ID: 1102352710

View in Genome Browser
Species Human (GRCh38)
Location 12:112206182-112206204
Sequence CCCAGGACGTTGTGGGTGAA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 254
Summary {0: 1, 1: 0, 2: 2, 3: 6, 4: 245}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1102352699_1102352710 10 Left 1102352699 12:112206149-112206171 CCATATCCTGTTGTTGCCTTAGG 0: 1
1: 0
2: 0
3: 13
4: 107
Right 1102352710 12:112206182-112206204 CCCAGGACGTTGTGGGTGAAAGG 0: 1
1: 0
2: 2
3: 6
4: 245
1102352701_1102352710 4 Left 1102352701 12:112206155-112206177 CCTGTTGTTGCCTTAGGCCCCAC 0: 1
1: 0
2: 0
3: 11
4: 114
Right 1102352710 12:112206182-112206204 CCCAGGACGTTGTGGGTGAAAGG 0: 1
1: 0
2: 2
3: 6
4: 245
1102352698_1102352710 13 Left 1102352698 12:112206146-112206168 CCTCCATATCCTGTTGTTGCCTT 0: 1
1: 0
2: 0
3: 16
4: 201
Right 1102352710 12:112206182-112206204 CCCAGGACGTTGTGGGTGAAAGG 0: 1
1: 0
2: 2
3: 6
4: 245
1102352702_1102352710 -6 Left 1102352702 12:112206165-112206187 CCTTAGGCCCCACAGTGCCCAGG 0: 1
1: 0
2: 0
3: 33
4: 381
Right 1102352710 12:112206182-112206204 CCCAGGACGTTGTGGGTGAAAGG 0: 1
1: 0
2: 2
3: 6
4: 245

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1102352710 Original CRISPR CCCAGGACGTTGTGGGTGAA AGG Intronic
900624258 1:3600926-3600948 CCCAGGACCTTGAGGCAGAATGG + Intronic
900717673 1:4155780-4155802 CCCAGGAGGTTGAGGCTGCAGGG - Intergenic
903207917 1:21796639-21796661 CCCAGGACGTGGAGGTTGCAGGG + Intergenic
904854744 1:33489320-33489342 CCCAGCAGGCTGGGGGTGAAGGG - Intronic
904940052 1:34159340-34159362 CCCAGGAGCTTGTGGTGGAAAGG + Intronic
906283472 1:44569848-44569870 CCCAGGACGATGCGGGTAGAGGG - Intronic
907319866 1:53595442-53595464 CCCAGGAGGTTGAGGCTGCAGGG + Intronic
910584684 1:88866276-88866298 CCCAGGAGGTTGAGGCTGCAGGG + Intronic
911086037 1:93978263-93978285 CCCAGGACTTTGAAGGAGAAAGG + Intergenic
912378168 1:109229878-109229900 CTCAGCAGGGTGTGGGTGAAGGG - Intronic
917014226 1:170511376-170511398 CCCCCTACGTTGTGGGTGAGTGG - Intergenic
923053025 1:230402023-230402045 GCCAGGAAGTGGTGGGTGACAGG + Intronic
924461569 1:244264329-244264351 CCAAGGATGAAGTGGGTGAAGGG + Intergenic
924813347 1:247422301-247422323 CCCAGGAGGTTGAGGCTGCAGGG + Intronic
1063374665 10:5546973-5546995 CCCAGGACTTTGTGTGGGCAGGG - Intergenic
1064019714 10:11799340-11799362 CCCAGGAGGTCGAGGCTGAAAGG - Intergenic
1065932857 10:30494746-30494768 CCCAGGAAGTGGTGAGAGAAAGG + Intergenic
1066489773 10:35883316-35883338 CCCAGGACCATGTGGGTTCAGGG - Intergenic
1067017552 10:42769422-42769444 CCCAGGACGCTGCAGGTTAAAGG - Intergenic
1067280920 10:44872138-44872160 CCCAGGAGGTTGAGGCTGCAGGG - Intergenic
1072281338 10:93868473-93868495 CCCAGGACTTTCCAGGTGAAAGG + Intergenic
1072650264 10:97289776-97289798 CCCAGGAGGTTGAGGCTGCAGGG + Intronic
1073419729 10:103414900-103414922 CCCAGGAAGTTGGCTGTGAAGGG + Intronic
1074375880 10:112940457-112940479 CCCAGCAGGTTGTGGGGGGAGGG - Intergenic
1074855401 10:117469536-117469558 TCCAGGACCTCGTGGGAGAAAGG - Intergenic
1076141631 10:128083732-128083754 CCCAGGCCGCTGTGGCAGAACGG - Exonic
1076401818 10:130189919-130189941 CCCTGGACGTTGGGGCTGCAGGG + Intergenic
1076494795 10:130889989-130890011 CCCAGGACCTTGTGGGCTGAGGG - Intergenic
1076529108 10:131132824-131132846 CCCAGGAGATTGTGGGTGGGAGG + Intronic
1077312262 11:1894307-1894329 CCCAGGAGGTTGAGGCTGCAAGG - Intergenic
1078640685 11:13092932-13092954 CCCAGCACTTTGTGGGGGCAAGG - Intergenic
1078651905 11:13203357-13203379 CCCAGCACTTTGTGAGTGCAAGG + Intergenic
1079067742 11:17312307-17312329 CCCAGGAGGTTGAGGCTGCAGGG - Intronic
1080356969 11:31460079-31460101 CCCAGGAGGTTGAGGCTGCAGGG + Intronic
1081594286 11:44448541-44448563 CCCAGGAAGTGCAGGGTGAAGGG - Intergenic
1083801567 11:65049094-65049116 CCCAGGAAGTTGAGGGTGTGGGG - Intronic
1084397283 11:68920556-68920578 CCCAGGAGGTTGAGGCTGCAGGG - Intronic
1085129532 11:74026229-74026251 CCCAGGAGTTTGCGGGTGCAGGG + Intronic
1085967280 11:81542666-81542688 CTCAGGATGATGTGGGTGGAGGG - Intergenic
1086945285 11:92838683-92838705 CCCAGGGCTTTGTGGGTGGAAGG + Intronic
1088727359 11:112651331-112651353 CCCAAGATGCTGGGGGTGAAGGG + Intergenic
1088883221 11:113987655-113987677 CCCAGGAGGTTGAGGCTGCAGGG + Intronic
1089670862 11:120056174-120056196 CCCAGGACTTGGTGAGTGATTGG + Intergenic
1090808018 11:130214911-130214933 CCCAGGAGGTTGAGGCTGCAGGG + Intergenic
1090847788 11:130545648-130545670 CCTAGGGTGTTGGGGGTGAAGGG - Intergenic
1090991402 11:131820147-131820169 ACCAGGCTGTTGTGGTTGAAAGG - Intronic
1091815825 12:3437086-3437108 CCCAGGAGGGTGGGGTTGAAGGG - Intronic
1092350298 12:7750751-7750773 CCCAGCACTTTGTGGGGCAAAGG + Intronic
1093840617 12:23895103-23895125 ACCAGGACTTTGTGGATGAGAGG - Intronic
1093955477 12:25212972-25212994 CCCAGGAGTTTGAGGTTGAAGGG - Intronic
1094561425 12:31557452-31557474 CCCAGGAGGTTGAGGCTGCAGGG - Intronic
1096085123 12:48860462-48860484 CCCAGGAGGTTGAGGCTGCAAGG - Intronic
1099686613 12:85897813-85897835 CCCAGGAGGTTGAGGCTGCAGGG + Intergenic
1102006788 12:109594204-109594226 CCCAGCACGTTGTGGGTGTTTGG + Intronic
1102352710 12:112206182-112206204 CCCAGGACGTTGTGGGTGAAAGG + Intronic
1102399016 12:112612638-112612660 CCCAGGAAGTTGAGGTTGCAGGG - Intronic
1102569016 12:113816064-113816086 CTCAAGGCGGTGTGGGTGAAGGG - Intergenic
1103630463 12:122255877-122255899 CCCAGGAGGTTGAGGCTGCAGGG - Intronic
1103754909 12:123197255-123197277 CCCAGGAAGTTGAGGCTGCAGGG - Intronic
1105566171 13:21550460-21550482 CCCAGGAGGTTGAGGCTGCAGGG + Intronic
1105680227 13:22718377-22718399 CACAGGACATTGTGAGTGGAGGG - Intergenic
1109711709 13:66169404-66169426 CCCAGGAGGTTGGGGCTGCAGGG - Intergenic
1109964678 13:69676530-69676552 CCCTGGACATTGAGGGTGATAGG - Intergenic
1111913690 13:94339138-94339160 CCCAGGAGGTTGAGGCTGCACGG - Intronic
1113469097 13:110531733-110531755 CCCAGGAGGTGGTGTGTAAATGG - Intronic
1115758148 14:36549995-36550017 CCCAGCACCTTATGGGTGACGGG + Intergenic
1118300316 14:64609176-64609198 CCCAGGAGGTTGAGGCTGCAGGG + Intergenic
1120781967 14:88493531-88493553 CCCAGGACGGGGCGGGTGAGAGG + Intronic
1121355153 14:93207598-93207620 CCCAGGAGGTTGGGGTTAAAAGG - Intronic
1122052484 14:99069556-99069578 CTCAGGTTGTTGTGGGGGAAAGG - Intergenic
1124944340 15:34249489-34249511 CCCAGGAGGTTGAGGCTGTAGGG + Intronic
1125033927 15:35101849-35101871 CCCAGGAAATTTTGGATGAAAGG + Intergenic
1128736187 15:70055230-70055252 GCCAGGGCGTCGTGGGGGAAGGG + Exonic
1130273809 15:82466108-82466130 CCTAGGACGTTGAGGCTGCAGGG + Intergenic
1130466157 15:84193480-84193502 CCTAGGACGTTGAGGCTGCAGGG + Intergenic
1130498106 15:84480056-84480078 CCTAGGACGTTGAGGCTGCAGGG - Intergenic
1130524105 15:84688953-84688975 CCCAGGAGGTGGAGGTTGAATGG + Intronic
1130588449 15:85198075-85198097 CCTAGGACGTTGAGGCTGCAGGG + Intergenic
1132229938 15:100174100-100174122 CCCTGGACTTTGTGGGAAAAAGG - Intronic
1133595972 16:7293101-7293123 CCAAGGACGTGGAGGGTCAACGG - Intronic
1134196541 16:12163410-12163432 CCCAGGGTGTTGAGGGTGACTGG + Intronic
1135597151 16:23753573-23753595 CCCAGGAGGTTGAGGCTGCAGGG - Intergenic
1136294969 16:29296277-29296299 CCAAGGACGTTGAGGGTGAAGGG + Intergenic
1138912739 16:61421946-61421968 CCCAGGATGCTGAGGCTGAAGGG + Intergenic
1140201160 16:72895746-72895768 CCCAGGAGGTGGAGGCTGAAGGG + Intronic
1140350339 16:74256546-74256568 CCCAGGAGGATGAGGCTGAAGGG + Intergenic
1140502807 16:75449401-75449423 CCCAGGAGGTTGAGGCTGCAGGG - Intronic
1141508681 16:84498342-84498364 CCCAGGAGGTTGAGGCTGCAGGG - Intronic
1141586789 16:85039376-85039398 CCCAGGAGGTTGAGGCTGCAGGG - Intronic
1142100863 16:88270286-88270308 CCAAGGACGTTGAGGGTGAAGGG + Intergenic
1142848493 17:2693318-2693340 CCCAGGAGGTTGAGGCTGCAGGG + Intronic
1143798463 17:9357618-9357640 CCCAGGAGGTTGAGGCTGCAGGG + Intronic
1145221308 17:21091755-21091777 CCCAGGAGGTTGAGGCTGCAGGG + Intergenic
1146005699 17:29159278-29159300 CATGGGACGTGGTGGGTGAAAGG - Intronic
1147579164 17:41618782-41618804 CCCAGGCAGGTGTGGGAGAAAGG - Intergenic
1148339823 17:46866786-46866808 CCCAGGATGTGGTGGGTGGGTGG - Intronic
1148572668 17:48682886-48682908 CCCAGGATGTTGAGGCTGCAGGG - Intergenic
1150457451 17:65318672-65318694 CCCAGGAGGTGGTGGTTGCAGGG - Intergenic
1150638413 17:66932816-66932838 CCCAGGATGGTGTCTGTGAAGGG - Intergenic
1150769802 17:68031307-68031329 CCCAGGAGGTTGAGGCTGCAGGG + Intergenic
1150807167 17:68328640-68328662 ACCAGGAGCTTGTAGGTGAAAGG + Intronic
1150822920 17:68450247-68450269 CTGAGGACGTGGTGGGAGAAGGG + Intronic
1151695985 17:75717797-75717819 CCCAGGAGGTTGAGGCTGCAGGG + Intergenic
1152347402 17:79761612-79761634 CCCAGGACTTTGAGGTTGCAGGG + Intergenic
1157335850 18:46736896-46736918 CCCTGGACTGTGTGGGTGGAGGG - Intronic
1158536322 18:58311435-58311457 CCCAGGGGGTTGAGGGTGCAAGG - Intronic
1159673411 18:71251414-71251436 CCCAGGCTTTTGTGGATGAAAGG - Intergenic
1159925226 18:74263070-74263092 CCCAGGAGGTTGAGGCTGCAGGG + Intronic
1160498806 18:79392241-79392263 CCCAGGAAGTTGGGGCTGCAGGG + Intergenic
1161198617 19:3001559-3001581 CCCAGGACTTTGAGGCTGTAGGG - Intronic
1162136272 19:8557370-8557392 CCCAGGAGGTTGAGGCTGCATGG - Intronic
1162461413 19:10816242-10816264 CTGAGGACATTGGGGGTGAAAGG + Intronic
1163024676 19:14503693-14503715 CCCAGGATGTTGAGGTTGCAGGG - Intergenic
1163180909 19:15600908-15600930 CCCAGGAGGTTGAGGTTGCAGGG + Intergenic
1164915081 19:32045831-32045853 CCCAGGAGGTTGAGGCTGCAGGG + Intergenic
1165287488 19:34853808-34853830 CCCAGGAAGGTGTGGGTCCATGG + Intergenic
1165402980 19:35613507-35613529 CCCAGGAGGTTGAGGCTGCAAGG + Intronic
1165486158 19:36097500-36097522 CCCAGGAGGTTGAGGCTGTAGGG + Intronic
1166661815 19:44652266-44652288 CCCAGGAGGTTGAGGCTGCAGGG - Intronic
1167027761 19:46933743-46933765 CCCAGGAAGCTGTGGTTGTAGGG + Intronic
1167644951 19:50700465-50700487 CCTGGAACCTTGTGGGTGAAAGG + Intronic
1168007686 19:53504455-53504477 TCCAGGGCGGTGTGGGTGGAGGG - Intergenic
1168365168 19:55780521-55780543 CCCAGGAAGTTGAGGCTGCAGGG + Intergenic
1168526414 19:57092002-57092024 CCCAGGAAGTTGAGGCTGCATGG + Intergenic
927167761 2:20342051-20342073 CCCAGGAGGTGGTGGTTGCATGG + Intronic
928491876 2:31792900-31792922 CCCAGGAGGTTGAGGCTGCAGGG - Intergenic
931330961 2:61282712-61282734 CCCAGGAGGTTGAGGCTGCAGGG + Intronic
931665482 2:64607249-64607271 CTCAGGATGTTGTGGTTGGAGGG - Intergenic
931705954 2:64946405-64946427 CCCAGCAGGATGTGGGTTAACGG - Intergenic
931858196 2:66326291-66326313 CCCAGGAGGTTGAGGCTGCAAGG + Intergenic
934474359 2:94583802-94583824 CCCAGCACTTTGTGGGGGCAAGG - Intergenic
935094869 2:99934710-99934732 CCCAGGGGGTTGTGAGTGAGGGG - Intronic
935303102 2:101711173-101711195 CCCACGACGTTAGGGCTGAAAGG + Intronic
936022805 2:109007682-109007704 CCCACAAAGTAGTGGGTGAAGGG - Intergenic
936448917 2:112618858-112618880 CCCAGGAGGTTGAGGCTGCAGGG - Intergenic
938789856 2:134666899-134666921 CCCAGGACGATGTCTCTGAAGGG - Intronic
939638665 2:144612900-144612922 GCCAGGAAGTTGAGGCTGAAGGG + Intergenic
940575240 2:155495234-155495256 CCCAGCACTTTGTGGGTCCAAGG + Intergenic
940685148 2:156839445-156839467 CCCAGGAGGTTGAGGCTGCAGGG + Intergenic
942160481 2:173180598-173180620 CCCAGGAGGTTGAGGCTGCAGGG + Intronic
944089458 2:195889564-195889586 CCCAGCACTTTGTGGGGGCAAGG - Intronic
944640581 2:201720636-201720658 CCCAGGAGGTTGAGGCTGCAGGG + Intronic
947536341 2:230942458-230942480 CCCAGGACGTTTTGCAGGAAGGG + Intronic
947625724 2:231617109-231617131 CCCAGGAAGTTGAGGCTGCAGGG - Intergenic
948534852 2:238638179-238638201 CACAGGGCGCTGTAGGTGAAAGG - Intergenic
1168836048 20:878126-878148 CCCAGGCCGTTGTGGGGGCTGGG - Intronic
1169354358 20:4895013-4895035 CGCTGGATGTTGTGGGTGAAGGG - Intronic
1170964319 20:21052689-21052711 CCCAGGACGCTGTAGCTGTAGGG + Intergenic
1172321303 20:33997189-33997211 CCCAGGAGGTTGAGGTTGCAGGG - Intronic
1174306000 20:49614803-49614825 CCCAGTGCTATGTGGGTGAAGGG - Intergenic
1174443316 20:50573520-50573542 CAAAGGATGGTGTGGGTGAAGGG - Intronic
1175791273 20:61741357-61741379 CCAAGGACTTTGCAGGTGAAAGG - Intronic
1176048469 20:63104549-63104571 CCCAGGACATTGGGGGCCAATGG + Intergenic
1180882010 22:19210981-19211003 CCCAGCACTTTGTGGGGGCAAGG - Intronic
1180930525 22:19587404-19587426 CCCAGGAGTTTGTGGCTGCAGGG - Intergenic
1181632490 22:24158563-24158585 CTCAGGACGCTGCGGGTGATGGG + Intronic
1182105504 22:27686213-27686235 CACAGGAGGATATGGGTGAAGGG + Intergenic
1183690484 22:39385177-39385199 CCCAGGAGTTTATGGGAGAAGGG + Exonic
1183902031 22:41013082-41013104 CCCAGGAGGTTGAGGCTGCAGGG + Intergenic
949486839 3:4547806-4547828 CTCAGGACTTAGTGGGTGATAGG + Intronic
950334147 3:12180471-12180493 CCCAGGATGCTCTGGGTGACTGG + Intronic
952255499 3:31691653-31691675 CCCAGGACTTTCTGGCTGCAGGG + Intronic
953955274 3:47227153-47227175 CCCAGGAGGTTGAGGCTGCAAGG + Intergenic
954535353 3:51355564-51355586 CCAAGGAAGCTGTGTGTGAAAGG - Intronic
956091070 3:65667645-65667667 CCCAGGAGGTTGAGGCTGCACGG - Intronic
962292151 3:134146023-134146045 CCCTGGAAGTTGTGGGTGAGGGG - Intronic
966881613 3:184354061-184354083 CCAAGGGGGCTGTGGGTGAAGGG - Intronic
969299685 4:6290644-6290666 CCCAGGCCGTTGGGGGTAAAGGG + Intronic
970913561 4:21307070-21307092 CCCAGGACTTTGGGGGTCCAAGG - Intronic
972644455 4:40954350-40954372 CCCAGGGCTTTGGGTGTGAAAGG + Intronic
974139307 4:57864342-57864364 CCCAGGACGTTGAGGATGCAGGG - Intergenic
976401503 4:84612018-84612040 CACAAGTCTTTGTGGGTGAAGGG + Intronic
976434874 4:85005717-85005739 CCCAGCACGTTGGGGGTCCAAGG + Intergenic
979175937 4:117664062-117664084 CCCAGAATGGAGTGGGTGAAGGG + Intergenic
981903707 4:149895294-149895316 CAGAGGACGGTGGGGGTGAAGGG + Intergenic
984761402 4:183365883-183365905 CCCAGGAGGTTGAGGCTGCAGGG + Intergenic
987387461 5:17343456-17343478 CCCAGGAGGTTGGGGCTGCAGGG + Intergenic
989624577 5:43416986-43417008 CCCAGGAAAGTGTGGATGAAAGG - Intergenic
992037326 5:72793018-72793040 CCCAGCACGTTGTGAGGCAAAGG - Intergenic
996058491 5:119006568-119006590 CCCAGGAGGTTGAGGCTGCAGGG + Intergenic
996811653 5:127522464-127522486 CCCAGGAGGTTGAGGCTGCAGGG - Intronic
996975972 5:129435111-129435133 CCCAAGAAGTTGAGGCTGAATGG - Intergenic
999211916 5:149896909-149896931 CCCAGGACCTTGTGCATCAATGG - Intronic
999579652 5:153022660-153022682 CCCAGGAGGTTGAGGCTGCAGGG + Intergenic
999876996 5:155818594-155818616 CCCAGGAGGTTGAGGCTGCAGGG - Intergenic
1001085679 5:168698702-168698724 GCCAGCACCTGGTGGGTGAAGGG - Intronic
1001214730 5:169845210-169845232 AGCAGGACTTGGTGGGTGAATGG - Intronic
1001242368 5:170080441-170080463 CCCAGGAAGTGGTGGGTGTGGGG - Intronic
1001565353 5:172696330-172696352 CCCAGGAGGTTGTAGGAGGATGG - Intergenic
1002123437 5:177023083-177023105 CCCAGCGCGCTGAGGGTGAAGGG + Intronic
1006963076 6:37953700-37953722 CCCAGGACATTGTGGGGTCAAGG - Intronic
1006974020 6:38079893-38079915 CCCAGGACTTTCTGGGTGTTGGG + Intronic
1011587488 6:88942444-88942466 CCCAGGAGGTTGAGGCTGCAGGG - Intronic
1011809778 6:91117714-91117736 CTCAGGAAGTTGTGAGTAAATGG - Intergenic
1012051570 6:94351694-94351716 CCCAGAACTTTGTGGGTCCAAGG + Intergenic
1012393629 6:98770929-98770951 CCCAGGAGGTTGAGGCTGCATGG + Intergenic
1012446561 6:99313040-99313062 CCCAGCACGTTGTGGGGCCAAGG + Intronic
1013606252 6:111751695-111751717 CCCAGGAGGTTGAGGCTGCAGGG - Intronic
1013610498 6:111790014-111790036 CCCAGAACCTTGGGGCTGAACGG + Intronic
1014193979 6:118531199-118531221 ATCAGGTGGTTGTGGGTGAATGG - Intronic
1014607468 6:123495127-123495149 CCCAGGAGGTTGGGGCTGCAGGG - Intronic
1015348882 6:132193634-132193656 CCCAGGACTTTGTGGGGCCAAGG + Intergenic
1015749851 6:136549564-136549586 CCCTGGAGGTTGTGGGGGAGGGG + Intronic
1017743129 6:157424772-157424794 CCCAGGCCGTTGTGATTGATTGG - Intronic
1018772274 6:166981815-166981837 CCCAGGAGGTTGAGGCTGCAGGG - Intergenic
1019362953 7:614999-615021 CCCAGGAGGTTGAGGCTGCAGGG + Intronic
1019428835 7:989229-989251 CCCAGGACCTGGGGGGTGCAGGG - Exonic
1019794232 7:3038092-3038114 CCCAGGAAGTTGAGGCTGCAGGG - Intronic
1022477582 7:30721914-30721936 CCCAGGATGTTGAAGCTGAAGGG - Intronic
1024215459 7:47244662-47244684 TCCAAGAGGTCGTGGGTGAAGGG - Intergenic
1024712495 7:52032520-52032542 CCCAGGAGGTTGAGGCTGCAGGG + Intergenic
1026020528 7:66701421-66701443 CCCAGGAGGTTGAGGCTGCAGGG + Intronic
1026482428 7:70790283-70790305 CCCATGACGGTGGGGGTGACGGG + Exonic
1026879747 7:73900938-73900960 CCCAGGAGGTTGAGGCTGCAGGG - Intergenic
1027924484 7:84443960-84443982 CCCAGGAGGTGGAGGTTGAAGGG - Intronic
1029167590 7:98604415-98604437 CCCAGGAGGTTGAGGCTGCAGGG - Intergenic
1031508659 7:122620980-122621002 CCCAGGAGGTTGAGGGTACATGG - Intronic
1032029471 7:128470609-128470631 CCCAGGAAGTTGAGGCTGCAGGG - Intergenic
1033104104 7:138504040-138504062 CCCATGATGATGTGGGGGAAGGG + Intronic
1033442771 7:141395363-141395385 CCCAGGAGGTTGAGGCTGCAGGG + Intronic
1033786256 7:144734595-144734617 CCCAGGAGGTTGAGGCTGCAGGG - Intronic
1035761311 8:2070913-2070935 GCCAGGACGGTGTGGGAGACGGG - Intronic
1036722167 8:11186450-11186472 CCCAGGAGGTTGAGGCTGCAGGG - Intronic
1040027476 8:42795231-42795253 CCCAGGAAGTTGAGGCTGCAGGG + Intronic
1041926713 8:63244279-63244301 CCCTGGTTGTTGTGTGTGAATGG - Intergenic
1049207935 8:141372033-141372055 CCCAGGAGGTGCTGGGTGAGTGG + Intergenic
1049856483 8:144865144-144865166 ACCAGGAAGGAGTGGGTGAATGG + Intergenic
1049975449 9:857229-857251 CCCAGGACGTGGAGGTTGCAGGG + Intronic
1052292192 9:26855086-26855108 TCCAAGATGTTATGGGTGAATGG + Intronic
1053683713 9:40502307-40502329 CCCAGCACTTTGTGGGGGCAAGG + Intergenic
1054280003 9:63122619-63122641 CCCAGCACTTTGTGGGGGCAAGG - Intergenic
1054296814 9:63337799-63337821 CCCAGCACTTTGTGGGGGCAAGG + Intergenic
1054394831 9:64642305-64642327 CCCAGCACTTTGTGGGGGCAAGG + Intergenic
1054429479 9:65147505-65147527 CCCAGCACTTTGTGGGGGCAAGG + Intergenic
1054500903 9:65874026-65874048 CCCAGCACTTTGTGGGGGCAAGG - Intergenic
1056621819 9:88221237-88221259 GCCAGGAGGTTTTGGGGGAAGGG - Intergenic
1057143559 9:92743266-92743288 CCCAGGAGGTTAAGGCTGAAGGG - Intronic
1059304281 9:113341591-113341613 GCCAGGCTGTTGTGGGGGAAAGG - Intergenic
1060217803 9:121748907-121748929 CCCAGGGCGTTCTGTGTGTATGG + Intronic
1061004334 9:127920027-127920049 CCCAGGAGGTTGAGGCTGCAAGG + Intergenic
1061766939 9:132887495-132887517 TCCAGGAGGTTGTTGGTGACTGG - Exonic
1062546323 9:137065168-137065190 CCCAGGACTTTGGGGCTGCAGGG - Exonic
1185939862 X:4304452-4304474 CCCAGGAGGTTGAGGCTGCAGGG + Intergenic
1186100038 X:6146037-6146059 CCCAGGAGGTTGAGGCTGCAGGG + Intronic
1187198466 X:17110936-17110958 CCCAGGAGGTTGAGGTTGCAGGG + Intronic
1187912227 X:24121452-24121474 CCCAGCACTTTGTGGGGCAAAGG + Intergenic
1188684964 X:33058358-33058380 CCCAGGAAGTTGAGGCTGCAGGG - Intronic
1189111212 X:38291800-38291822 ACCAGGACGTTGTAGGTCATTGG - Intronic
1189471312 X:41316302-41316324 CCCAGGAGGTTGAGGCTGCAGGG + Intergenic
1198101888 X:133429238-133429260 CCCAGGAGGTTGAGGCTGCAGGG - Intergenic
1198951581 X:142078179-142078201 TGCAGGACGTGGTGGGTGCATGG + Intergenic
1200256970 X:154587766-154587788 CCCAGGAGGTGGAGGGTGCAGGG + Intergenic
1200260799 X:154616636-154616658 CCCAGGAGGTGGAGGGTGCAGGG - Intergenic
1201295543 Y:12460245-12460267 CCCAGGAAGTTGAGGCTGCAGGG - Intergenic