGCCCGGG - Intronic
1081878626 11:46428834-46428856 GGCCGAGGCCTGCCAGTCTCTGG + Intronic
1083203039 11:61131826-61131848 CGCCGGGGCCTGCCTGGCCTGGG - Exonic
1083625103 11:64068333-64068355 CAGTGATGCCTACCAGGCCCTGG + Intronic
1083697370 11:64451860-64451882 AGCCCACCCCTGCCAGGCCCGGG - Intergenic
1084793840 11:71491240-71491262 TGCCGATGCTTGGCAGGCCGAGG + Intronic
1087837232 11:102887238-102887260 AGCCAGTGCCAGCCAGGCCCTGG - Intergenic
1089494538 11:118901639-118901661 TGCCACTGCCTGCCATGCCCAGG + Exonic
1089852684 11:121514163-121514185 CGCAGATGCCTCCGAGGACCAGG + Exonic
1090486836 11:127120710-127120732 CCACCATGCCTGCCATGCCCTGG + Intergenic
1094045858 12:26166109-26166131 CCCCAATCCCTGACAGGCCCTGG - Intronic
1096037816 12:48488238-48488260 GGCCGAGGCCTGCCAGTCTCTGG - Intronic
1096196287 12:49650872-49650894 CACCTATTCCTGCCAGGACCTGG - Exonic
1097361791 12:58666324-58666346 CCCCGATCCCTGACAGGCCCCGG - Intronic
1098450161 12:70610237-70610259 CGCCGATACCTTCCCGGCCAGGG + Intronic
1102349961 12:112184798-112184820 CGCCGATGCCTGCCAGGCCCTGG - Exonic
1102375748 12:112419364-112419386 CGGGGATGCCCGTCAGGCCCGGG + Intronic
1104448837 12:128853526-128853548 CGCCGCCGCCGACCAGGCCCCGG - Exonic
1104969528 12:132525005-132525027 CGCCGATGCGTGCCAGGGCCTGG - Intronic
1106604459 13:31214618-31214640 CTCTGTTGCCTGCCAGGCTCTGG + Intronic
1109290396 13:60467140-60467162 CCCCACTGCCTGACAGGCCCCGG + Intronic
1110318180 13:74134257-74134279 CGCCGCTGCCGGCGAGCCCCGGG + Intergenic
1114473321 14:22978386-22978408 GAGCAATGCCTGCCAGGCCCTGG - Exonic
1121325546 14:93017635-93017657 CGCCGCTGCCTCCGAGGCACTGG - Intronic
1122273617 14:100579814-100579836 CGCCCCTGGCTGCCAGGCCCTGG + Intronic
1123016256 14:105377084-105377106 TGCGGCTGCCTGGCAGGCCCAGG + Intronic
1123069548 14:105635801-105635823 CGACGATGCCTGCCACGCATGGG - Intergenic
1123088644 14:105731585-105731607 CGACGATGCCTGCCATGCATGGG - Intergenic
1123880697 15:24675907-24675929 CGCCGGCCCCTGCCAGGGCCAGG + Exonic
1124237674 15:28004016-28004038 AGCCGCTGCCACCCAGGCCCTGG + Intronic
1127589055 15:60404757-60404779 GGCCGAGGCCTGCCAGTCTCTGG - Intergenic
1128544540 15:68558279-68558301 TGCCCCTGCCTGGCAGGCCCAGG + Intergenic
1130831971 15:87610161-87610183 ATCCCATGCCTGTCAGGCCCGGG + Intergenic
1132765184 16:1530931-1530953 GGCCCCTGCCTGCCAGGCCGAGG + Intronic
1132869642 16:2110126-2110148 TGCCGCTGCCGGCCAGGGCCGGG + Exonic
1132933927 16:2471697-2471719 CGGCCATGCCTGGCTGGCCCTGG + Exonic
1133156497 16:3880238-3880260 CGTCGCTGCCAGCCGGGCCCGGG - Exonic
1133280142 16:4660560-4660582 CGCGGATGCATTCCAGGCCTGGG + Intronic
1133774529 16:8886497-8886519 CGCCTGTCCCCGCCAGGCCCTGG - Intergenic
1134717775 16:16365473-16365495 TGCCGCTGCCGGCCAGGGCCGGG - Intergenic
1134956976 16:18386686-18386708 TGCCGCTGCCGGCCAGGGCCGGG + Intergenic
1135327837 16:21538598-21538620 GGCCGAGGCCTGCCAGTCCCTGG - Intergenic
1136338190 16:29624623-29624645 GGCCGAGGCCTGCCAGTCCCTGG - Intergenic
1136498837 16:30659697-30659719 CGCCGCCGCCCGCCAGGCCTTGG + Exonic
1136994621 16:35181346-35181368 ACCTGGTGCCTGCCAGGCCCTGG - Intergenic
1138688449 16:58746906-58746928 GGCCCAGTCCTGCCAGGCCCAGG - Intergenic
1140481712 16:75265851-75265873 CGCCGCTGCCCGCCAGGCCCCGG - Exonic
1140858995 16:79003014-79003036 CGCCAATGCATGCCAGCCACAGG + Intronic
1142040919 16:87893536-87893558 GGCCGAGGCCTGCCAGTCCCTGG - Intronic
1143105957 17:4530655-4530677 CCCCGATGCCCACCAGCCCCCGG - Exonic
1143490997 17:7285129-7285151 CACACATGCCCGCCAGGCCCAGG - Exonic
1147200315 17:38797339-38797361 CGCCTATGCATGTCAGGTCCTGG - Intronic
1147383726 17:40070217-40070239 CCCCCATGCCTGCCAGGCTGGGG + Intronic
1147978342 17:44260380-44260402 TGCCCCTGCCTGCCAGGGCCTGG - Intronic
1148456624 17:47814676-47814698 GGCAGATTCTTGCCAGGCCCTGG - Intronic
1148562540 17:48614211-48614233 CGCCCCGGCCTGCCAGGCCTTGG + Intronic
1149555236 17:57568906-57568928 CCCCGGTACCAGCCAGGCCCAGG - Intronic
1150112719 17:62516451-62516473 GGCCGAGGCCTGCCAGTCTCTGG + Intronic
1151213639 17:72562640-72562662 CGCCCATTCCTGCCTGGCCCCGG - Intergenic
1151569085 17:74917261-74917283 AGCGCATGCCTGCCAGGCCTGGG + Exonic
1151593968 17:75065512-75065534 AGGTGATGCCAGCCAGGCCCAGG + Exonic
1152565465 17:81098267-81098289 GGCCGCTGCCTCCCAGGCCCCGG - Intronic
1152756815 17:82090456-82090478 CGCCGACGGCTGCCTGTCCCAGG - Exonic
1158853969 18:61523899-61523921 CCCCGACCCCTGACAGGCCCTGG - Intronic
1159146359 18:64458693-64458715 CCCCGACCCCTGACAGGCCCCGG - Intergenic
1160793930 19:935158-935180 CCCCGAGCCCTGCCAGGACCTGG - Intronic
1163817978 19:19478726-19478748 AGCCTCTGCCTCCCAGGCCCAGG - Intronic
1164160773 19:22624134-22624156 CGCCCCTCCCTCCCAGGCCCAGG - Intergenic
1164624088 19:29715177-29715199 GCCCGGGGCCTGCCAGGCCCGGG - Intronic
1165317396 19:35065272-35065294 CCCAGCTGCCGGCCAGGCCCTGG + Exonic
1165355209 19:35299968-35299990 CCCCAATCCCTGCCTGGCCCTGG - Intronic
1166677421 19:44748488-44748510 CGCCGAGGCCTGGCTGCCCCAGG + Intronic
926216992 2:10912037-10912059 CGCCGCTGCCTGCGCGCCCCGGG + Exonic
926622597 2:15060499-15060521 CACCGATGCCTCCCAGGATCAGG - Intergenic
930022075 2:47007661-47007683 AGCCGAGGCAGGCCAGGCCCTGG + Intronic
931517776 2:63059785-63059807 CGCCGCGGCCCGGCAGGCCCTGG - Intergenic
931673023 2:64665866-64665888 GGCCGAGGCCTGCCAGCCTCTGG - Intronic
932416973 2:71579315-71579337 CTCCCCTCCCTGCCAGGCCCAGG - Intronic
932780605 2:74556332-74556354 CGCCGCTGCCCCTCAGGCCCTGG + Exonic
935195790 2:100815068-100815090 CCCTGATGACTGCCAAGCCCGGG - Intergenic
935313345 2:101806939-101806961 CGCCAGGGCCAGCCAGGCCCAGG - Intronic
936049860 2:109214494-109214516 AGCCCAAGCCAGCCAGGCCCTGG + Intronic
944615023 2:201451467-201451489 CGCCTGTCCCTGCCACGCCCGGG - Exonic
946413468 2:219527197-219527219 CACCCCTGCCTGCCTGGCCCAGG + Intronic
946431070 2:219627716-219627738 CTCCGGAGCCTGCGAGGCCCAGG - Exonic
948424741 2:237880072-237880094 AGCCCAGGCCTGCCAGCCCCTGG + Intronic
949021318 2:241742862-241742884 CCCTCATGCCTGCCACGCCCTGG - Intronic
949021394 2:241743102-241743124 CCCTCATGCCTGCCACGCCCTGG - Intronic
949023504 2:241754209-241754231 AGCCGATGCCCGCCAGACCATGG + Intronic
1168829792 20:839628-839650 GGCCGAGGCCTGCCAGTCTCTGG + Intronic
1169197747 20:3692569-3692591 CGCCTACTCTTGCCAGGCCCAGG - Exonic
1170289948 20:14757853-14757875 GGCCGAGGCCTGCCAGTCCCTGG - Intronic
1172116719 20:32577325-32577347 AGCAGGTGCCTGCCAGGCCTTGG + Intronic
1172277250 20:33686365-33686387 CGCCGCTGCCTGCAAAGTCCCGG + Exonic
1172598816 20:36169426-36169448 CGTTGCTGCCAGCCAGGCCCAGG - Intronic
1173725964 20:45298062-45298084 TGACGATGCCTGCAAGGCCGGGG + Exonic
1173871738 20:46346363-46346385 CGCCCATTCCTGCCAGCCTCCGG - Intronic
1174169873 20:48609597-48609619 CTTCTGTGCCTGCCAGGCCCTGG + Intergenic
1174302837 20:49594752-49594774 CTCCGCTTCCTGCCAGGACCAGG + Intergenic
1174427988 20:50446890-50446912 CTCCTATTCCTGCCAGGCCTGGG - Intergenic
1175184826 20:57173146-57173168 CCCCGCAGCCTGCCCGGCCCAGG + Intronic
1175913772 20:62416347-62416369 CCCTGCTGCCTGCCAGGCCCTGG - Intronic
1176086047 20:63296007-63296029 CGCCCCGGCCTGTCAGGCCCTGG - Intronic
1176382006 21:6118349-6118371 CGCGGCTGCCTGGCAGGCCCGGG - Exonic
1179438498 21:41377884-41377906 CGGCGATGGCTGGCAGGGCCAGG - Exonic
1179446558 21:41435932-41435954 CGGCGATGGCTGGCAGGGCCAGG - Exonic
1179741466 21:43419890-43419912 CGCGGCTGCCTGGCAGGCCCGGG + Exonic
1179792240 21:43762455-43762477 TGCCCCTGCCTGCCGGGCCCAGG + Intergenic
1181496031 22:23288028-23288050 CGCAAATGCCTGGTAGGCCCGGG - Intronic
1181652681 22:24269527-24269549 GACCGAGGCCTGCCAGTCCCTGG + Intergenic
1182159621 22:28108143-28108165 TGCCGTGGCCTACCAGGCCCTGG - Exonic
1182584961 22:31339701-31339723 GGGCCATGCCTGCCAGGTCCTGG + Intronic
1183455742 22:37922235-37922257 CGCAGATCCCTACCAAGCCCCGG + Exonic
1183905718 22:41038730-41038752 CATAGATGCCTGCCAGGACCAGG + Intergenic
1184131568 22:42519668-42519690 CGGCGATGCCTGACCGCCCCCGG + Intronic
1184497990 22:44854141-44854163 GGCCGCTTCCTGGCAGGCCCAGG - Intronic
1184563304 22:45275893-45275915 AGCCGAGGCCTGCCAGTCTCTGG - Intergenic
1185088231 22:48752253-48752275 AGCCGATGCCTGCCACACTCAGG - Intronic
953025695 3:39143683-39143705 CACCCAGGCCTGCCTGGCCCTGG - Exonic
953879617 3:46684869-46684891 AGCAGCTTCCTGCCAGGCCCCGG + Intronic
953912917 3:46901867-46901889 CCACCATGCCTGCCATGCCCTGG + Intronic
954574135 3:51665749-51665771 CACTGATGCCTCTCAGGCCCTGG + Exonic
954633867 3:52061088-52061110 AGCAGGGGCCTGCCAGGCCCTGG + Intergenic
961474010 3:127135870-127135892 CGCCGGTGCGTGGCAGGGCCGGG - Intergenic
961644157 3:128383646-128383668 GGCTGATGCCTTCCAGGCCAGGG - Intronic
961650831 3:128415968-128415990 AGCCCAAGCCTGCCAGGTCCTGG + Intergenic
963397963 3:144757288-144757310 CGGAGTTGCCTGCCAGTCCCTGG - Intergenic
965475442 3:169149549-169149571 CGCCTCTGCCCGCCAGGCGCCGG + Intronic
968775029 4:2535615-2535637 CGCAGATGTCTGCAAGGCCGCGG + Intronic
969105978 4:4807340-4807362 AGCCGATGCCAGCCCAGCCCTGG - Intergenic
969492742 4:7509383-7509405 CCCCTATGACTGCCTGGCCCAGG - Intronic
977111684 4:92964377-92964399 CCCCTATGCCTGACAGGGCCCGG - Intronic
978600537 4:110422769-110422791 CCCCGATCCATGCCAGGCCCTGG - Intronic
979554431 4:122028840-122028862 CCCCGACCCCTGACAGGCCCTGG + Intergenic
985812957 5:2103584-2103606 AGCCCAGGCCGGCCAGGCCCCGG - Intergenic
986784141 5:11096318-11096340 CCCCCACCCCTGCCAGGCCCCGG + Intronic
987553069 5:19409135-19409157 CCCCGACCCCTGACAGGCCCTGG - Intergenic
988482032 5:31639178-31639200 CGCCGGTGCGTGCCGGCCCCGGG + Intergenic
989012163 5:36885409-36885431 CTCCCATTCCTGCCAGACCCTGG - Intronic
989314902 5:40066853-40066875 CTCCCATTCCTGCCAGACCCCGG - Intergenic
994140958 5:96340574-96340596 CTCCGTTGACTGCCAGGTCCCGG + Intergenic
994351210 5:98748611-98748633 CCCCCATGCCTGACAGGCCCTGG - Intergenic
995106210 5:108380938-108380960 CGCCGGCTGCTGCCAGGCCCCGG - Exonic
1001748022 5:174107162-174107184 GGCTGCTGCGTGCCAGGCCCAGG + Intronic
1003602905 6:7534381-7534403 AGCCGCTGCCTCCCAGGCTCAGG + Intergenic
1005749604 6:28870655-28870677 CGCCAATATCTGCTAGGCCCTGG - Intergenic
1006458925 6:34146777-34146799 GGCCGAGTCCTGCCAGGCCTGGG - Intronic
1006496067 6:34424674-34424696 GGCCGAGGCCTGCCAGTCTCTGG + Exonic
1006512624 6:34529845-34529867 CCTCGGTGCCTGCCATGCCCAGG - Intronic
1006541603 6:34744470-34744492 GGCCGAGGCCTGCCAGTCTCTGG - Intergenic
1007430758 6:41775418-41775440 CGCCGATGTCAGACAGGCCAGGG - Exonic
1007519433 6:42440056-42440078 CCCCCATCCCTGCCAGGCCACGG - Intronic
1007848274 6:44779282-44779304 CACCCATGCCTGCCTTGCCCTGG + Intergenic
1008785690 6:55164611-55164633 CCCCACTGCCTGACAGGCCCTGG - Intronic
1011716536 6:90111452-90111474 GGCCCAAGCCTGCAAGGCCCTGG + Intronic
1015301105 6:131653918-131653940 CTCCGCTGACTGCCAGGGCCTGG + Intronic
1015880104 6:137863826-137863848 GGCCCATGACTGCCATGCCCTGG + Intergenic
1017672440 6:156779378-156779400 CGCCGCTGCCAGCCCGGCCTGGG + Exonic
1018669385 6:166167002-166167024 CCCCGAGCCCTGCCAGGTCCAGG + Intronic
1018956541 6:168413948-168413970 AGCCGATCCCTGCCAGACCGGGG - Intergenic
1019216733 6:170448579-170448601 GGCCCACGCCTGCCAGGGCCTGG - Intergenic
1019538007 7:1538848-1538870 CGCACCTGGCTGCCAGGCCCTGG + Intronic
1019954721 7:4404614-4404636 TGCAGGTGCCAGCCAGGCCCTGG - Intergenic
1019985498 7:4652457-4652479 CGCCCATGGCTGCCAGGAGCTGG - Intergenic
1020099953 7:5389064-5389086 CGCCGAGGGCCGCCAGGACCGGG - Exonic
1020275527 7:6622371-6622393 CCGCGCTGCCTGCCGGGCCCGGG - Exonic
1022355554 7:29611237-29611259 CGCAGCTGCCAACCAGGCCCTGG + Intergenic
1023169395 7:37375817-37375839 GGCCGAGGCCTGCCAGTCTCTGG - Intronic
1026034316 7:66820111-66820133 CCTGGATGCCTGCCAGGTCCTGG - Intergenic
1026592894 7:71712068-71712090 GGTCGATGCCAGCCAGGCCCCGG - Exonic
1026985283 7:74551409-74551431 CCTGGATGCCTGCCAGGTCCCGG + Intronic
1027188346 7:75984615-75984637 CTCTGATGCCTCCCTGGCCCTGG - Intronic
1027843899 7:83347575-83347597 CCCCGACCCCTGACAGGCCCCGG - Intergenic
1031008423 7:116499656-116499678 CGCCTAGCCCTGCGAGGCCCGGG - Exonic
1031620979 7:123933224-123933246 CCCCGACCCCTGACAGGCCCTGG + Intronic
1031744564 7:125477899-125477921 CCCCCATCCCTGACAGGCCCTGG + Intergenic
1032496723 7:132368426-132368448 CCTGGATGCCTGGCAGGCCCAGG - Intronic
1034513321 7:151553657-151553679 CTCCAATGCCTGTGAGGCCCAGG + Intergenic
1034590684 7:152136443-152136465 AGCCGATGGCTGCCCTGCCCCGG - Exonic
1035027844 7:155837369-155837391 CGTCTATGCCAGCAAGGCCCAGG - Intergenic
1037910558 8:22741377-22741399 TGCCACTGTCTGCCAGGCCCAGG + Intronic
1041634229 8:60124823-60124845 CGCCCAACCCTGACAGGCCCTGG + Intergenic
1048303349 8:133267086-133267108 CCCCGAAGCCAGCCAGCCCCAGG + Intronic
1049621975 8:143602526-143602548 TGCCATCGCCTGCCAGGCCCTGG + Exonic
1049682441 8:143925603-143925625 CGCCTCTGCCTGCCGGGCCTTGG + Exonic
1051276522 9:15404295-15404317 AAACGATGCATGCCAGGCCCAGG + Intergenic
1052762214 9:32604274-32604296 TACAGCTGCCTGCCAGGCCCAGG + Intergenic
1053283385 9:36835843-36835865 CACCCATGCCTGCCTGGGCCTGG + Exonic
1053307709 9:36995813-36995835 CGCCCAGCCCTCCCAGGCCCAGG + Intronic
1056532239 9:87497966-87497988 CGCAGATCCCTCCCAGGCGCCGG - Exonic
1056597113 9:88016594-88016616 GGCCGAGGCCTGCCAGTCTCTGG - Intergenic
1057221917 9:93262034-93262056 CACCGCTGCCTGGCGGGCCCGGG + Exonic
1060583345 9:124770976-124770998 AGCCGGTTCCTGCCTGGCCCGGG + Intronic
1061289462 9:129642359-129642381 CGCCCCTTCCTGCCAGGGCCCGG + Intergenic
1061876476 9:133546588-133546610 CACCCATGCCAGCCAGGCCAGGG + Intronic
1062282297 9:135757457-135757479 CGACGTAGCCTGCCACGCCCCGG + Intronic
1062318909 9:135981000-135981022 CGCTGATGCCAGCCTGGCCATGG - Intergenic
1062463290 9:136670809-136670831 CCCCGCTGCCTGCCTGGCGCTGG - Intronic
1062519811 9:136952912-136952934 AGCTGTTGCCCGCCAGGCCCAGG - Exonic
1062532438 9:137007824-137007846 CCCCAGTGCCTGCCAGGGCCTGG - Exonic
1188016034 X:25109615-25109637 TGCCCACTCCTGCCAGGCCCAGG + Intergenic
1189318990 X:40075902-40075924 CCCCCAAGCCTGACAGGCCCAGG - Intronic
1190320553 X:49177085-49177107 CGCCCATTCCTGCCACGCCGAGG - Exonic
1194698930 X:97090394-97090416 CACCGCTGCCCGCCACGCCCGGG + Intronic
1195729674 X:107953734-107953756 CCCCAACCCCTGCCAGGCCCCGG + Intergenic
1199715989 X:150507731-150507753 CGCTGAAGCCTGCCCTGCCCCGG + Intronic
1200217592 X:154374843-154374865 CGGCGAGGGCCGCCAGGCCCTGG + Intergenic